| geneid | 8714 |
|---|---|
| ensemblid | ENSG00000108846.16 |
| hgncid | 54 |
| symbol | ABCC3 |
| name | ATP binding cassette subfamily C member 3 |
| refseq_nuc | NM_003786.4 |
| refseq_prot | NP_003777.2 |
| ensembl_nuc | ENST00000285238.13 |
| ensembl_prot | ENSP00000285238.8 |
| mane_status | MANE Select |
| chr | chr17 |
| start | 50634881 |
| end | 50692253 |
| strand | + |
| ver | v1.2 |
| region | chr17:50634881-50692253 |
| region5000 | chr17:50629881-50697253 |
| regionname0 | ABCC3_chr17_50634881_50692253 |
| regionname5000 | ABCC3_chr17_50629881_50697253 |
| chr:pos | ref | alt | af | annotation | impact | samples | AHAPIDS | ACHAPIDS | ACTHAPIDS | ACTGHAPIDS | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr17:50673462
|
T | TCCCCAGA others(15): Show |
0.0029 | frameshift_variant | HIGH | NA19067.hp1 | a0001 | a0001c0001 | a0001c0001t0001 | a0001c0001t0001g0038 | 1 | 342 | 22 | ABCC3 | ENSG00000108846.16 | transcript | ENST00000285238.13 | protein_coding | 19/31 | c.2410-5_2426dupCCCAGACGCGAGTGCTGGTGAC | p.His810fs | 2483/5693 | 2427/4584 | 809/1527 | INFO_REALIGN_3_PRIME |
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
ahapid | alen | total | AFR | AMR | EAS | EUR | SAS | aseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABCC3 | 1/1 | a0001 | 1527 | 286 | 47 | 56 | 139 | 9 | 33 | subcellular location copy fasta | chr17 | 50629881 | 50697253 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
chapid | clen | total | AFR | AMR | EAS | EUR | SAS | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABCC3 | 1/0 | c0001 | 4584 | 204 | 31 | 42 | 104 | 5 | 21 | copy fasta | chr17 | 50629881 | 50697253 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
achapid | total | AFR | AMR | EAS | EUR | SAS | clen | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABCC3 | 1/0 | a0001c0001 | 204 | 31 | 42 | 104 | 5 | 21 | 4584 | copy fasta | chr17 | 50629881 | 50697253 |
Click to load Haplotype QTL data...
| pos | S. Strand |
E# Exon Number |
max | median | min | diff | type | haplotypeid | max_hap_list | min_hap_list | symbol | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 50634981 | + | 1 | -0.7846 | -0.7440 | -0.7424 | 0.0422 | acceptor | a0001c0001 | NA18973.hp2 | NA18955.hp1 NA19010.hp2 |
ABCC3 | chr17 | 50629881 | 50697253 |
| 50655832 | + | 2 | 0.9970 | 0.9964 | 0.9960 | 0.0010 | donor | a0001c0001 | HG01175.hp1 HG01928.hp2 HG01934.hp2 HG02293.hp1 HG03491.hp2 others(1): Show |
HG01192.hp2 HG02148.hp2 |
ABCC3 | chr17 | 50629881 | 50697253 |
| 50656008 | + | 2 | -0.9946 | -0.9934 | -0.9930 | 0.0015 | acceptor | a0001c0001 | HG01928.hp2 HG01934.hp2 HG02293.hp1 HG03491.hp2 HG04199.hp2 |
HG01261.hp2 HG02818.hp1 HG03130.hp1 HG03486.hp2 |
ABCC3 | chr17 | 50629881 | 50697253 |
| 50656702 | + | 3 | 0.9456 | 0.9433 | 0.9392 | 0.0064 | donor | a0001c0001 | NA20129.hp1 | HG02486.hp2 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50656827 | + | 3 | -0.7197 | -0.7126 | -0.6899 | 0.0298 | acceptor | a0001c0001 | NA18981.hp1 | NA18982.hp2 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50657046 | + | 4 | 0.9872 | 0.9732 | 0.9726 | 0.0146 | donor | a0001c0001 | HG02486.hp2 | homoSapiens_grch38.hp1 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50657183 | + | 4 | -0.9968 | -0.9956 | -0.9955 | 0.0013 | acceptor | a0001c0001 | HG02486.hp2 | HG01069.hp1 NA18979.hp2 NA18988.hp1 |
ABCC3 | chr17 | 50629881 | 50697253 |
| 50658082 | + | 5 | 0.9789 | 0.9785 | 0.9668 | 0.0120 | donor | a0001c0001 | NA18942.hp2 | HG02486.hp2 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50658207 | + | 5 | -0.9888 | -0.9887 | -0.9815 | 0.0074 | acceptor | a0001c0001 | NA18983.hp2 | HG02486.hp2 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50658435 | + | 6 | 0.9808 | 0.9792 | 0.9775 | 0.0033 | donor | a0001c0001 | NA18954.hp2 | HG02486.hp2 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50658496 | + | 6 | -0.9806 | -0.9767 | -0.9749 | 0.0057 | acceptor | a0001c0001 | HG03516.hp1 NA18983.hp2 |
HG02486.hp2 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50659237 | + | 7 | 0.9689 | 0.9637 | 0.9625 | 0.0064 | donor | a0001c0001 | NA18942.hp2 | HG02055.hp2 HG02109.hp2 HG03130.hp2 |
ABCC3 | chr17 | 50629881 | 50697253 |
| 50659368 | + | 7 | -0.9973 | -0.9964 | -0.9964 | 0.0009 | acceptor | a0001c0001 | HG02970.hp1 | NA18973.hp1 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50660923 | + | 8 | 0.9755 | 0.9578 | 0.9515 | 0.0240 | donor | a0001c0001 | NA18992.hp2 | HG03516.hp1 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50661114 | + | 8 | -0.9535 | -0.9465 | -0.9172 | 0.0363 | acceptor | a0001c0001 | HG00642.hp2 HG01261.hp2 |
HG02145.hp2 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50663681 | + | 9 | 0.8909 | 0.8750 | 0.8619 | 0.0290 | donor | a0001c0001 | HG02486.hp2 | HG02055.hp2 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50663858 | + | 9 | -0.9072 | -0.8785 | -0.8736 | 0.0336 | acceptor | a0001c0001 | HG02055.hp2 | HG02717.hp1 HG02818.hp2 HG03098.hp1 |
ABCC3 | chr17 | 50629881 | 50697253 |
| 50663950 | + | 10 | 0.9064 | 0.8979 | 0.8898 | 0.0165 | donor | a0001c0001 | HG03516.hp1 | HG02717.hp1 HG02818.hp2 HG03098.hp1 |
ABCC3 | chr17 | 50629881 | 50697253 |
| 50664111 | + | 10 | -0.9834 | -0.9826 | -0.9792 | 0.0042 | acceptor | a0001c0001 | NA19063.hp2 | NA18612.hp1 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50665153 | + | 11 | 0.9704 | 0.9674 | 0.9622 | 0.0082 | donor | a0001c0001 | NA18941.hp2 | NA19084.hp2 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50665245 | + | 11 | -0.9958 | -0.9947 | -0.9934 | 0.0024 | acceptor | a0001c0001 | HG01167.hp2 | HG00099.hp2 HG01109.hp2 HG02622.hp2 HG02647.hp1 HG02970.hp1 others(1): Show |
ABCC3 | chr17 | 50629881 | 50697253 |
| 50667554 | + | 12 | 0.9993 | 0.9992 | 0.9991 | 0.0001 | donor | a0001c0001 | HG01952.hp1 HG02486.hp2 HG02717.hp1 HG02818.hp2 HG03098.hp1 others(3): Show |
HG04199.hp1 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50667757 | + | 12 | -0.9964 | -0.9964 | -0.9913 | 0.0051 | acceptor | a0001c0001 | HG02040.hp2 NA18971.hp2 NA18990.hp1 NA19002.hp2 NA19066.hp2 others(1): Show |
NA18983.hp1 NA18988.hp1 NA19011.hp1 |
ABCC3 | chr17 | 50629881 | 50697253 |
| 50667863 | + | 13 | 0.9964 | 0.9962 | 0.9833 | 0.0131 | donor | a0001c0001 | NA18974.hp2 | NA18983.hp1 NA19011.hp1 |
ABCC3 | chr17 | 50629881 | 50697253 |
| 50668009 | + | 13 | -0.9950 | -0.9949 | -0.9924 | 0.0026 | acceptor | a0001c0001 | HG02135.hp2 NA19084.hp2 |
NA18983.hp1 NA19011.hp1 |
ABCC3 | chr17 | 50629881 | 50697253 |
| 50668430 | + | 14 | 0.9010 | 0.8959 | 0.8823 | 0.0187 | donor | a0001c0001 | NA19083.hp1 | NA18988.hp1 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50668517 | + | 14 | -0.7898 | -0.7740 | -0.7539 | 0.0359 | acceptor | a0001c0001 | NA18974.hp2 | NA19066.hp2 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50668853 | + | 15 | 0.8082 | 0.7933 | 0.7816 | 0.0266 | donor | a0001c0001 | HG00408.hp1 HG00639.hp1 HG00738.hp2 HG02080.hp1 HG02083.hp1 others(10): Show |
HG02040.hp2 NA18971.hp2 NA18990.hp1 NA19002.hp2 |
ABCC3 | chr17 | 50629881 | 50697253 |
| 50668919 | + | 15 | -0.8960 | -0.8911 | -0.8854 | 0.0106 | acceptor | a0001c0001 | NA18974.hp2 | NA19066.hp2 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50669140 | + | 16 | 0.9614 | 0.9576 | 0.9536 | 0.0079 | donor | a0001c0001 | homoSapiens_grch38.hp1 | NA18983.hp1 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50669266 | + | 16 | -0.9925 | -0.9884 | -0.9882 | 0.0043 | acceptor | a0001c0001 | NA18974.hp2 | NA18983.hp1 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50669352 | + | 17 | 0.9956 | 0.9663 | 0.9615 | 0.0341 | donor | a0001c0001 | NA18974.hp2 | HG02647.hp1 HG02970.hp1 |
ABCC3 | chr17 | 50629881 | 50697253 |
| 50669528 | + | 17 | -0.9995 | -0.9981 | -0.9980 | 0.0015 | acceptor | a0001c0001 | NA18974.hp2 | NA19083.hp1 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50672971 | + | 18 | 0.9980 | 0.9973 | 0.9968 | 0.0012 | donor | a0001c0001 | NA18906.hp1 | HG02630.hp2 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50673138 | + | 18 | -0.9958 | -0.9952 | -0.9941 | 0.0017 | acceptor | a0001c0001 | NA18940.hp1 | NA19065.hp2 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50673469 | + | 19 | 0.9667 | 0.9525 | 0.0195 | 0.9472 | donor | a0001c0001 | NA19084.hp1 | NA19067.hp1 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50673658 | + | 19 | -0.9818 | -0.9748 | -0.9663 | 0.0155 | acceptor | a0001c0001 | NA19065.hp2 | NA18969.hp2 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50675362 | + | 20 | 0.9994 | 0.9993 | 0.9992 | 0.0001 | donor | a0001c0001 | HG00099.hp2 HG02622.hp2 NA19067.hp2 NA20300.hp2 |
HG02273.hp1 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50675476 | + | 20 | -0.9997 | -0.9997 | -0.9996 | 0.0001 | acceptor | a0001c0001 | HG00280.hp1 HG01361.hp1 |
HG00558.hp1 HG01169.hp1 HG02056.hp1 HG03927.hp1 |
ABCC3 | chr17 | 50629881 | 50697253 |
| 50675631 | + | 21 | 0.7778 | 0.7613 | 0.7501 | 0.0277 | donor | a0001c0001 | HG02630.hp2 | NA18906.hp1 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50675775 | + | 21 | -0.8535 | -0.8435 | -0.8351 | 0.0184 | acceptor | a0001c0001 | HG00099.hp2 | HG01123.hp2 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50675883 | + | 22 | 0.9958 | 0.9955 | 0.9953 | 0.0004 | donor | a0001c0001 | HG02647.hp1 | HG01167.hp2 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50676090 | + | 22 | -0.9973 | -0.9971 | -0.9969 | 0.0004 | acceptor | a0001c0001 | homoSapiens_grch38.hp1 | NA18981.hp1 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50676278 | + | 23 | 0.9835 | 0.9818 | 0.9803 | 0.0032 | donor | a0001c0001 | HG01109.hp2 | HG02818.hp1 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50676588 | + | 23 | -0.9917 | -0.9906 | -0.9896 | 0.0021 | acceptor | a0001c0001 | HG02572.hp1 | HG03516.hp1 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50677744 | + | 24 | 0.9953 | 0.9944 | 0.9937 | 0.0016 | donor | a0001c0001 | NA19077.hp1 | HG02572.hp1 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50677943 | + | 24 | -0.9930 | -0.9928 | -0.9925 | 0.0005 | acceptor | a0001c0001 | HG03516.hp1 | NA18612.hp1 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50678093 | + | 25 | 0.9634 | 0.9629 | 0.9615 | 0.0019 | donor | a0001c0001 | HG03834.hp2 | NA18612.hp1 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50678219 | + | 25 | -0.9918 | -0.9909 | -0.9889 | 0.0029 | acceptor | a0001c0001 | NA18940.hp1 | NA18612.hp1 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50679798 | + | 26 | 0.9850 | 0.9801 | 0.9740 | 0.0110 | donor | a0001c0001 | NA18963.hp1 NA18973.hp1 |
NA18612.hp1 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50679899 | + | 26 | -0.9935 | -0.9925 | -0.9867 | 0.0068 | acceptor | a0001c0001 | HG01069.hp1 HG01070.hp2 HG01169.hp2 HG01192.hp2 HG01261.hp1 others(4): Show |
NA18612.hp1 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50683610 | + | 27 | 0.9965 | 0.9951 | 0.9948 | 0.0017 | donor | a0001c0001 | HG01993.hp1 HG03669.hp1 NA19000.hp2 |
HG00099.hp2 HG00280.hp1 HG00323.hp1 HG00408.hp1 HG00408.hp2 others(65): Show |
ABCC3 | chr17 | 50629881 | 50697253 |
| 50683756 | + | 27 | -0.9941 | -0.9923 | -0.9920 | 0.0021 | acceptor | a0001c0001 | HG02055.hp2 | NA20129.hp1 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50683949 | + | 28 | 0.9954 | 0.9950 | 0.9943 | 0.0011 | donor | a0001c0001 | NA18992.hp1 | HG00639.hp1 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50684107 | + | 28 | -0.9996 | -0.9996 | -0.9996 | 0.0000 | acceptor | a0001c0001 | HG02922.hp2 | HG00099.hp2 HG00280.hp1 HG00323.hp1 HG00408.hp1 HG00408.hp2 others(71): Show |
ABCC3 | chr17 | 50629881 | 50697253 |
| 50684709 | + | 29 | 0.9602 | 0.9584 | 0.9527 | 0.0075 | donor | a0001c0001 | HG00423.hp2 NA19078.hp2 |
HG01167.hp2 HG01169.hp1 HG04184.hp1 |
ABCC3 | chr17 | 50629881 | 50697253 |
| 50684875 | + | 29 | -0.9787 | -0.9780 | -0.9770 | 0.0017 | acceptor | a0001c0001 | HG00733.hp1 | NA19068.hp1 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50687536 | + | 30 | 0.9498 | 0.9426 | 0.9424 | 0.0074 | donor | a0001c0001 | NA18974.hp2 NA19077.hp1 |
NA18941.hp2 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50687730 | + | 30 | -0.9888 | -0.9879 | -0.9865 | 0.0023 | acceptor | a0001c0001 | HG01346.hp1 | HG02818.hp1 | ABCC3 | chr17 | 50629881 | 50697253 |
| 50691092 | + | 31 | 0.8555 | 0.8371 | 0.8293 | 0.0262 | donor | a0001c0001 | HG01346.hp1 | HG02015.hp2 HG02083.hp2 HG03834.hp1 NA19066.hp2 |
ABCC3 | chr17 | 50629881 | 50697253 |
| pos | annotationhgvs_chgvs_p | clinvarid | clnsig | geneinfo | mc | clndisdb | strand strand
|
ahapid ahapid_count
|
chapid chapid count
|
thapid thapid_count
|
ghapid ghapid_count
|
AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
impact | chr | ref | alt | external |
|---|
| CHR:POS | annotationhgvs_chgvs_p | disease trait-log10podds or beta | AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
study | initial sample size/replication sample size | report genes | mapped gene | strongest snp risk allele | strand strand
|
impact | chr | ref | alt |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr17:50675239
|
c.2600-123C>T | X-16935 levels0.107768 | a0001a0006a0010a0012a0013others(4): Show | a0001c0001a0001c0004a0001c0014a0001c0024a0001c0026others(9): Show | a0001c0001t0001a0001c0004t0001a0001c0014t0001a0001c0024t0001a0001c0026t0001others(9): Show | a0001c0001t0001g0010a0001c0001t0001g0012a0001c0001t0001g0017a0001c0001t0001g0018a0001c0001t0001g0019others(103): Show | HG00323.hp2 HG00438.hp2 HG00544.hp1 HG00642.hp2 HG00738.hp1 others(103): Show |
Genomic atlas of the plasma metabolome prioritizes others(42): Show |
7,804 European ancestry individuals/ | ABCC3 | rs4148415-T | + | MODIFIER | chr17 | C | T | |
|
chr17:50675505
|
c.2714+29C>T | X-21441 levels0.102981 | a0001a0006a0010a0012a0013others(4): Show | a0001c0001a0001c0004a0001c0014a0001c0024a0001c0026others(9): Show | a0001c0001t0001a0001c0004t0001a0001c0014t0001a0001c0024t0001a0001c0026t0001others(9): Show | a0001c0001t0001g0010a0001c0001t0001g0012a0001c0001t0001g0017a0001c0001t0001g0018a0001c0001t0001g0019others(103): Show | HG00323.hp2 HG00438.hp2 HG00544.hp1 HG00642.hp2 HG00738.hp1 others(103): Show |
Genomic atlas of the plasma metabolome prioritizes others(42): Show |
8,030 European ancestry individuals/ | ABCC3 | rs2072365-T | + | MODIFIER | chr17 | C | T | |
|
chr17:50675239
|
c.2600-123C>T |
Pregnanediol-3-glucuronide levels0.10233 others(1): Show |
a0001a0006a0010a0012a0013others(4): Show | a0001c0001a0001c0004a0001c0014a0001c0024a0001c0026others(9): Show | a0001c0001t0001a0001c0004t0001a0001c0014t0001a0001c0024t0001a0001c0026t0001others(9): Show | a0001c0001t0001g0010a0001c0001t0001g0012a0001c0001t0001g0017a0001c0001t0001g0018a0001c0001t0001g0019others(103): Show | HG00323.hp2 HG00438.hp2 HG00544.hp1 HG00642.hp2 HG00738.hp1 others(103): Show |
Genomic atlas of the plasma metabolome prioritizes others(42): Show |
7,905 European ancestry individuals/ | ABCC3 | rs4148415-T | + | MODIFIER | chr17 | C | T | |
|
chr17:50635862
|
c.45+881G>A | Severe COVID-19 infection | a0001a0002a0003a0004a0005others(16): Show | a0001c0001a0001c0002a0001c0003a0001c0004a0001c0009others(31): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0002t0001others(36): Show | a0001c0001t0001g0031a0001c0001t0001g0034a0001c0001t0001g0035a0001c0001t0001g0036a0001c0001t0001g0038others(246): Show | HG00099.hp2 HG00280.hp1 HG00280.hp2 HG00408.hp1 HG00423.hp1 others(246): Show |
Better safe than sorry-Whole-genome sequencing ind others(76): Show |
235 severe cases, up to 841 resistant, benign or m others(13): Show |
ABCC3 | rs10153257-? | + | MODIFIER | chr17 | G | A | |
|
chr17:50679576
|
c.3706-222C>T |
Glycochenodeoxycholate glucuronide (1) levels others(13): Show |
a0001a0010a0012a0018 | a0001c0001a0001c0004a0001c0014a0001c0024a0001c0026others(4): Show | a0001c0001t0001a0001c0004t0001a0001c0014t0001a0001c0024t0001a0001c0026t0001others(4): Show | a0001c0001t0001g0010a0001c0001t0001g0012a0001c0001t0001g0017a0001c0001t0001g0018a0001c0001t0001g0019others(89): Show | HG00323.hp2 HG00438.hp2 HG00642.hp2 HG00738.hp1 HG01069.hp1 others(89): Show |
Genomic atlas of the plasma metabolome prioritizes others(42): Show |
8,236 European ancestry individuals/ | ABCC3 | rs3785912-T | + | MODIFIER | chr17 | C | T | |
|
chr17:50662481
|
c.999-1200T>C | Abnormal dreams on treatment with varenicline in smokersothers(20): Show | a0001a0002a0003a0014a0017others(2): Show | a0001c0001a0001c0002a0001c0003a0001c0004a0001c0009others(14): Show | a0001c0001t0001a0001c0001t0002a0001c0002t0001a0001c0003t0001a0001c0004t0001others(16): Show | a0001c0001t0001g0010a0001c0001t0001g0011a0001c0001t0001g0012a0001c0001t0001g0013a0001c0001t0001g0019others(129): Show | HG00280.hp1 HG00280.hp2 HG00323.hp2 HG00423.hp1 HG00438.hp2 others(129): Show |
Genetic Prediction of Smoking Cessation Medication others(77): Show |
188 European ancestry individuals/137 African ance others(16): Show |
ABCC3 | rs1137449-C | + | MODIFIER | chr17 | T | C | |
|
chr17:50634726
|
c.-211C>T |
Glycochenodeoxycholate glucuronide (1) levels others(9): Show |
a0001a0002a0003a0004a0005others(16): Show | a0001c0001a0001c0002a0001c0003a0001c0004a0001c0009others(31): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0002t0001a0001c0002t0006others(35): Show | a0001c0001t0001g0031a0001c0001t0001g0034a0001c0001t0001g0035a0001c0001t0001g0036a0001c0001t0001g0038others(242): Show | HG00280.hp1 HG00280.hp2 HG00408.hp1 HG00423.hp1 HG00423.hp2 others(242): Show |
Genome-wide association studies of metabolites in others(43): Show |
6,136 Finnish ancestry individuals/ | CACNA1G - ABCC3 | rs4793665-T | + | MODIFIER | chr17 | C | T | |
|
chr17:50688763
|
c.4475+1033G>A | X-11491 levels0.073718145 | a0001a0010a0012 | a0001c0001a0001c0004a0001c0014a0001c0024a0001c0026others(3): Show | a0001c0001t0001a0001c0004t0001a0001c0014t0001a0001c0024t0001a0001c0026t0001others(3): Show | a0001c0001t0001g0010a0001c0001t0001g0011a0001c0001t0001g0012a0001c0001t0001g0017a0001c0001t0001g0018others(87): Show | HG00323.hp2 HG00438.hp2 HG00642.hp2 HG00738.hp1 HG01069.hp1 others(87): Show |
Rare and common genetic determinants of metabolic others(48): Show |
14,296 European ancestry individuals/5,698 Europea others(22): Show |
ABCC3 | rs12946683-A | + | MODIFIER | chr17 | G | A | |
|
chr17:50676879
|
c.3378+291T>G | X-16935 levels0.10491943 | a0001a0010a0012a0017a0018 | a0001c0001a0001c0004a0001c0014a0001c0024a0001c0026others(5): Show | a0001c0001t0001a0001c0004t0001a0001c0014t0001a0001c0024t0001a0001c0026t0001others(5): Show | a0001c0001t0001g0010a0001c0001t0001g0012a0001c0001t0001g0017a0001c0001t0001g0018a0001c0001t0001g0019others(96): Show | HG00323.hp2 HG00438.hp2 HG00642.hp2 HG00738.hp1 HG01069.hp1 others(96): Show |
Rare and common genetic determinants of metabolic others(48): Show |
14,296 European ancestry individuals/5,698 Europea others(22): Show |
ABCC3 | rs12943812-T | + | MODIFIER | chr17 | T | G | |
|
chr17:50675505
|
c.2714+29C>T | X-17612 levels0.0693718 | a0001a0006a0010a0012a0013others(4): Show | a0001c0001a0001c0004a0001c0014a0001c0024a0001c0026others(9): Show | a0001c0001t0001a0001c0004t0001a0001c0014t0001a0001c0024t0001a0001c0026t0001others(9): Show | a0001c0001t0001g0010a0001c0001t0001g0012a0001c0001t0001g0017a0001c0001t0001g0018a0001c0001t0001g0019others(103): Show | HG00323.hp2 HG00438.hp2 HG00544.hp1 HG00642.hp2 HG00738.hp1 others(103): Show |
Rare and common genetic determinants of metabolic others(48): Show |
14,296 European ancestry individuals/5,698 Europea others(22): Show |
ABCC3 | rs2072365-T | + | MODIFIER | chr17 | C | T | |
|
chr17:50674400
|
c.2599+742G>A | X-21441 levels0.075929664 | a0001a0010a0012a0017a0018 | a0001c0001a0001c0004a0001c0014a0001c0024a0001c0026others(5): Show | a0001c0001t0001a0001c0004t0001a0001c0014t0001a0001c0024t0001a0001c0026t0001others(5): Show | a0001c0001t0001g0010a0001c0001t0001g0012a0001c0001t0001g0017a0001c0001t0001g0018a0001c0001t0001g0019others(91): Show | HG00323.hp2 HG00438.hp2 HG00642.hp2 HG00738.hp1 HG01069.hp1 others(91): Show |
Rare and common genetic determinants of metabolic others(48): Show |
14,296 European ancestry individuals/5,698 Europea others(22): Show |
ABCC3 | rs11658264-A | + | MODIFIER | chr17 | G | A | |
|
chr17:50693156
|
c.*1956G>A | X-24588 levels0.13 | a0001a0002a0003a0004a0006others(10): Show | a0001c0001a0001c0002a0001c0003a0001c0004a0001c0009others(20): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0002t0001others(27): Show | a0001c0001t0001g0008a0001c0001t0001g0013a0001c0001t0001g0016a0001c0001t0001g0031a0001c0001t0001g0034others(150): Show | HG00099.hp1 HG00099.hp2 HG00280.hp1 HG00323.hp1 HG00408.hp1 others(150): Show |
Genome-wide association studies of metabolites in others(43): Show |
6,136 Finnish ancestry individuals/ | ABCC3 - ANKRD40 | rs4148418-A | + | MODIFIER | chr17 | G | A | |
|
chr17:50674400
|
c.2599+742G>A |
Glycochenodeoxycholate glucuronide (1) levels others(15): Show |
a0001a0010a0012a0017a0018 | a0001c0001a0001c0004a0001c0014a0001c0024a0001c0026others(5): Show | a0001c0001t0001a0001c0004t0001a0001c0014t0001a0001c0024t0001a0001c0026t0001others(5): Show | a0001c0001t0001g0010a0001c0001t0001g0012a0001c0001t0001g0017a0001c0001t0001g0018a0001c0001t0001g0019others(91): Show | HG00323.hp2 HG00438.hp2 HG00642.hp2 HG00738.hp1 HG01069.hp1 others(91): Show |
Rare and common genetic determinants of metabolic others(48): Show |
14,296 European ancestry individuals/5,698 Europea others(22): Show |
ABCC3 | rs11658264-A | + | MODIFIER | chr17 | G | A | |
|
chr17:50676879
|
c.3378+291T>G | Eicosanoid 11t LTD4 levels0.12 | a0001a0010a0012a0017a0018 | a0001c0001a0001c0004a0001c0014a0001c0024a0001c0026others(5): Show | a0001c0001t0001a0001c0004t0001a0001c0014t0001a0001c0024t0001a0001c0026t0001others(5): Show | a0001c0001t0001g0010a0001c0001t0001g0012a0001c0001t0001g0017a0001c0001t0001g0018a0001c0001t0001g0019others(96): Show | HG00323.hp2 HG00438.hp2 HG00642.hp2 HG00738.hp1 HG01069.hp1 others(96): Show |
A genome-wide association study identifies 41 loci others(35): Show |
1,910 African American individuals, 6,496 European others(22): Show |
ABCC3 | rs12943812-? | + | MODIFIER | chr17 | T | G |