| geneid | 94 |
|---|---|
| ensemblid | ENSG00000139567.13 |
| hgncid | 175 |
| symbol | ACVRL1 |
| name | activin A receptor like type 1 |
| refseq_nuc | NM_000020.3 |
| refseq_prot | NP_000011.2 |
| ensembl_nuc | ENST00000388922.9 |
| ensembl_prot | ENSP00000373574.4 |
| mane_status | MANE Select |
| chr | chr12 |
| start | 51907504 |
| end | 51923361 |
| strand | + |
| ver | v1.2 |
| region | chr12:51907504-51923361 |
| region5000 | chr12:51902504-51928361 |
| regionname0 | ACVRL1_chr12_51907504_51923361 |
| regionname5000 | ACVRL1_chr12_51902504_51928361 |
| chr:pos | ref | alt | af | annotation | impact | samples | AHAPIDS | ACHAPIDS | ACTHAPIDS | ACTGHAPIDS | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
ahapid | alen | total | AFR | AMR | EAS | EUR | SAS | aseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ACVRL1 | 1/1 | a0001 | 503 | 435 | 95 | 76 | 203 | 14 | 45 | subcellular location copy fasta | chr12 | 51902504 | 51928361 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
chapid | clen | total | AFR | AMR | EAS | EUR | SAS | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ACVRL1 | 1/1 | c0001 | 1512 | 396 | 62 | 71 | 203 | 14 | 44 | copy fasta | chr12 | 51902504 | 51928361 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
achapid | total | AFR | AMR | EAS | EUR | SAS | clen | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ACVRL1 | 1/1 | a0001c0001 | 396 | 62 | 71 | 203 | 14 | 44 | 1512 | copy fasta | chr12 | 51902504 | 51928361 |
Click to load Haplotype QTL data...
| pos | S. Strand |
E# Exon Number |
max | median | min | diff | type | haplotypeid | max_hap_list | min_hap_list | symbol | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 51907695 | + | 1 | -0.8561 | -0.8391 | -0.8223 | 0.0337 | acceptor | a0001c0001 | HG00738.hp2 HG01928.hp1 HG01981.hp2 HG02109.hp1 HG02523.hp1 others(22): Show |
NA18977.hp2 | ACVRL1 | chr12 | 51902504 | 51928361 |
| 51912470 | + | 2 | 0.9965 | 0.9953 | 0.9924 | 0.0040 | donor | a0001c0001 | HG02976.hp2 | NA18967.hp1 | ACVRL1 | chr12 | 51902504 | 51928361 |
| 51912535 | + | 2 | -0.9978 | -0.9970 | -0.9926 | 0.0052 | acceptor | a0001c0001 | HG02615.hp1 HG03098.hp1 HG03453.hp2 HG03471.hp1 HG03486.hp1 others(1): Show |
NA18967.hp1 | ACVRL1 | chr12 | 51902504 | 51928361 |
| 51913099 | + | 3 | 0.9671 | 0.9652 | 0.9639 | 0.0031 | donor | a0001c0001 | HG03669.hp1 | HG01168.hp2 HG01169.hp1 HG01255.hp1 |
ACVRL1 | chr12 | 51902504 | 51928361 |
| 51913350 | + | 3 | -0.9912 | -0.9901 | -0.9893 | 0.0019 | acceptor | a0001c0001 | NA18967.hp1 | NA18972.hp2 | ACVRL1 | chr12 | 51902504 | 51928361 |
| 51913559 | + | 4 | 0.9881 | 0.9819 | 0.9778 | 0.0102 | donor | a0001c0001 | HG01952.hp2 | HG01168.hp2 HG01169.hp1 HG01255.hp1 |
ACVRL1 | chr12 | 51902504 | 51928361 |
| 51913770 | + | 4 | -0.9702 | -0.9626 | -0.9575 | 0.0127 | acceptor | a0001c0001 | HG01952.hp2 | HG01168.hp2 HG01169.hp1 HG01255.hp1 |
ACVRL1 | chr12 | 51902504 | 51928361 |
| 51913974 | + | 5 | 0.8599 | 0.8469 | 0.8098 | 0.0501 | donor | a0001c0001 | NA18994.hp1 NA19066.hp1 NA19077.hp1 |
NA18940.hp1 NA19010.hp1 |
ACVRL1 | chr12 | 51902504 | 51928361 |
| 51914073 | + | 5 | -0.7069 | -0.6757 | -0.6354 | 0.0715 | acceptor | a0001c0001 | HG00733.hp2 | NA18940.hp1 NA19010.hp1 |
ACVRL1 | chr12 | 51902504 | 51928361 |
| 51914439 | + | 6 | 0.9385 | 0.9304 | 0.9062 | 0.0323 | donor | a0001c0001 | HG03209.hp1 HG03225.hp2 |
HG01168.hp2 HG01169.hp1 HG01255.hp1 |
ACVRL1 | chr12 | 51902504 | 51928361 |
| 51914585 | + | 6 | -0.3454 | -0.3047 | -0.2629 | 0.0825 | acceptor | a0001c0001 | HG00597.hp2 | HG00621.hp1 HG01978.hp1 HG02040.hp1 HG02074.hp2 HG02273.hp2 others(45): Show |
ACVRL1 | chr12 | 51902504 | 51928361 |
| 51915225 | + | 7 | 0.9971 | 0.9962 | 0.9960 | 0.0011 | donor | a0001c0001 | NA18994.hp1 NA19066.hp1 NA19077.hp1 |
HG01978.hp2 | ACVRL1 | chr12 | 51902504 | 51928361 |
| 51915500 | + | 7 | -0.9965 | -0.9962 | -0.9959 | 0.0007 | acceptor | a0001c0001 | HG01168.hp2 HG01169.hp1 HG01255.hp1 |
HG01978.hp2 | ACVRL1 | chr12 | 51902504 | 51928361 |
| 51916036 | + | 8 | 0.9521 | 0.9495 | 0.9137 | 0.0384 | donor | a0001c0001 | HG01168.hp2 HG01169.hp1 HG01255.hp1 |
NA18974.hp1 | ACVRL1 | chr12 | 51902504 | 51928361 |
| 51916233 | + | 8 | -0.9986 | -0.9983 | -0.9983 | 0.0004 | acceptor | a0001c0001 | HG02896.hp2 | HG03491.hp1 | ACVRL1 | chr12 | 51902504 | 51928361 |
| 51918985 | + | 9 | 0.9982 | 0.9978 | 0.9975 | 0.0007 | donor | a0001c0001 | HG03453.hp2 | HG01257.hp1 HG01258.hp2 HG01515.hp1 |
ACVRL1 | chr12 | 51902504 | 51928361 |
| 51919115 | + | 9 | -0.9936 | -0.9927 | -0.9903 | 0.0033 | acceptor | a0001c0001 | HG03688.hp2 HG03710.hp1 HG04228.hp2 NA20905.hp2 |
HG03209.hp1 HG03225.hp2 |
ACVRL1 | chr12 | 51902504 | 51928361 |
| 51920759 | + | 10 | 0.3461 | 0.3191 | 0.2693 | 0.0768 | donor | a0001c0001 | NA19240.hp2 | HG00140.hp1 HG00140.hp2 NA20752.hp2 |
ACVRL1 | chr12 | 51902504 | 51928361 |
| pos | annotationhgvs_chgvs_p | clinvarid | clnsig | geneinfo | mc | clndisdb | strand strand
|
ahapid ahapid_count
|
chapid chapid count
|
thapid thapid_count
|
ghapid ghapid_count
|
AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
impact | chr | ref | alt | external |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 51913524:splice 51913524:variant goto | c.314-35A>G | 254710 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774|MedGen:C3661900|MedGen:CN169374 |
+ | 1 | 7 | 26 | 92 | a0001 | a0001c0001a0001c0002a0001c0003a0001c0004a0001c0005others(2): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004a0001c0001t0005a0001c0001t0010others(21): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0030a0001c0001t0001g0032a0001c0001t0001g0033others(87): Show | HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00323.hp1 HG00323.hp2 others(166): Show |
MODIFIER | chr12 | A | G | TogoVar |
| 51913361:splice 51913361:variant goto | c.313+11C>T | 136293 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MedGen:CN169374|MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774|MedGen:C3661900|MedGen:CN230736 |
+ | 1 | 7 | 25 | 90 | a0001 | a0001c0001a0001c0002a0001c0003a0001c0004a0001c0005others(2): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004a0001c0001t0010a0001c0001t0019others(20): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0030a0001c0001t0001g0032a0001c0001t0001g0033others(85): Show | HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00323.hp1 HG00323.hp2 others(164): Show |
MODIFIER | chr12 | C | T | TogoVar |
| 51912903:splice 51912903:variant goto | c.62-196C>G | 1226999 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MedGen:C3661900 | + | 1 | 6 | 17 | 74 | a0001 | a0001c0001a0001c0002a0001c0003a0001c0004a0001c0006others(1): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004a0001c0001t0010a0001c0001t0019others(12): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0030a0001c0001t0001g0032a0001c0001t0001g0033others(69): Show | HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00323.hp1 HG00323.hp2 others(141): Show |
MODIFIER | chr12 | C | G | TogoVar |
| 51912002:splice 51912002:variant goto | c.-5-468C>T | 1271094 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MedGen:C3661900 | + | 4 | 10 | 38 | 148 | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0003a0001c0005a0001c0006others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(33): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0032a0001c0001t0001g0033a0001c0001t0001g0042others(143): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(332): Show |
MODIFIER | chr12 | C | T | TogoVar |
| 51914716:splice 51914716:variant goto | c.772+175_772+179dupAATTT | 1258247 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MedGen:C3661900 | + | 3 | 7 | 19 | 84 | a0001a0002a0003 | a0001c0001a0001c0002a0001c0003a0001c0004a0001c0006others(2): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(14): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0033a0001c0001t0001g0040a0001c0001t0001g0042others(79): Show | HG00099.hp1 HG00280.hp2 HG00323.hp1 HG00544.hp1 HG00544.hp2 others(182): Show |
MODIFIER | chr12 | T | TTTTAA | TogoVar |
| 51919363:splice 51919363:variant goto | c.1377+288_1377+289delGT | 1273462 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MedGen:C3661900 | + | 1 | 2 | 10 | 23 | a0001 | a0001c0001a0001c0002 | a0001c0001t0001a0001c0001t0002a0001c0001t0004a0001c0001t0008a0001c0001t0015others(5): Show | a0001c0001t0001g0014a0001c0001t0001g0028a0001c0001t0001g0071a0001c0001t0002g0008a0001c0001t0002g0015others(18): Show | HG00323.hp1 HG00323.hp2 HG00733.hp2 HG00741.hp2 HG01069.hp1 others(50): Show |
MODIFIER | chr12 | CTG | C | TogoVar |
| 51919363:splice 51919363:variant goto | c.1377+288_1377+289dupGT | 1259673 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MedGen:C3661900 | + | 2 | 7 | 19 | 41 | a0001a0004 | a0001c0001a0001c0002a0001c0003a0001c0004a0001c0010others(2): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004a0001c0001t0005a0001c0001t0006others(14): Show | a0001c0001t0001g0017a0001c0001t0001g0038a0001c0001t0001g0114a0001c0001t0001g0160a0001c0001t0003g0002others(36): Show | HG00099.hp1 HG00280.hp1 HG00280.hp2 HG00438.hp2 HG00558.hp1 others(110): Show |
MODIFIER | chr12 | C | CTG | TogoVar |
| 51913510:splice 51913510:variant goto | c.314-49G>C | 994343 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 1 | 1 | 1 | 1 | a0001 | a0001c0001 | a0001c0001t0001 | a0001c0001t0001g0027 | HG01168.hp2 HG01169.hp1 HG01255.hp1 |
MODIFIER | chr12 | G | C | TogoVar |
| 51918970:splice 51918970:variant goto | c.1247-15A>G | 379523 | Benign/Likely_benign | ACVRL1:94 | SO:0001627 intron_variant |
MedGen:CN169374|MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 1 | 1 | 1 | 1 | a0001 | a0001c0001 | a0001c0001t0001 | a0001c0001t0001g0028 | HG01257.hp1 HG01258.hp2 HG01515.hp1 |
MODIFIER | chr12 | A | G | TogoVar |
| 51919363:splice 51919363:variant goto | c.1377+286_1377+289dupGTGT | 1273235 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MedGen:C3661900 | + | 3 | 5 | 11 | 18 | a0001a0002a0003 | a0001c0001a0001c0002a0001c0003a0002c0007a0003c0009 | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0009others(6): Show | a0001c0001t0001g0030a0001c0001t0002g0013a0001c0001t0002g0021a0001c0001t0002g0045a0001c0001t0002g0063others(13): Show | HG00544.hp1 HG00544.hp2 HG00621.hp1 HG01168.hp1 HG02293.hp2 others(32): Show |
MODIFIER | chr12 | C | CTGTG | TogoVar |
| 51919363:splice 51919363:variant goto | c.1377+286_1377+289delGTGT | 1296508 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774|MedGen:C3661900 |
+ | 1 | 1 | 5 | 21 | a0001 | a0001c0001 | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0008a0001c0001t0028 | a0001c0001t0001g0032a0001c0001t0001g0033a0001c0001t0001g0150a0001c0001t0001g0152a0001c0001t0002g0004others(16): Show | HG00733.hp1 HG00735.hp2 HG01081.hp2 HG01123.hp1 HG01192.hp1 others(44): Show |
MODIFIER | chr12 | CTGTG | C | TogoVar |
| 51914716:splice 51914716:variant goto | c.772+170_772+179dupAATTTAATTT | 1242924 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MedGen:C3661900 | + | 1 | 1 | 7 | 17 | a0001 | a0001c0001 | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0010a0001c0001t0027others(2): Show | a0001c0001t0001g0032a0001c0001t0001g0043a0001c0001t0001g0094a0001c0001t0001g0152a0001c0001t0002g0020others(12): Show | HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00323.hp2 HG01074.hp1 others(23): Show |
MODIFIER | chr12 | T | TTTTAATT others(3): Show |
TogoVar |
| 51919361:splice 51919361:variant goto | c.1377+248_1377+251dupCTGT | 1679429 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 1 | 1 | 2 | 3 | a0001 | a0001c0001 | a0001c0001t0001a0001c0001t0033 | a0001c0001t0001g0043a0001c0001t0001g0102a0001c0001t0033g0043 | NA18977.hp2 NA18997.hp1 NA19087.hp2 |
MODIFIER | chr12 | C | CTCTG | TogoVar |
| 51918755:splice 51918755:variant goto | c.1247-230T>C | 1188187 | Likely_benign | ACVRL1:94 | SO:0001627 intron_variant |
MedGen:C3661900 | + | 1 | 1 | 1 | 2 | a0001 | a0001c0001 | a0001c0001t0001 | a0001c0001t0001g0073a0001c0001t0001g0096 | HG01069.hp2 NA20805.hp2 |
MODIFIER | chr12 | T | C | TogoVar |
| 51913030:splice 51913030:variant goto | c.62-69G>T | 811494 | Benign/Likely_benign | ACVRL1:94 | SO:0001627 intron_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774|MedGen:C3661900 |
+ | 1 | 3 | 3 | 4 | a0001 | a0001c0001a0001c0002a0001c0010 | a0001c0001t0001a0001c0002t0006a0001c0010t0006 | a0001c0001t0001g0075a0001c0001t0001g0158a0001c0002t0006g0149a0001c0010t0006g0076 | HG01891.hp1 HG02451.hp1 HG06807.hp1 NA18522.hp1 |
MODIFIER | chr12 | G | T | TogoVar |
| 51920511:splice 51920511:variant goto | c.1378-248T>G | 678439 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MedGen:C3661900|MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 4 | 8 | 27 | 69 | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0005a0001c0010a0001c0011others(3): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004a0001c0001t0006a0001c0001t0008others(22): Show | a0001c0001t0001g0082a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077others(64): Show | HG00099.hp1 HG00280.hp2 HG00438.hp2 HG00544.hp1 HG00544.hp2 others(145): Show |
MODIFIER | chr12 | T | G | TogoVar |
| 51920710:splice 51920710:variant goto | c.1378-49C>T | 2921145 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 1 | 1 | 1 | 1 | a0001 | a0001c0001 | a0001c0001t0001 | a0001c0001t0001g0084 | HG01255.hp2 | MODIFIER | chr12 | C | T | TogoVar |
| 51913546:splice 51913546:variant goto | c.314-13C>T | 2965106 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 1 | 1 | 1 | 1 | a0001 | a0001c0001 | a0001c0001t0001 | a0001c0001t0001g0085 | HG01952.hp2 | MODIFIER | chr12 | C | T | TogoVar |
| 51922139:splice 51922139:variant goto | c.*1246T>C | 309467 | Benign | ACVRL1:94 | SO:0001624 3_prime_UTR_variant |
MedGen:C3661900|MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 4 | 8 | 34 | 125 | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0005a0001c0010a0001c0011others(3): Show | a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005a0001c0001t0006others(29): Show | a0001c0001t0002g0004a0001c0001t0002g0005a0001c0001t0002g0006a0001c0001t0002g0008a0001c0001t0002g0012others(120): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(291): Show |
MODIFIER | chr12 | T | C | TogoVar |
| 51912005:splice 51912005:variant goto | c.-5-465A>G | 1174347 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MedGen:C3661900 | + | 4 | 5 | 16 | 59 | a0001a0002a0003a0004 | a0001c0001a0001c0011a0002c0007a0003c0009a0004c0008 | a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005a0001c0001t0006others(11): Show | a0001c0001t0002g0005a0001c0001t0002g0006a0001c0001t0002g0013a0001c0001t0002g0021a0001c0001t0002g0063others(54): Show | HG00099.hp1 HG00280.hp2 HG00438.hp2 HG00544.hp1 HG00544.hp2 others(167): Show |
MODIFIER | chr12 | A | G | TogoVar |
| 51914890:splice 51914890:variant goto | c.772+305T>A | 674089 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MedGen:C3661900 | + | 1 | 1 | 2 | 13 | a0001 | a0001c0001 | a0001c0001t0002a0001c0001t0005 | a0001c0001t0002g0005a0001c0001t0002g0006a0001c0001t0002g0013a0001c0001t0002g0021a0001c0001t0002g0063others(8): Show | HG00621.hp1 HG01978.hp1 HG02040.hp1 HG02074.hp2 HG02273.hp2 others(47): Show |
MODIFIER | chr12 | T | A | TogoVar |
| 51919363:splice 51919363:variant goto | c.1377+284_1377+289dupGTGTGT | 1220225 | Benign/Likely_benign | ACVRL1:94 | SO:0001627 intron_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774|MedGen:C3661900 |
+ | 1 | 2 | 5 | 6 | a0001 | a0001c0001a0001c0002 | a0001c0001t0002a0001c0001t0003a0001c0001t0017a0001c0001t0025a0001c0002t0023 | a0001c0001t0002g0006a0001c0001t0002g0066a0001c0001t0003g0132a0001c0001t0017g0047a0001c0001t0025g0047others(1): Show | HG01106.hp1 HG01167.hp2 HG02074.hp2 HG02273.hp2 HG02698.hp1 others(14): Show |
MODIFIER | chr12 | C | CTGTGTG | TogoVar |
| 51919900:splice 51919900:variant goto | c.1377+785G>A | 1330889 | Likely_benign | ACVRL1:94 | SO:0001627 intron_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 1 | 1 | 1 | 1 | a0001 | a0001c0001 | a0001c0001t0002 | a0001c0001t0002g0021 | HG03688.hp2 HG03710.hp1 HG04228.hp2 NA20905.hp2 |
MODIFIER | chr12 | G | A | TogoVar |
| 51919441:splice 51919441:variant goto | c.1377+326G>T | 811663 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774|MedGen:C3661900 |
+ | 1 | 1 | 1 | 4 | a0001 | a0001c0001 | a0001c0001t0002 | a0001c0001t0002g0026a0001c0001t0002g0062a0001c0001t0002g0101a0001c0001t0002g0145 | HG01123.hp1 HG01433.hp1 HG02602.hp1 HG03017.hp2 HG03669.hp1 others(1): Show |
MODIFIER | chr12 | G | T | TogoVar |
| 51920505:splice 51920505:variant goto | c.1378-248delT | 810920 | Benign/Likely_benign | ACVRL1:94 | SO:0001627 intron_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774|MedGen:C3661900 |
+ | 1 | 1 | 1 | 2 | a0001 | a0001c0001 | a0001c0001t0002 | a0001c0001t0002g0044a0001c0001t0002g0074 | HG00140.hp1 HG00140.hp2 NA20752.hp2 |
MODIFIER | chr12 | AT | A | TogoVar |
| 51914716:splice 51914716:variant goto | c.772+175_772+179delAATTT | 1259264 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MedGen:C3661900 | + | 1 | 4 | 12 | 27 | a0001 | a0001c0001a0001c0002a0001c0003a0001c0010 | a0001c0001t0002a0001c0001t0004a0001c0001t0008a0001c0001t0009a0001c0001t0015others(7): Show | a0001c0001t0002g0062a0001c0001t0004g0003a0001c0001t0004g0019a0001c0001t0004g0054a0001c0001t0004g0056others(22): Show | HG00438.hp2 HG00738.hp1 HG00738.hp2 HG01109.hp2 HG01256.hp2 others(55): Show |
MODIFIER | chr12 | TTTTAA | T | TogoVar |
| 51919860:splice 51919860:variant goto | c.1377+745G>A | 2920811 | Benign | ACVRL1:94 | SO:0001624 3_prime_UTR_variant,SO:0001627 intron_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 1 | 1 | 1 | 2 | a0001 | a0001c0001 | a0001c0001t0002 | a0001c0001t0002g0099a0001c0001t0002g0117 | HG01346.hp1 HG03130.hp2 |
MODIFIER | chr12 | G | A | TogoVar |
| 51920354:splice 51920354:variant goto | c.1378-405A>G | 810907 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MedGen:C3661900|MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 4 | 8 | 27 | 69 | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0005a0001c0010a0001c0011others(3): Show | a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0006a0001c0001t0008others(22): Show | a0001c0001t0002g0119a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077others(64): Show | HG00099.hp1 HG00280.hp2 HG00438.hp2 HG00544.hp1 HG00544.hp2 others(145): Show |
MODIFIER | chr12 | A | G | TogoVar |
| 51920543:splice 51920543:variant goto | c.1378-216C>T | 811605 | Benign/Likely_benign | ACVRL1:94 | SO:0001627 intron_variant |
.|MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774|MedGen:C3661900 |
+ | 1 | 1 | 1 | 1 | a0001 | a0001c0001 | a0001c0001t0002 | a0001c0001t0002g0144 | HG01192.hp1 | MODIFIER | chr12 | C | T | TogoVar |
| 51920729:splice 51920729:variant goto | c.1378-30T>C | 439374 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MedGen:C3661900|MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 1 | 1 | 1 | 1 | a0001 | a0001c0001 | a0001c0001t0002 | a0001c0001t0002g0154 | HG02280.hp2 | MODIFIER | chr12 | T | C | TogoVar |
| 51919160:splice 51919160:variant goto | c.1377+45T>C | 254709 | Benign/Likely_benign | ACVRL1:94 | SO:0001627 intron_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774|MedGen:CN169374|MedGen:C3661900 |
+ | 4 | 8 | 26 | 68 | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0005a0001c0010a0001c0011others(3): Show | a0001c0001t0003a0001c0001t0004a0001c0001t0006a0001c0001t0008a0001c0001t0009others(21): Show | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(63): Show | HG00099.hp1 HG00280.hp2 HG00438.hp2 HG00544.hp1 HG00544.hp2 others(144): Show |
MODIFIER | chr12 | T | C | TogoVar |
| 51919180:splice 51919180:variant goto | c.1377+65A>G | 439373 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MedGen:C3661900|MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 4 | 8 | 26 | 68 | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0005a0001c0010a0001c0011others(3): Show | a0001c0001t0003a0001c0001t0004a0001c0001t0006a0001c0001t0008a0001c0001t0009others(21): Show | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(63): Show | HG00099.hp1 HG00280.hp2 HG00438.hp2 HG00544.hp1 HG00544.hp2 others(144): Show |
MODIFIER | chr12 | A | G | TogoVar |
| 51919412:splice 51919412:variant goto | c.1377+297T>A | 1237113 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MedGen:C3661900 | + | 4 | 8 | 26 | 68 | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0005a0001c0010a0001c0011others(3): Show | a0001c0001t0003a0001c0001t0004a0001c0001t0006a0001c0001t0008a0001c0001t0009others(21): Show | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(63): Show | HG00099.hp1 HG00280.hp2 HG00438.hp2 HG00544.hp1 HG00544.hp2 others(144): Show |
MODIFIER | chr12 | T | A | TogoVar |
| 51921453:splice 51921453:variant goto | c.*560T>C | 309454 | Benign | ACVRL1:94 | SO:0001624 3_prime_UTR_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774|MedGen:C3661900 |
+ | 4 | 8 | 26 | 68 | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0005a0001c0010a0001c0011others(3): Show | a0001c0001t0003a0001c0001t0004a0001c0001t0006a0001c0001t0008a0001c0001t0009others(21): Show | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(63): Show | HG00099.hp1 HG00280.hp2 HG00438.hp2 HG00544.hp1 HG00544.hp2 others(144): Show |
MODIFIER | chr12 | T | C | TogoVar |
| 51922819:splice 51922819:variant goto | c.*1926T>C | 309477 | Benign | ACVRL1:94 | SO:0001624 3_prime_UTR_variant |
MedGen:C3661900|MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 3 | 6 | 12 | 30 | a0001a0002a0003 | a0001c0001a0001c0002a0001c0005a0001c0011a0002c0007others(1): Show | a0001c0001t0003a0001c0001t0007a0001c0001t0017a0001c0001t0024a0001c0001t0025others(7): Show | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(25): Show | HG00099.hp1 HG00280.hp2 HG00438.hp1 HG00544.hp1 HG00544.hp2 others(73): Show |
MODIFIER | chr12 | T | C | TogoVar |
| 51914179:splice 51914179:variant goto | c.625+110_625+130delAATTGGAATTCTGCTGGGCAG | 439376 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774|MedGen:C3661900 |
+ | 3 | 4 | 6 | 22 | a0001a0002a0003 | a0001c0001a0001c0011a0002c0007a0003c0009 | a0001c0001t0003a0001c0001t0017a0001c0001t0025a0001c0011t0003a0002c0007t0003others(1): Show | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(17): Show | HG00099.hp1 HG00280.hp2 HG00544.hp1 HG00544.hp2 HG00558.hp1 others(59): Show |
MODIFIER | chr12 | TCAGAATT others(14): Show |
T | TogoVar |
| 51923291:splice 51923291:variant goto | c.*2398G>A | 309484 | Benign | ACVRL1:94 | SO:0001624 3_prime_UTR_variant |
MedGen:C3661900|MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 3 | 4 | 6 | 22 | a0001a0002a0003 | a0001c0001a0001c0011a0002c0007a0003c0009 | a0001c0001t0003a0001c0001t0017a0001c0001t0025a0001c0011t0003a0002c0007t0003others(1): Show | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(17): Show | HG00099.hp1 HG00280.hp2 HG00544.hp1 HG00544.hp2 HG00558.hp1 others(59): Show |
MODIFIER | chr12 | G | A | TogoVar |
| 51920604:splice 51920604:variant goto | c.1378-155T>G | 810856 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774|MedGen:C3661900|MedGen:CN230736 |
+ | 3 | 4 | 5 | 20 | a0001a0002a0003 | a0001c0001a0001c0011a0002c0007a0003c0009 | a0001c0001t0003a0001c0001t0018a0001c0011t0003a0002c0007t0003a0003c0009t0003 | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(15): Show | HG00099.hp1 HG00280.hp2 HG00544.hp1 HG00544.hp2 HG00558.hp1 others(57): Show |
MODIFIER | chr12 | T | G | TogoVar |
| 51912243:splice 51912243:variant goto | c.-5-227C>G | 810906 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774|MedGen:C3661900 |
+ | 3 | 4 | 4 | 19 | a0001a0002a0003 | a0001c0001a0001c0011a0002c0007a0003c0009 | a0001c0001t0003a0001c0011t0003a0002c0007t0003a0003c0009t0003 | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(14): Show | HG00099.hp1 HG00280.hp2 HG00544.hp1 HG00544.hp2 HG00558.hp1 others(56): Show |
MODIFIER | chr12 | C | G | TogoVar |
| 51923273:splice 51923273:variant goto | c.*2380C>G | 309483 | Benign | ACVRL1:94 | SO:0001624 3_prime_UTR_variant |
MedGen:C3661900|MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 3 | 4 | 4 | 19 | a0001a0002a0003 | a0001c0001a0001c0011a0002c0007a0003c0009 | a0001c0001t0003a0001c0011t0003a0002c0007t0003a0003c0009t0003 | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(14): Show | HG00099.hp1 HG00280.hp2 HG00544.hp1 HG00544.hp2 HG00558.hp1 others(56): Show |
MODIFIER | chr12 | C | G | TogoVar |
| 51914380:splice 51914380:variant goto | c.626-59G>T | 675883 | Likely_benign | ACVRL1:94 | SO:0001627 intron_variant |
MedGen:C3661900 | + | 1 | 1 | 1 | 1 | a0001 | a0001c0001 | a0001c0001t0003 | a0001c0001t0003g0136 | NA20805.hp1 | MODIFIER | chr12 | G | T | TogoVar |
| 51912542:splice 51912542:variant goto | c.61+7A>T | 1673852 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774|. |
+ | 1 | 1 | 1 | 1 | a0001 | a0001c0001 | a0001c0001t0003 | a0001c0001t0003g0137 | NA18967.hp1 | LOW | chr12 | A | T | TogoVar |
| 51921762:splice 51921762:variant goto | c.*869C>T | 309457 | Benign | ACVRL1:94 | SO:0001624 3_prime_UTR_variant |
MedGen:C3661900|MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 2 | 4 | 11 | 29 | a0001a0004 | a0001c0001a0001c0002a0001c0010a0004c0008 | a0001c0001t0004a0001c0001t0006a0001c0001t0009a0001c0001t0018a0001c0002t0006others(6): Show | a0001c0001t0004g0003a0001c0001t0004g0019a0001c0001t0004g0053a0001c0001t0004g0054a0001c0001t0004g0055others(24): Show | HG00438.hp2 HG00738.hp1 HG00738.hp2 HG01192.hp2 HG01256.hp2 others(58): Show |
MODIFIER | chr12 | C | T | TogoVar |
| 51921806:splice 51921806:variant goto | c.*913C>T | 309459 | Benign | ACVRL1:94 | SO:0001624 3_prime_UTR_variant |
MedGen:C3661900|MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 2 | 4 | 11 | 29 | a0001a0004 | a0001c0001a0001c0002a0001c0010a0004c0008 | a0001c0001t0004a0001c0001t0006a0001c0001t0009a0001c0001t0018a0001c0002t0006others(6): Show | a0001c0001t0004g0003a0001c0001t0004g0019a0001c0001t0004g0053a0001c0001t0004g0054a0001c0001t0004g0055others(24): Show | HG00438.hp2 HG00738.hp1 HG00738.hp2 HG01192.hp2 HG01256.hp2 others(58): Show |
MODIFIER | chr12 | C | T | TogoVar |
| 51921935:splice 51921935:variant goto | c.*1042C>T | 309466 | Benign | ACVRL1:94 | SO:0001624 3_prime_UTR_variant |
MedGen:C3661900|MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 2 | 4 | 11 | 29 | a0001a0004 | a0001c0001a0001c0002a0001c0010a0004c0008 | a0001c0001t0004a0001c0001t0006a0001c0001t0009a0001c0001t0018a0001c0002t0006others(6): Show | a0001c0001t0004g0003a0001c0001t0004g0019a0001c0001t0004g0053a0001c0001t0004g0054a0001c0001t0004g0055others(24): Show | HG00438.hp2 HG00738.hp1 HG00738.hp2 HG01192.hp2 HG01256.hp2 others(58): Show |
MODIFIER | chr12 | C | T | TogoVar |
| 51920060:splice 51920060:variant goto | c.1378-699C>T | 993687 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 2 | 4 | 13 | 30 | a0001a0004 | a0001c0001a0001c0002a0001c0010a0004c0008 | a0001c0001t0004a0001c0001t0006a0001c0001t0009a0001c0001t0018a0001c0001t0024others(8): Show | a0001c0001t0004g0003a0001c0001t0004g0019a0001c0001t0004g0053a0001c0001t0004g0054a0001c0001t0004g0055others(25): Show | HG00438.hp2 HG00738.hp1 HG00738.hp2 HG01192.hp2 HG01256.hp2 others(61): Show |
MODIFIER | chr12 | C | T | TogoVar |
| 51912437:splice 51912437:variant goto | c.-5-33C>T | 136292 | Benign | ACVRL1:94 | SO:0001623 5_prime_UTR_variant,SO:0001627 intron_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774|MedGen:C3661900|MedGen:CN169374 |
+ | 1 | 1 | 2 | 10 | a0001 | a0001c0001 | a0001c0001t0004a0001c0001t0018 | a0001c0001t0004g0003a0001c0001t0004g0019a0001c0001t0004g0054a0001c0001t0004g0055a0001c0001t0004g0056others(5): Show | HG00438.hp2 HG00738.hp2 HG01928.hp1 HG01981.hp2 HG02071.hp1 others(32): Show |
MODIFIER | chr12 | C | T | TogoVar |
| 51914237:splice 51914237:variant goto | c.625+164T>C | 439375 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MedGen:C3661900|MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 1 | 1 | 2 | 10 | a0001 | a0001c0001 | a0001c0001t0004a0001c0001t0018 | a0001c0001t0004g0003a0001c0001t0004g0019a0001c0001t0004g0054a0001c0001t0004g0055a0001c0001t0004g0056others(5): Show | HG00438.hp2 HG00738.hp2 HG01928.hp1 HG01981.hp2 HG02071.hp1 others(32): Show |
MODIFIER | chr12 | T | C | TogoVar |
| 51920048:splice 51920048:variant goto | c.1378-711C>T | 811392 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 1 | 1 | 1 | 2 | a0001 | a0001c0001 | a0001c0001t0004 | a0001c0001t0004g0120a0001c0001t0004g0121 | HG02622.hp1 HG02970.hp2 |
MODIFIER | chr12 | C | T | TogoVar |
| 51914386:splice 51914386:variant goto | c.626-53C>T | 439371 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MedGen:C3661900|MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 1 | 1 | 2 | 4 | a0001 | a0001c0001 | a0001c0001t0004a0001c0001t0008 | a0001c0001t0004g0127a0001c0001t0008g0050a0001c0001t0008g0115a0001c0001t0008g0157 | HG00733.hp2 HG02257.hp2 HG02723.hp1 HG03209.hp1 HG03225.hp2 |
MODIFIER | chr12 | C | T | TogoVar |
| 51921934:splice 51921934:variant goto | c.*1041G>T | 309464 | Benign | ACVRL1:94 | SO:0001624 3_prime_UTR_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 1 | 1 | 1 | 4 | a0001 | a0001c0001 | a0001c0001t0005 | a0001c0001t0005g0005a0001c0001t0005g0068a0001c0001t0005g0069a0001c0001t0005g0148 | HG02040.hp1 NA18942.hp1 NA18953.hp2 NA18956.hp1 NA18963.hp2 others(17): Show |
MODIFIER | chr12 | G | T | TogoVar |
| 51921935:splice 51921935:variant goto | c.*1042C>G | 309465 | Benign | ACVRL1:94 | SO:0001624 3_prime_UTR_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 1 | 1 | 1 | 4 | a0001 | a0001c0001 | a0001c0001t0005 | a0001c0001t0005g0005a0001c0001t0005g0068a0001c0001t0005g0069a0001c0001t0005g0148 | HG02040.hp1 NA18942.hp1 NA18953.hp2 NA18956.hp1 NA18963.hp2 others(17): Show |
MODIFIER | chr12 | C | G | TogoVar |
| 51912557:splice 51912557:variant goto | c.61+22A>G | 439370 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MedGen:CN169374|MedGen:C3661900|MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 2 | 2 | 5 | 11 | a0001a0004 | a0001c0001a0004c0008 | a0001c0001t0006a0001c0001t0009a0001c0001t0012a0001c0001t0014a0004c0008t0006 | a0001c0001t0006g0024a0001c0001t0006g0072a0001c0001t0009g0125a0001c0001t0012g0049a0001c0001t0012g0106others(6): Show | HG02451.hp2 HG02615.hp1 HG02630.hp2 HG02895.hp1 HG02897.hp2 others(8): Show |
MODIFIER | chr12 | A | G | TogoVar |
| 51920420:splice 51920420:variant goto | c.1378-339T>G | 993782 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774|MedGen:C3661900 |
+ | 2 | 4 | 11 | 19 | a0001a0004 | a0001c0001a0001c0002a0001c0010a0004c0008 | a0001c0001t0006a0001c0001t0009a0001c0001t0024a0001c0002t0006a0001c0002t0009others(6): Show | a0001c0001t0006g0024a0001c0001t0006g0072a0001c0001t0009g0125a0001c0001t0024g0088a0001c0002t0006g0018others(14): Show | HG00738.hp1 HG01256.hp2 HG01258.hp1 HG01884.hp1 HG02055.hp2 others(23): Show |
MODIFIER | chr12 | T | G | TogoVar |
| 51921738:splice 51921738:variant goto | c.*856dupT | 309455 | Likely_benign | ACVRL1:94 | SO:0001624 3_prime_UTR_variant |
MONDO:MONDO:0008535 MedGen:C4551861 OMIM:187300 Orphanet:774 |
+ | 2 | 4 | 11 | 19 | a0001a0004 | a0001c0001a0001c0002a0001c0010a0004c0008 | a0001c0001t0006a0001c0001t0009a0001c0001t0028a0001c0001t0029a0001c0002t0006others(6): Show | a0001c0001t0006g0024a0001c0001t0006g0072a0001c0001t0009g0125a0001c0001t0028g0032a0001c0001t0029g0040others(14): Show | HG00738.hp1 HG01256.hp2 HG01258.hp1 HG01884.hp2 HG02055.hp2 others(21): Show |
MODIFIER | chr12 | C | CT | TogoVar |
| 51920542:splice 51920542:variant goto | c.1378-217A>G | 811572 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774|MedGen:C3661900 |
+ | 1 | 2 | 6 | 14 | a0001 | a0001c0001a0001c0005 | a0001c0001t0006a0001c0001t0008a0001c0001t0012a0001c0001t0014a0001c0001t0015others(1): Show | a0001c0001t0006g0072a0001c0001t0008g0050a0001c0001t0008g0115a0001c0001t0008g0118a0001c0001t0008g0157others(9): Show | HG00733.hp2 HG01109.hp2 HG02257.hp2 HG02615.hp1 HG02647.hp1 others(12): Show |
MODIFIER | chr12 | A | G | TogoVar |
| 51921842:splice 51921842:variant goto | c.*949C>T | 309461 | Benign | ACVRL1:94 | SO:0001624 3_prime_UTR_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 1 | 2 | 5 | 13 | a0001 | a0001c0001a0001c0005 | a0001c0001t0008a0001c0001t0012a0001c0001t0014a0001c0001t0015a0001c0005t0008 | a0001c0001t0008g0050a0001c0001t0008g0115a0001c0001t0008g0118a0001c0001t0008g0157a0001c0001t0012g0049others(8): Show | HG00733.hp2 HG01109.hp2 HG02257.hp2 HG02615.hp1 HG02647.hp1 others(11): Show |
MODIFIER | chr12 | C | T | TogoVar |
| 51921914:splice 51921914:variant goto | c.*1021T>C | 309463 | Benign | ACVRL1:94 | SO:0001624 3_prime_UTR_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 1 | 2 | 5 | 13 | a0001 | a0001c0001a0001c0005 | a0001c0001t0008a0001c0001t0012a0001c0001t0014a0001c0001t0015a0001c0005t0008 | a0001c0001t0008g0050a0001c0001t0008g0115a0001c0001t0008g0118a0001c0001t0008g0157a0001c0001t0012g0049others(8): Show | HG00733.hp2 HG01109.hp2 HG02257.hp2 HG02615.hp1 HG02647.hp1 others(11): Show |
MODIFIER | chr12 | T | C | TogoVar |
| 51913494:splice 51913494:variant goto | c.314-65G>C | 811495 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774|MedGen:C3661900 |
+ | 1 | 1 | 2 | 2 | a0001 | a0001c0001 | a0001c0001t0008a0001c0001t0015 | a0001c0001t0008g0118a0001c0001t0015g0036 | HG01109.hp2 HG02647.hp1 HG03579.hp1 NA18906.hp2 |
MODIFIER | chr12 | G | C | TogoVar |
| 51922453:splice 51922453:variant goto | c.*1560A>C | 309470 | Benign | ACVRL1:94 | SO:0001624 3_prime_UTR_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 1 | 2 | 2 | 4 | a0001 | a0001c0001a0001c0002 | a0001c0001t0009a0001c0002t0009 | a0001c0001t0009g0125a0001c0002t0009g0018a0001c0002t0009g0034a0001c0002t0009g0116 | HG02055.hp2 HG02486.hp1 HG02630.hp2 HG02717.hp2 HG02809.hp1 others(1): Show |
MODIFIER | chr12 | A | C | TogoVar |
| 51920951:splice 51920951:variant goto | c.*58G>A | 309445 | Benign/Likely_benign | ACVRL1:94 | SO:0001624 3_prime_UTR_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774|MedGen:C3661900 |
+ | 1 | 1 | 1 | 2 | a0001 | a0001c0001 | a0001c0001t0010 | a0001c0001t0010g0022a0001c0001t0010g0058 | HG00280.hp1 HG01074.hp1 HG01099.hp1 HG02698.hp2 HG03239.hp2 |
MODIFIER | chr12 | G | A | TogoVar |
| 51919751:splice 51919751:variant goto | c.1377+636C>T | 811890 | Benign | ACVRL1:94 | SO:0001627 intron_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 1 | 1 | 2 | 7 | a0001 | a0001c0001 | a0001c0001t0012a0001c0001t0014 | a0001c0001t0012g0049a0001c0001t0012g0106a0001c0001t0012g0123a0001c0001t0012g0126a0001c0001t0014g0049others(2): Show | HG02615.hp1 HG03098.hp1 HG03209.hp2 HG03453.hp2 HG03471.hp1 others(2): Show |
MODIFIER | chr12 | C | T | TogoVar |
| 51923315:splice 51923315:variant goto | c.*2422A>G | 309485 | Benign | ACVRL1:94 | SO:0001624 3_prime_UTR_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 1 | 1 | 2 | 7 | a0001 | a0001c0001 | a0001c0001t0012a0001c0001t0014 | a0001c0001t0012g0049a0001c0001t0012g0106a0001c0001t0012g0123a0001c0001t0012g0126a0001c0001t0014g0049others(2): Show | HG02615.hp1 HG03098.hp1 HG03209.hp2 HG03453.hp2 HG03471.hp1 others(2): Show |
MODIFIER | chr12 | A | G | TogoVar |
| 51914219:splice 51914219:variant goto | c.625+146C>T | 1192727 | Likely_benign | ACVRL1:94 | SO:0001627 intron_variant |
MedGen:C3661900 | + | 1 | 1 | 1 | 1 | a0001 | a0001c0001 | a0001c0001t0012 | a0001c0001t0012g0126 | HG03486.hp1 | MODIFIER | chr12 | C | T | TogoVar |
| 51921316:splice 51921316:variant goto | c.*423C>T | 309452 | Benign | ACVRL1:94 | SO:0001624 3_prime_UTR_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 1 | 1 | 1 | 3 | a0001 | a0001c0001 | a0001c0001t0014 | a0001c0001t0014g0049a0001c0001t0014g0122a0001c0001t0014g0124 | HG02615.hp1 HG03471.hp1 NA20129.hp2 |
MODIFIER | chr12 | C | T | TogoVar |
| 51907655:splice 51907655:variant goto | c.-46C>G | 212792 | Benign | ACVRL1:94 | SO:0001623 5_prime_UTR_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774|MedGen:CN169374 |
+ | 1 | 1 | 1 | 1 | a0001 | a0001c0001 | a0001c0001t0015 | a0001c0001t0015g0036 | HG01109.hp2 HG02647.hp1 NA18906.hp2 |
MODIFIER | chr12 | C | G | TogoVar |
| 51914933:splice 51914933:variant goto | c.773-292G>A | 1217210 | Likely_benign | ACVRL1:94 | SO:0001627 intron_variant |
MedGen:C3661900 | + | 1 | 1 | 2 | 3 | a0001 | a0001c0001 | a0001c0001t0017a0001c0001t0025 | a0001c0001t0017g0047a0001c0001t0017g0108a0001c0001t0025g0047 | HG01106.hp1 HG01167.hp2 HG02293.hp2 |
MODIFIER | chr12 | G | A | TogoVar |
| 51918790:splice 51918790:variant goto | c.1247-195C>T | 1197463 | Likely_benign | ACVRL1:94 | SO:0001627 intron_variant |
MedGen:C3661900 | + | 1 | 1 | 2 | 3 | a0001 | a0001c0001 | a0001c0001t0017a0001c0001t0025 | a0001c0001t0017g0047a0001c0001t0017g0108a0001c0001t0025g0047 | HG01106.hp1 HG01167.hp2 HG02293.hp2 |
MODIFIER | chr12 | C | T | TogoVar |
| 51922262:splice 51922262:variant goto | c.*1369C>T | 883848 | Likely_benign | ACVRL1:94 | SO:0001624 3_prime_UTR_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 1 | 1 | 1 | 2 | a0001 | a0001c0001 | a0001c0001t0018 | a0001c0001t0018g0003a0001c0001t0018g0105 | NA18945.hp2 NA19003.hp2 |
MODIFIER | chr12 | C | T | TogoVar |
| 51921755:splice 51921755:variant goto | c.*862G>A | 309456 | Benign | ACVRL1:94 | SO:0001624 3_prime_UTR_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 1 | 3 | 4 | 4 | a0001 | a0001c0001a0001c0002a0001c0005 | a0001c0001t0024a0001c0002t0013a0001c0002t0023a0001c0005t0022 | a0001c0001t0024g0088a0001c0002t0013g0031a0001c0002t0023g0089a0001c0005t0022g0111 | HG01884.hp1 HG02886.hp1 HG02895.hp2 HG02976.hp1 HG03225.hp1 others(1): Show |
MODIFIER | chr12 | G | A | TogoVar |
| 51922669:splice 51922669:variant goto | c.*1776C>T | 309474 | Benign | ACVRL1:94 | SO:0001624 3_prime_UTR_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 1 | 2 | 3 | 3 | a0001 | a0001c0001a0001c0002 | a0001c0001t0026a0001c0002t0013a0001c0002t0023 | a0001c0001t0026g0104a0001c0002t0013g0031a0001c0002t0023g0089 | HG01884.hp1 HG02886.hp1 HG02976.hp1 HG03225.hp1 NA19030.hp1 |
MODIFIER | chr12 | C | T | TogoVar |
| 51923206:splice 51923206:variant goto | c.*2313G>A | 309481 | Benign | ACVRL1:94 | SO:0001624 3_prime_UTR_variant |
MedGen:C3661900|MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 1 | 1 | 1 | 1 | a0001 | a0001c0001 | a0001c0001t0027 | a0001c0001t0027g0080 | HG01243.hp2 | MODIFIER | chr12 | G | A | TogoVar |
| 51921716:splice 51921716:variant goto | c.*823C>T | 881900 | Likely_benign | ACVRL1:94 | SO:0001624 3_prime_UTR_variant |
MONDO:MONDO:0010880 MedGen:C1838163 OMIM:600376 Orphanet:774 |
+ | 1 | 1 | 1 | 1 | a0001 | a0001c0001 | a0001c0001t0030 | a0001c0001t0030g0008 | NA19091.hp2 | MODIFIER | chr12 | C | T | TogoVar |
| CHR:POS | annotationhgvs_chgvs_p | disease trait-log10podds or beta | AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
study | initial sample size/replication sample size | report genes | mapped gene | strongest snp risk allele | strand strand
|
impact | chr | ref | alt |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr12:51924594
|
c.*3701A>T | Hemoglobin0.03162 | a0001a0002a0003 | a0001c0001a0001c0011a0002c0007a0003c0009 | a0001c0001t0003a0001c0011t0003a0002c0007t0003a0003c0009t0003 | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(14): Show | HG00099.hp1 HG00280.hp2 HG00544.hp1 HG00544.hp2 HG00558.hp1 others(56): Show |
Genetic analysis of quantitative traits in the Jap others(60): Show |
108,769 Japanese ancestry individuals/ | ACVRL1, ACVR1B | ACVRL1 - ACVR1B | rs3847858-? | + | MODIFIER | chr12 | A | T |
|
chr12:51924594
|
c.*3701A>T | Hematocrit0.02837 | a0001a0002a0003 | a0001c0001a0001c0011a0002c0007a0003c0009 | a0001c0001t0003a0001c0011t0003a0002c0007t0003a0003c0009t0003 | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(14): Show | HG00099.hp1 HG00280.hp2 HG00544.hp1 HG00544.hp2 HG00558.hp1 others(56): Show |
Genetic analysis of quantitative traits in the Jap others(60): Show |
108,757 Japanese ancestry individuals/ | ACVRL1, ACVR1B | ACVRL1 - ACVR1B | rs3847858-? | + | MODIFIER | chr12 | A | T |
|
chr12:51924594
|
c.*3701A>T | Red blood cell count | a0001a0002a0003 | a0001c0001a0001c0011a0002c0007a0003c0009 | a0001c0001t0003a0001c0011t0003a0002c0007t0003a0003c0009t0003 | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(14): Show | HG00099.hp1 HG00280.hp2 HG00544.hp1 HG00544.hp2 HG00558.hp1 others(56): Show |
Leveraging Polygenic Functional Enrichment to Impr others(15): Show |
approximately 445,000 European ancestry individual others(2): Show |
ACVRL1 - ACVR1B | rs3847858-? | + | MODIFIER | chr12 | A | T | |
|
chr12:51912002
|
c.-5-468C>T | White blood cell count | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0003a0001c0005a0001c0006others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(33): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0032a0001c0001t0001g0033a0001c0001t0001g0042others(143): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(332): Show |
Leveraging Polygenic Functional Enrichment to Impr others(15): Show |
approximately 444,000 European ancestry individual others(2): Show |
ACVRL1 | rs1700159-? | + | MODIFIER | chr12 | C | T | |
|
chr12:51912002
|
c.-5-468C>T | Eczema | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0003a0001c0005a0001c0006others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(33): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0032a0001c0001t0001g0033a0001c0001t0001g0042others(143): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(332): Show |
Leveraging Polygenic Functional Enrichment to Impr others(15): Show |
approximately 459,000 European ancestry individual others(2): Show |
ACVRL1 | rs1700159-? | + | MODIFIER | chr12 | C | T | |
|
chr12:51924594
|
c.*3701A>T | Hemoglobin levels0.021 | a0001a0002a0003 | a0001c0001a0001c0011a0002c0007a0003c0009 | a0001c0001t0003a0001c0011t0003a0002c0007t0003a0003c0009t0003 | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(14): Show | HG00099.hp1 HG00280.hp2 HG00544.hp1 HG00544.hp2 HG00558.hp1 others(56): Show |
Predicted loss and gain of function mutations in A others(39): Show |
684,122 European ancestry individuals/ | ACVRL1 | ACVRL1 - ACVR1B | rs3847858-T | + | MODIFIER | chr12 | A | T |
|
chr12:51924594
|
c.*3701A>T | Hematocrit0.029957 | a0001a0002a0003 | a0001c0001a0001c0011a0002c0007a0003c0009 | a0001c0001t0003a0001c0011t0003a0002c0007t0003a0003c0009t0003 | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(14): Show | HG00099.hp1 HG00280.hp2 HG00544.hp1 HG00544.hp2 HG00558.hp1 others(56): Show |
Trans-ethnic and Ancestry-Specific Blood-Cell Gene others(54): Show |
142,940 East Asian ancestry individuals/ | NR | ACVRL1 - ACVR1B | rs3847858-A | + | MODIFIER | chr12 | A | T |
|
chr12:51920604
|
c.1378-155T>G | Hematocrit0.026538 | a0001a0002a0003 | a0001c0001a0001c0011a0002c0007a0003c0009 | a0001c0001t0003a0001c0001t0018a0001c0011t0003a0002c0007t0003a0003c0009t0003 | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(15): Show | HG00099.hp1 HG00280.hp2 HG00544.hp1 HG00544.hp2 HG00558.hp1 others(57): Show |
Trans-ethnic and Ancestry-Specific Blood-Cell Gene others(54): Show |
562,259 European ancestry individuals/ | NR | ACVRL1 | rs2277383-G | + | MODIFIER | chr12 | T | G |
|
chr12:51924594
|
c.*3701A>T | Hematocrit | a0001a0002a0003 | a0001c0001a0001c0011a0002c0007a0003c0009 | a0001c0001t0003a0001c0011t0003a0002c0007t0003a0003c0009t0003 | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(14): Show | HG00099.hp1 HG00280.hp2 HG00544.hp1 HG00544.hp2 HG00558.hp1 others(56): Show |
Trans-ethnic and Ancestry-Specific Blood-Cell Gene others(54): Show |
737,823 African American or Afro-Caribbean, Africa others(116): Show |
NR | ACVRL1 - ACVR1B | rs3847858-T | + | MODIFIER | chr12 | A | T |
|
chr12:51924594
|
c.*3701A>T | Hemoglobin concentration0.023914 | a0001a0002a0003 | a0001c0001a0001c0011a0002c0007a0003c0009 | a0001c0001t0003a0001c0011t0003a0002c0007t0003a0003c0009t0003 | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(14): Show | HG00099.hp1 HG00280.hp2 HG00544.hp1 HG00544.hp2 HG00558.hp1 others(56): Show |
Trans-ethnic and Ancestry-Specific Blood-Cell Gene others(54): Show |
563,946 European ancestry individuals/ | NR | ACVRL1 - ACVR1B | rs3847858-T | + | MODIFIER | chr12 | A | T |
|
chr12:51923273
|
c.*2380C>G |
Medication use (HMG CoA reductase inhibitors) others(16): Show |
a0001a0002a0003 | a0001c0001a0001c0011a0002c0007a0003c0009 | a0001c0001t0003a0001c0011t0003a0002c0007t0003a0003c0009t0003 | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(14): Show | HG00099.hp1 HG00280.hp2 HG00544.hp1 HG00544.hp2 HG00558.hp1 others(56): Show |
Genome-wide association study of medication-use an others(39): Show |
73,475 European ancestry cases, 216,910 European a others(17): Show |
ACVRL1 | ACVRL1 | rs2293093-G | + | MODIFIER | chr12 | C | G |
|
chr12:51912002
|
c.-5-468C>T | Plateletcrit0.02877429 | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0003a0001c0005a0001c0006others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(33): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0032a0001c0001t0001g0033a0001c0001t0001g0042others(143): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(332): Show |
The Allelic Landscape of Human Blood Cell Trait Va others(44): Show |
164,339 European ancestry individuals/ | ACVRL1 | ACVRL1 | rs1700159-T | + | MODIFIER | chr12 | C | T |
|
chr12:51912002
|
c.-5-468C>T | White blood cell count0.03278325 | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0003a0001c0005a0001c0006others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(33): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0032a0001c0001t0001g0033a0001c0001t0001g0042others(143): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(332): Show |
The Allelic Landscape of Human Blood Cell Trait Va others(44): Show |
172,435 European ancestry individuals/ | ACVRL1 | ACVRL1 | rs1700159-T | + | MODIFIER | chr12 | C | T |
|
chr12:51912002
|
c.-5-468C>T | Monocyte count0.02582382 | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0003a0001c0005a0001c0006others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(33): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0032a0001c0001t0001g0033a0001c0001t0001g0042others(143): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(332): Show |
The Allelic Landscape of Human Blood Cell Trait Va others(44): Show |
170,721 European ancestry individuals/ | ACVRL1 | ACVRL1 | rs1700159-T | + | MODIFIER | chr12 | C | T |
|
chr12:51912002
|
c.-5-468C>T | Myeloid white cell count0.03093112 | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0003a0001c0005a0001c0006others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(33): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0032a0001c0001t0001g0033a0001c0001t0001g0042others(143): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(332): Show |
The Allelic Landscape of Human Blood Cell Trait Va others(44): Show |
169,219 European ancestry individuals/ | ACVRL1 | ACVRL1 | rs1700159-T | + | MODIFIER | chr12 | C | T |
|
chr12:51912002
|
c.-5-468C>T | Neutrophil count | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0003a0001c0005a0001c0006others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(33): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0032a0001c0001t0001g0033a0001c0001t0001g0042others(143): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(332): Show |
Genetic determinants of blood-cell traits influenc others(59): Show |
234,802 European ancestry individuals/100,556 Euro others(25): Show |
ACVRL1 | rs1700159-C | + | MODIFIER | chr12 | C | T | |
|
chr12:51912002
|
c.-5-468C>T | Monocyte count | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0003a0001c0005a0001c0006others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(33): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0032a0001c0001t0001g0033a0001c0001t0001g0042others(143): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(332): Show |
Genetic determinants of blood-cell traits influenc others(59): Show |
234,690 European ancestry individuals/100,494 Euro others(25): Show |
ACVRL1 | rs1700159-C | + | MODIFIER | chr12 | C | T | |
|
chr12:51913524
|
c.314-35A>G | Serine/threonine-protein kinase receptor R3 (analyte X16318.12) levelsothers(36): Show | a0001 | a0001c0001a0001c0002a0001c0003a0001c0004a0001c0005others(2): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004a0001c0001t0005a0001c0001t0010others(21): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0030a0001c0001t0001g0032a0001c0001t0001g0033others(87): Show | HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00323.hp1 HG00323.hp2 others(166): Show |
Proteogenomic analysis of human cerebrospinal flui others(103): Show |
2,721 European ancestry individuals/ | ACVRL1 | rs2071219-G | + | MODIFIER | chr12 | A | G | |
|
chr12:51918504
|
c.1247-481T>A | Serine/threonine-protein kinase receptor R3 levelsothers(15): Show | a0001 | a0001c0001 | a0001c0001t0004a0001c0001t0018 | a0001c0001t0004g0003a0001c0001t0004g0019a0001c0001t0004g0053a0001c0001t0004g0054a0001c0001t0004g0055others(7): Show | HG00438.hp2 HG00738.hp2 HG01192.hp2 HG01928.hp1 HG01981.hp2 others(34): Show |
Mapping the proteo-genomic convergence of human di others(7): Show |
10,708 European ancestry individuals/ | ACVRL1 | rs11169954-A | + | MODIFIER | chr12 | T | A | |
|
chr12:51920604
|
c.1378-155T>G | Estimated glomerular filtration rate (creatinine)others(14): Show | a0001a0002a0003 | a0001c0001a0001c0011a0002c0007a0003c0009 | a0001c0001t0003a0001c0001t0018a0001c0011t0003a0002c0007t0003a0003c0009t0003 | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(15): Show | HG00099.hp1 HG00280.hp2 HG00544.hp1 HG00544.hp2 HG00558.hp1 others(57): Show |
Epigenomic and transcriptomic analyses define core others(64): Show |
1,205,871 European ancestry individuals, 168,300 E others(384): Show |
ACVRL1 | rs2277383-G | + | MODIFIER | chr12 | T | G | |
|
chr12:51920604
|
c.1378-155T>G | Coronary artery disease0.966 | a0001a0002a0003 | a0001c0001a0001c0011a0002c0007a0003c0009 | a0001c0001t0003a0001c0001t0018a0001c0011t0003a0002c0007t0003a0003c0009t0003 | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(15): Show | HG00099.hp1 HG00280.hp2 HG00544.hp1 HG00544.hp2 HG00558.hp1 others(57): Show |
Discovery and systematic characterization of risk others(78): Show |
210,842 European ancestry, East Asian ancestry, un others(80): Show |
ACVRL1 | rs2277383-T | + | MODIFIER | chr12 | T | G | |
|
chr12:51920604
|
c.1378-155T>G | Blood urea nitrogen levels0.0034 | a0001a0002a0003 | a0001c0001a0001c0011a0002c0007a0003c0009 | a0001c0001t0003a0001c0001t0018a0001c0011t0003a0002c0007t0003a0003c0009t0003 | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(15): Show | HG00099.hp1 HG00280.hp2 HG00544.hp1 HG00544.hp2 HG00558.hp1 others(57): Show |
Discovery and prioritization of variants and genes others(49): Show |
679,531 European ancestry individuals, 173,149 ind others(9): Show |
ACVRL1 | rs2277383-G | + | MODIFIER | chr12 | T | G | |
|
chr12:51920604
|
c.1378-155T>G | Estimated glomerular filtration rate (creatinine)others(16): Show | a0001a0002a0003 | a0001c0001a0001c0011a0002c0007a0003c0009 | a0001c0001t0003a0001c0001t0018a0001c0011t0003a0002c0007t0003a0003c0009t0003 | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(15): Show | HG00099.hp1 HG00280.hp2 HG00544.hp1 HG00544.hp2 HG00558.hp1 others(57): Show |
Discovery and prioritization of variants and genes others(49): Show |
1,004,040 European ancestry individuals, 165,726 E others(189): Show |
ACVRL1 | rs2277383-G | + | MODIFIER | chr12 | T | G | |
|
chr12:51924594
|
c.*3701A>T | Hemoglobin concentration | a0001a0002a0003 | a0001c0001a0001c0011a0002c0007a0003c0009 | a0001c0001t0003a0001c0011t0003a0002c0007t0003a0003c0009t0003 | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(14): Show | HG00099.hp1 HG00280.hp2 HG00544.hp1 HG00544.hp2 HG00558.hp1 others(56): Show |
Trans-ethnic and Ancestry-Specific Blood-Cell Gene others(54): Show |
746,431 African American or Afro-Caribbean, Africa others(116): Show |
NR | ACVRL1 - ACVR1B | rs3847858-T | + | MODIFIER | chr12 | A | T |
|
chr12:51912002
|
c.-5-468C>T | Monocyte count | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0003a0001c0005a0001c0006others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(33): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0032a0001c0001t0001g0033a0001c0001t0001g0042others(143): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(332): Show |
Trans-ethnic and Ancestry-Specific Blood-Cell Gene others(54): Show |
639,696 African American or Afro-Caribbean, Africa others(116): Show |
NR | ACVRL1 | rs1700159-T | + | MODIFIER | chr12 | C | T |
|
chr12:51912002
|
c.-5-468C>T | Monocyte count0.020438 | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0003a0001c0005a0001c0006others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(33): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0032a0001c0001t0001g0033a0001c0001t0001g0042others(143): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(332): Show |
Trans-ethnic and Ancestry-Specific Blood-Cell Gene others(54): Show |
521,594 European ancestry individuals/ | NR | ACVRL1 | rs1700159-T | + | MODIFIER | chr12 | C | T |
|
chr12:51912002
|
c.-5-468C>T | Lymphocyte count0.017172 | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0003a0001c0005a0001c0006others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(33): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0032a0001c0001t0001g0033a0001c0001t0001g0042others(143): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(332): Show |
Trans-ethnic and Ancestry-Specific Blood-Cell Gene others(54): Show |
524,923 European ancestry individuals/ | NR | ACVRL1 | rs1700159-T | + | MODIFIER | chr12 | C | T |
|
chr12:51912002
|
c.-5-468C>T | Lymphocyte count | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0003a0001c0005a0001c0006others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(33): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0032a0001c0001t0001g0033a0001c0001t0001g0042others(143): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(332): Show |
Trans-ethnic and Ancestry-Specific Blood-Cell Gene others(54): Show |
643,370 African American or Afro-Caribbean, Africa others(116): Show |
NR | ACVRL1 | rs1700159-T | + | MODIFIER | chr12 | C | T |
|
chr12:51924594
|
c.*3701A>T | Hemoglobin concentration0.029339 | a0001a0002a0003 | a0001c0001a0001c0011a0002c0007a0003c0009 | a0001c0001t0003a0001c0011t0003a0002c0007t0003a0003c0009t0003 | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(14): Show | HG00099.hp1 HG00280.hp2 HG00544.hp1 HG00544.hp2 HG00558.hp1 others(56): Show |
Trans-ethnic and Ancestry-Specific Blood-Cell Gene others(54): Show |
149,861 East Asian ancestry individuals/ | NR | ACVRL1 - ACVR1B | rs3847858-A | + | MODIFIER | chr12 | A | T |
|
chr12:51922139
|
c.*1246T>C | Mean platelet volume | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0005a0001c0010a0001c0011others(3): Show | a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005a0001c0001t0006others(29): Show | a0001c0001t0002g0004a0001c0001t0002g0005a0001c0001t0002g0006a0001c0001t0002g0008a0001c0001t0002g0012others(120): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(291): Show |
Trans-ethnic and Ancestry-Specific Blood-Cell Gene others(54): Show |
484,042 African American or Afro-Caribbean, Africa others(116): Show |
NR | ACVRL1 | rs706819-T | + | MODIFIER | chr12 | T | C |
|
chr12:51912002
|
c.-5-468C>T | Platelet count0.01569 | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0003a0001c0005a0001c0006others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(33): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0032a0001c0001t0001g0033a0001c0001t0001g0042others(143): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(332): Show |
Trans-ethnic and Ancestry-Specific Blood-Cell Gene others(54): Show |
542,827 European ancestry individuals/ | NR | ACVRL1 | rs1700159-T | + | MODIFIER | chr12 | C | T |
|
chr12:51922139
|
c.*1246T>C | Mean platelet volume0.016409 | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0005a0001c0010a0001c0011others(3): Show | a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005a0001c0001t0006others(29): Show | a0001c0001t0002g0004a0001c0001t0002g0005a0001c0001t0002g0006a0001c0001t0002g0008a0001c0001t0002g0012others(120): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(291): Show |
Trans-ethnic and Ancestry-Specific Blood-Cell Gene others(54): Show |
460,935 European ancestry individuals/ | NR | ACVRL1 | rs706819-T | + | MODIFIER | chr12 | T | C |
|
chr12:51912002
|
c.-5-468C>T | Neutrophil count0.02158 | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0003a0001c0005a0001c0006others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(33): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0032a0001c0001t0001g0033a0001c0001t0001g0042others(143): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(332): Show |
Trans-ethnic and Ancestry-Specific Blood-Cell Gene others(54): Show |
519,288 European ancestry individuals/ | NR | ACVRL1 | rs1700159-T | + | MODIFIER | chr12 | C | T |
|
chr12:51912002
|
c.-5-468C>T | Neutrophil count | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0003a0001c0005a0001c0006others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(33): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0032a0001c0001t0001g0033a0001c0001t0001g0042others(143): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(332): Show |
Trans-ethnic and Ancestry-Specific Blood-Cell Gene others(54): Show |
627,215 African American or Afro-Caribbean, Africa others(116): Show |
NR | ACVRL1 | rs1700159-T | + | MODIFIER | chr12 | C | T |
|
chr12:51912002
|
c.-5-468C>T | Platelet count | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0003a0001c0005a0001c0006others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(33): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0032a0001c0001t0001g0033a0001c0001t0001g0042others(143): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(332): Show |
Trans-ethnic and Ancestry-Specific Blood-Cell Gene others(54): Show |
721,201 African American or Afro-Caribbean, Africa others(116): Show |
NR | ACVRL1 | rs1700159-T | + | MODIFIER | chr12 | C | T |
|
chr12:51912002
|
c.-5-468C>T | White blood cell count | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0003a0001c0005a0001c0006others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(33): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0032a0001c0001t0001g0033a0001c0001t0001g0042others(143): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(332): Show |
Trans-ethnic and Ancestry-Specific Blood-Cell Gene others(54): Show |
746,667 African American or Afro-Caribbean, Africa others(116): Show |
NR | ACVRL1 | rs1700159-T | + | MODIFIER | chr12 | C | T |
|
chr12:51912002
|
c.-5-468C>T | White blood cell count0.02445 | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0003a0001c0005a0001c0006others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(33): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0032a0001c0001t0001g0033a0001c0001t0001g0042others(143): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(332): Show |
Trans-ethnic and Ancestry-Specific Blood-Cell Gene others(54): Show |
562,243 European ancestry individuals/ | NR | ACVRL1 | rs1700159-T | + | MODIFIER | chr12 | C | T |
|
chr12:51924594
|
c.*3701A>T | Red blood cell count | a0001a0002a0003 | a0001c0001a0001c0011a0002c0007a0003c0009 | a0001c0001t0003a0001c0011t0003a0002c0007t0003a0003c0009t0003 | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(14): Show | HG00099.hp1 HG00280.hp2 HG00544.hp1 HG00544.hp2 HG00558.hp1 others(56): Show |
Trans-ethnic and Ancestry-Specific Blood-Cell Gene others(54): Show |
727,624 African American or Afro-Caribbean, Africa others(116): Show |
NR | ACVRL1 - ACVR1B | rs3847858-T | + | MODIFIER | chr12 | A | T |
|
chr12:51922819
|
c.*1926T>C | Red blood cell count | a0001a0002a0003 | a0001c0001a0001c0002a0001c0005a0001c0011a0002c0007others(1): Show | a0001c0001t0003a0001c0001t0007a0001c0001t0017a0001c0001t0024a0001c0001t0025others(7): Show | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(25): Show | HG00099.hp1 HG00280.hp2 HG00438.hp1 HG00544.hp1 HG00544.hp2 others(73): Show |
Analysis across Taiwan Biobank, Biobank Japan, and others(73): Show |
92,615 Taiwanese ancestry individuals/ | ACVRL1 | rs2293094-? | + | MODIFIER | chr12 | T | C | |
|
chr12:51924189
|
c.*3296G>A | Height0.0047 | a0001a0004 | a0001c0001a0001c0002a0001c0005a0001c0010a0004c0008 | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0006others(19): Show | a0001c0001t0001g0007a0001c0001t0001g0042a0001c0001t0001g0043a0001c0001t0001g0073a0001c0001t0001g0094others(48): Show | HG00280.hp2 HG00438.hp2 HG00738.hp1 HG00738.hp2 HG01069.hp2 others(97): Show |
A saturated map of common genetic variants associa others(22): Show |
5,314,291 European ancestry, Hispanic or Latin Ame others(79): Show |
ACVRL1 - ACVR1B | rs2641534-A | + | MODIFIER | chr12 | G | A | |
|
chr12:51920604
|
c.1378-155T>G | Hemoglobin0.0194 | a0001a0002a0003 | a0001c0001a0001c0011a0002c0007a0003c0009 | a0001c0001t0003a0001c0001t0018a0001c0011t0003a0002c0007t0003a0003c0009t0003 | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(15): Show | HG00099.hp1 HG00280.hp2 HG00544.hp1 HG00544.hp2 HG00558.hp1 others(57): Show |
A cross-population atlas of genetic associations f others(24): Show |
350,474 European ancestry individuals, 152,447 Eas others(29): Show |
ACVRL1 | rs2277383-G | + | MODIFIER | chr12 | T | G | |
|
chr12:51923273
|
c.*2380C>G | Hematocrit0.0207 | a0001a0002a0003 | a0001c0001a0001c0011a0002c0007a0003c0009 | a0001c0001t0003a0001c0011t0003a0002c0007t0003a0003c0009t0003 | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(14): Show | HG00099.hp1 HG00280.hp2 HG00544.hp1 HG00544.hp2 HG00558.hp1 others(56): Show |
A cross-population atlas of genetic associations f others(24): Show |
350,475 European ancestry individuals, 153,015 Eas others(29): Show |
ACVRL1 | rs2293093-G | + | MODIFIER | chr12 | C | G | |
|
chr12:51914237
|
c.625+164T>C | Serine/threonine-protein kinase receptor R3 levelsothers(15): Show | a0001 | a0001c0001 | a0001c0001t0004a0001c0001t0018 | a0001c0001t0004g0003a0001c0001t0004g0019a0001c0001t0004g0054a0001c0001t0004g0055a0001c0001t0004g0056others(5): Show | HG00438.hp2 HG00738.hp2 HG01928.hp1 HG01981.hp2 HG02071.hp1 others(32): Show |
Mapping the serum proteome to neurological disease others(32): Show |
2,893 European ancestry individuals/ | ACVRL1 | rs77709482-T | + | MODIFIER | chr12 | T | C | |
|
chr12:51912002
|
c.-5-468C>T | Monocyte count0.0158 | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0003a0001c0005a0001c0006others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(33): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0032a0001c0001t0001g0033a0001c0001t0001g0042others(143): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(332): Show |
A cross-population atlas of genetic associations f others(24): Show |
349,856 European ancestry individuals, 95,119 East others(28): Show |
ACVRL1 | rs1700159-T | + | MODIFIER | chr12 | C | T | |
|
chr12:51923273
|
c.*2380C>G | Red blood cell count0.0141 | a0001a0002a0003 | a0001c0001a0001c0011a0002c0007a0003c0009 | a0001c0001t0003a0001c0011t0003a0002c0007t0003a0003c0009t0003 | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(14): Show | HG00099.hp1 HG00280.hp2 HG00544.hp1 HG00544.hp2 HG00558.hp1 others(56): Show |
A cross-population atlas of genetic associations f others(24): Show |
350,475 European ancestry individuals, 153,512 Eas others(29): Show |
ACVRL1 | rs2293093-G | + | MODIFIER | chr12 | C | G | |
|
chr12:51924594
|
c.*3701A>T | Hemoglobin0.021613702 | a0001a0002a0003 | a0001c0001a0001c0011a0002c0007a0003c0009 | a0001c0001t0003a0001c0011t0003a0002c0007t0003a0003c0009t0003 | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(14): Show | HG00099.hp1 HG00280.hp2 HG00544.hp1 HG00544.hp2 HG00558.hp1 others(56): Show |
The Polygenic and Monogenic Basis of Blood Traits others(13): Show |
408,112 British individuals/ | ACVRL1 | ACVRL1 - ACVR1B | rs3847858-T | + | MODIFIER | chr12 | A | T |
|
chr12:51909085
|
c.-6+1390T>C | ACVRL1/EFNA4 protein level ratio0.625824 | a0001 | a0001c0001a0001c0002 | a0001c0001t0001a0001c0001t0004a0001c0001t0018a0001c0002t0006 | a0001c0001t0001g0016a0001c0001t0001g0038a0001c0001t0001g0073a0001c0001t0004g0003a0001c0001t0004g0019others(6): Show | HG00438.hp2 HG00735.hp1 HG00738.hp2 HG01081.hp1 HG01192.hp2 others(38): Show |
Genetic associations with ratios between protein l others(63): Show |
43,509 European ancestry individuals/ | ACVRL1 | rs76782411-? | + | MODIFIER | chr12 | T | C | |
|
chr12:51909085
|
c.-6+1390T>C | ACVRL1/TNFRSF10B protein level ratio0.585016 | a0001 | a0001c0001a0001c0002 | a0001c0001t0001a0001c0001t0004a0001c0001t0018a0001c0002t0006 | a0001c0001t0001g0016a0001c0001t0001g0038a0001c0001t0001g0073a0001c0001t0004g0003a0001c0001t0004g0019others(6): Show | HG00438.hp2 HG00735.hp1 HG00738.hp2 HG01081.hp1 HG01192.hp2 others(38): Show |
Genetic associations with ratios between protein l others(63): Show |
43,509 European ancestry individuals/ | ACVRL1 | rs76782411-? | + | MODIFIER | chr12 | T | C | |
|
chr12:51912002
|
c.-5-468C>T | Neutrophil count0.020982396 | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0003a0001c0005a0001c0006others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(33): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0032a0001c0001t0001g0033a0001c0001t0001g0042others(143): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(332): Show |
The Polygenic and Monogenic Basis of Blood Traits others(13): Show |
408,112 British individuals/ | ACVRL1 | ACVRL1 | rs1700159-T | + | MODIFIER | chr12 | C | T |
|
chr12:51912002
|
c.-5-468C>T | Monocyte count0.019132491 | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0003a0001c0005a0001c0006others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(33): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0032a0001c0001t0001g0033a0001c0001t0001g0042others(143): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(332): Show |
The Polygenic and Monogenic Basis of Blood Traits others(13): Show |
408,112 British individuals/ | ACVRL1 | ACVRL1 | rs1700159-C | + | MODIFIER | chr12 | C | T |
|
chr12:51912002
|
c.-5-468C>T | White blood cell count0.024555305 | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0003a0001c0005a0001c0006others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(33): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0032a0001c0001t0001g0033a0001c0001t0001g0042others(143): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(332): Show |
The Polygenic and Monogenic Basis of Blood Traits others(13): Show |
408,112 British individuals/ | ACVRL1 | ACVRL1 | rs1700159-T | + | MODIFIER | chr12 | C | T |
|
chr12:51912002
|
c.-5-468C>T | Platelet count0.017000787 | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0003a0001c0005a0001c0006others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(33): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0032a0001c0001t0001g0033a0001c0001t0001g0042others(143): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(332): Show |
The Polygenic and Monogenic Basis of Blood Traits others(13): Show |
408,112 British individuals/ | ACVRL1 | ACVRL1 | rs1700159-T | + | MODIFIER | chr12 | C | T |
|
chr12:51912002
|
c.-5-468C>T | Plateletcrit0.02518572 | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0003a0001c0005a0001c0006others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(33): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0032a0001c0001t0001g0033a0001c0001t0001g0042others(143): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(332): Show |
The Polygenic and Monogenic Basis of Blood Traits others(13): Show |
408,112 British individuals/ | ACVRL1 | ACVRL1 | rs1700159-T | + | MODIFIER | chr12 | C | T |
|
chr12:51912002
|
c.-5-468C>T | Lymphocyte count0.015135433 | a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0003a0001c0005a0001c0006others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(33): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0032a0001c0001t0001g0033a0001c0001t0001g0042others(143): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(332): Show |
The Polygenic and Monogenic Basis of Blood Traits others(13): Show |
408,112 British individuals/ | ACVRL1 | ACVRL1 | rs1700159-T | + | MODIFIER | chr12 | C | T |
|
chr12:51912002
|
c.-5-468C>T |
Monocyte count (UKB data field 30130)0.0 others(8): Show |
a0001a0002a0003a0004 | a0001c0001a0001c0002a0001c0003a0001c0005a0001c0006others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(33): Show | a0001c0001t0001g0007a0001c0001t0001g0012a0001c0001t0001g0032a0001c0001t0001g0033a0001c0001t0001g0042others(143): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(332): Show |
A scalable variational inference approach for incr others(36): Show |
394,642 European ancestry individuals/ | ACVRL1 | rs1700159-T | + | MODIFIER | chr12 | C | T | |
|
chr12:51906326
|
c.-1375C>T | ACVRL1 protein levels0.13929912 | a0001 | a0001c0001 | a0001c0001t0002 | a0001c0001t0002g0013 | HG02300.hp2 |
A scalable variational inference approach for incr others(36): Show |
47,745 European ancestry individuals/ | ANKRD33 - ACVRL1 | rs117564283-T | + | MODIFIER | chr12 | C | T | |
|
chr12:51923273
|
c.*2380C>G | ACVRL1 protein levels0.19997895 | a0001a0002a0003 | a0001c0001a0001c0011a0002c0007a0003c0009 | a0001c0001t0003a0001c0011t0003a0002c0007t0003a0003c0009t0003 | a0001c0001t0003g0002a0001c0001t0003g0010a0001c0001t0003g0035a0001c0001t0003g0077a0001c0001t0003g0107others(14): Show | HG00099.hp1 HG00280.hp2 HG00544.hp1 HG00544.hp2 HG00558.hp1 others(56): Show |
A scalable variational inference approach for incr others(36): Show |
47,745 European ancestry individuals/ | ACVRL1 | rs2293093-G | + | MODIFIER | chr12 | C | G | |
|
chr12:51905754
|
c.-1947A>C | ACVRL1 protein levels0.17454757 | a0001 | a0001c0001 | a0001c0001t0001 | a0001c0001t0001g0001a0001c0001t0001g0082 | HG00639.hp2 HG01256.hp1 |
A scalable variational inference approach for incr others(36): Show |
47,745 European ancestry individuals/ | ANKRD33 - ACVRL1 | rs73111518-C | + | MODIFIER | chr12 | A | C |