| geneid | 127550 |
|---|---|
| ensemblid | ENSG00000184389.9 |
| hgncid | 30005 |
| symbol | A3GALT2 |
| name | alpha 1,3-galactosyltransferase 2 |
| refseq_nuc | NM_001080438.1 |
| refseq_prot | NP_001073907.1 |
| ensembl_nuc | ENST00000442999.3 |
| ensembl_prot | ENSP00000475261.1 |
| mane_status | MANE Select |
| chr | chr1 |
| start | 33306766 |
| end | 33321098 |
| strand | - |
| ver | v1.2 |
| region | chr1:33306766-33321098 |
| region5000 | chr1:33301766-33326098 |
| regionname0 | A3GALT2_chr1_33306766_33321098 |
| regionname5000 | A3GALT2_chr1_33301766_33326098 |
| chr:pos | ref | alt | af | annotation | impact | samples | AHAPIDS | ACHAPIDS | ACTHAPIDS | ACTGHAPIDS | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|
| chr:pos | ref | alt | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | af | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr1:33307710
|
T | TCCCCACC others(26): Show |
intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00423.hp2 others(167): Show |
a0001a0002a0003others(6): Show | a0001c0001a0001c0014a0001c0015others(8): Show | a0001c0001t0000a0001c0014t0000a0001c0015t0000others(8): Show | a0001c0001t0000g0004a0001c0001t0000g0009a0001c0001t0000g0012others(124): Show | 170 | 418 | 0.4067 | 33 | A3GALT2 | ENSG00000184389.9 | transcript | ENST00000442999.3 | protein_coding | 4/4 | c.336-290_336-258dupGTGGGGGGGAGGTGGGAGTGGGGTGAGGTGGGG | ||||||
|
chr1:33307785
|
C | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00323.hp2 others(309): Show |
a0001a0002a0003others(8): Show | a0001c0001a0001c0006a0001c0014others(11): Show | a0001c0001t0000a0001c0006t0000a0001c0014t0000others(11): Show | a0001c0001t0000g0001a0001c0001t0000g0002a0001c0001t0000g0004others(188): Show | 312 | 418 | 0.7464 | 0 | A3GALT2 | ENSG00000184389.9 | transcript | ENST00000442999.3 | protein_coding | 4/4 | c.336-332G>T | ||||||
|
chr1:33307859
|
C | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00423.hp2 others(165): Show |
a0001a0002a0003others(5): Show | a0001c0001a0001c0015a0002c0002others(6): Show | a0001c0001t0000a0001c0015t0000a0002c0002t0000others(6): Show | a0001c0001t0000g0004a0001c0001t0000g0009a0001c0001t0000g0012others(123): Show | 168 | 418 | 0.4019 | 0 | A3GALT2 | ENSG00000184389.9 | transcript | ENST00000442999.3 | protein_coding | 4/4 | c.336-406G>C | ||||||
|
chr1:33308011
|
CACCTCAC others(10): Show |
C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(411): Show |
a0001a0002a0003others(9): Show | a0001c0001a0001c0006a0001c0014others(12): Show | a0001c0001t0000a0001c0006t0000a0001c0014t0000others(12): Show | a0001c0001t0000g0001a0001c0001t0000g0002a0001c0001t0000g0003others(252): Show | 414 | 418 | 0.9904 | -17 | A3GALT2 | ENSG00000184389.9 | transcript | ENST00000442999.3 | protein_coding | 4/4 | c.336-575_336-559delTGCGGTGGGGGTGAGGT | ||||||
|
chr1:33309151
|
A | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00323.hp2 others(312): Show |
a0001a0002a0003others(8): Show | a0001c0001a0001c0006a0001c0014others(11): Show | a0001c0001t0000a0001c0006t0000a0001c0014t0000others(11): Show | a0001c0001t0000g0001a0001c0001t0000g0002a0001c0001t0000g0004others(191): Show | 315 | 418 | 0.7536 | 0 | A3GALT2 | ENSG00000184389.9 | transcript | ENST00000442999.3 | protein_coding | 4/4 | c.336-1698T>G | ||||||
|
chr1:33309373
|
C | T | intron_variant | MODIFIER | HG00639.hp2 HG01243.hp2 HG02451.hp2 others(1): Show |
a0001 | a0001c0001a0001c0015 | a0001c0001t0000a0001c0015t0000 | a0001c0001t0000g0062a0001c0001t0000g0063a0001c0001t0000g0154others(1): Show | 4 | 418 | 0.0096 | 0 | A3GALT2 | ENSG00000184389.9 | transcript | ENST00000442999.3 | protein_coding | 4/4 | c.336-1920G>A | ||||||
|
chr1:33309410
|
C | T | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00423.hp2 others(166): Show |
a0001a0002a0003others(5): Show | a0001c0001a0001c0015a0002c0002others(6): Show | a0001c0001t0000a0001c0015t0000a0002c0002t0000others(6): Show | a0001c0001t0000g0004a0001c0001t0000g0009a0001c0001t0000g0012others(124): Show | 169 | 418 | 0.4043 | 0 | A3GALT2 | ENSG00000184389.9 | transcript | ENST00000442999.3 | protein_coding | 4/4 | c.336-1957G>A | ||||||
|
chr1:33309491
|
C | T | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00423.hp2 others(165): Show |
a0001a0002a0003others(5): Show | a0001c0001a0001c0015a0002c0002others(6): Show | a0001c0001t0000a0001c0015t0000a0002c0002t0000others(6): Show | a0001c0001t0000g0004a0001c0001t0000g0009a0001c0001t0000g0012others(123): Show | 168 | 418 | 0.4019 | 0 | A3GALT2 | ENSG00000184389.9 | transcript | ENST00000442999.3 | protein_coding | 4/4 | c.336-2038G>A | ||||||
|
chr1:33309636
|
G | A | intron_variant | MODIFIER | HG00639.hp2 HG01243.hp2 HG02896.hp2 |
a0001 | a0001c0001 | a0001c0001t0000 | a0001c0001t0000g0062a0001c0001t0000g0063a0001c0001t0000g0154 | 3 | 418 | 0.0072 | 0 | A3GALT2 | ENSG00000184389.9 | transcript | ENST00000442999.3 | protein_coding | 4/4 | c.336-2183C>T | ||||||
|
chr1:33310840
|
C | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00323.hp2 others(314): Show |
a0001a0002a0003others(8): Show | a0001c0001a0001c0006a0001c0014others(11): Show | a0001c0001t0000a0001c0006t0000a0001c0014t0000others(11): Show | a0001c0001t0000g0001a0001c0001t0000g0002a0001c0001t0000g0004others(191): Show | 317 | 418 | 0.7584 | 0 | A3GALT2 | ENSG00000184389.9 | transcript | ENST00000442999.3 | protein_coding | 4/4 | c.335+1212G>T | ||||||
|
chr1:33311127
|
C | T | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00323.hp2 others(314): Show |
a0001a0002a0003others(8): Show | a0001c0001a0001c0006a0001c0014others(11): Show | a0001c0001t0000a0001c0006t0000a0001c0014t0000others(11): Show | a0001c0001t0000g0001a0001c0001t0000g0002a0001c0001t0000g0004others(191): Show | 317 | 418 | 0.7584 | 0 | A3GALT2 | ENSG00000184389.9 | transcript | ENST00000442999.3 | protein_coding | 4/4 | c.335+925G>A | ||||||
|
chr1:33311923
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00323.hp2 others(315): Show |
a0001a0002a0003others(8): Show | a0001c0001a0001c0006a0001c0014others(11): Show | a0001c0001t0000a0001c0006t0000a0001c0014t0000others(11): Show | a0001c0001t0000g0001a0001c0001t0000g0002a0001c0001t0000g0004others(192): Show | 318 | 418 | 0.7608 | 0 | A3GALT2 | ENSG00000184389.9 | transcript | ENST00000442999.3 | protein_coding | 4/4 | c.335+129A>G | ||||||
|
chr1:33312625
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00423.hp2 others(166): Show |
a0001a0002a0003others(5): Show | a0001c0001a0001c0015a0002c0002others(6): Show | a0001c0001t0000a0001c0015t0000a0002c0002t0000others(6): Show | a0001c0001t0000g0004a0001c0001t0000g0009a0001c0001t0000g0012others(124): Show | 169 | 418 | 0.4043 | 0 | A3GALT2 | ENSG00000184389.9 | transcript | ENST00000442999.3 | protein_coding | 2/4 | c.108-35C>T | ||||||
|
chr1:33312990
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00323.hp2 others(314): Show |
a0001a0002a0003others(8): Show | a0001c0001a0001c0006a0001c0014others(11): Show | a0001c0001t0000a0001c0006t0000a0001c0014t0000others(11): Show | a0001c0001t0000g0001a0001c0001t0000g0002a0001c0001t0000g0004others(191): Show | 317 | 418 | 0.7584 | 0 | A3GALT2 | ENSG00000184389.9 | transcript | ENST00000442999.3 | protein_coding | 1/4 | c.24-100A>G | ||||||
|
chr1:33313171
|
C | CTG | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(414): Show |
a0001a0002a0003others(9): Show | a0001c0001a0001c0006a0001c0014others(12): Show | a0001c0001t0000a0001c0006t0000a0001c0014t0000others(12): Show | a0001c0001t0000g0001a0001c0001t0000g0002a0001c0001t0000g0003others(255): Show | 417 | 418 | 0.9976 | 2 | A3GALT2 | ENSG00000184389.9 | transcript | ENST00000442999.3 | protein_coding | 1/4 | c.24-282_24-281insCA | ||||||
|
chr1:33313175
|
G | GTT | intron_variant | MODIFIER | HG00099.hp2 HG00438.hp2 HG00558.hp1 others(140): Show |
a0001a0002a0004others(4): Show | a0001c0001a0001c0006a0001c0015others(6): Show | a0001c0001t0000a0001c0006t0000a0001c0015t0000others(6): Show | a0001c0001t0000g0004a0001c0001t0000g0009a0001c0001t0000g0012others(99): Show | 143 | 418 | 0.3421 | 2 | A3GALT2 | ENSG00000184389.9 | transcript | ENST00000442999.3 | protein_coding | 1/4 | c.24-287_24-286dupAA | ||||||
|
chr1:33313442
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00423.hp2 others(183): Show |
a0001a0002a0003others(6): Show | a0001c0001a0001c0006a0001c0014others(9): Show | a0001c0001t0000a0001c0006t0000a0001c0014t0000others(9): Show | a0001c0001t0000g0004a0001c0001t0000g0009a0001c0001t0000g0012others(138): Show | 186 | 418 | 0.4450 | 0 | A3GALT2 | ENSG00000184389.9 | transcript | ENST00000442999.3 | protein_coding | 1/4 | c.24-552A>G | ||||||
|
chr1:33314093
|
C | T | intron_variant | MODIFIER | HG00639.hp2 HG01243.hp2 HG02451.hp2 others(1): Show |
a0001 | a0001c0001a0001c0015 | a0001c0001t0000a0001c0015t0000 | a0001c0001t0000g0062a0001c0001t0000g0063a0001c0001t0000g0154others(1): Show | 4 | 418 | 0.0096 | 0 | A3GALT2 | ENSG00000184389.9 | transcript | ENST00000442999.3 | protein_coding | 1/4 | c.24-1203G>A | ||||||
|
chr1:33315380
|
CA | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00323.hp2 others(287): Show |
a0001a0002a0003others(6): Show | a0001c0001a0001c0006a0001c0014others(8): Show | a0001c0001t0000a0001c0006t0000a0001c0014t0000others(8): Show | a0001c0001t0000g0001a0001c0001t0000g0002a0001c0001t0000g0004others(166): Show | 290 | 418 | 0.6938 | -1 | A3GALT2 | ENSG00000184389.9 | transcript | ENST00000442999.3 | protein_coding | 1/4 | c.24-2491delT | ||||||
|
chr1:33315933
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00423.hp2 others(165): Show |
a0001a0002a0003others(5): Show | a0001c0001a0001c0015a0002c0002others(6): Show | a0001c0001t0000a0001c0015t0000a0002c0002t0000others(6): Show | a0001c0001t0000g0004a0001c0001t0000g0009a0001c0001t0000g0012others(123): Show | 168 | 418 | 0.4019 | 0 | A3GALT2 | ENSG00000184389.9 | transcript | ENST00000442999.3 | protein_coding | 1/4 | c.24-3043C>T | ||||||
|
chr1:33316568
|
T | TTAGGTGC others(1): Show |
intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00423.hp2 others(166): Show |
a0001a0002a0003others(5): Show | a0001c0001a0001c0015a0002c0002others(6): Show | a0001c0001t0000a0001c0015t0000a0002c0002t0000others(6): Show | a0001c0001t0000g0004a0001c0001t0000g0009a0001c0001t0000g0012others(124): Show | 169 | 418 | 0.4043 | 8 | A3GALT2 | ENSG00000184389.9 | transcript | ENST00000442999.3 | protein_coding | 1/4 | c.24-3686_24-3679dupGGCACCTA | ||||||
|
chr1:33317967
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00408.hp1 others(244): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0006a0001c0014others(10): Show | a0001c0001t0000a0001c0006t0000a0001c0014t0000others(10): Show | a0001c0001t0000g0001a0001c0001t0000g0004a0001c0001t0000g0005others(158): Show | 247 | 418 | 0.5909 | 0 | A3GALT2 | ENSG00000184389.9 | transcript | ENST00000442999.3 | protein_coding | 1/4 | c.23+3109T>C | ||||||
|
chr1:33318147
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00408.hp1 others(244): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0006a0001c0014others(10): Show | a0001c0001t0000a0001c0006t0000a0001c0014t0000others(10): Show | a0001c0001t0000g0001a0001c0001t0000g0004a0001c0001t0000g0005others(158): Show | 247 | 418 | 0.5909 | 0 | A3GALT2 | ENSG00000184389.9 | transcript | ENST00000442999.3 | protein_coding | 1/4 | c.23+2929C>T | ||||||
|
chr1:33318545
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00323.hp2 others(314): Show |
a0001a0002a0003others(8): Show | a0001c0001a0001c0006a0001c0014others(11): Show | a0001c0001t0000a0001c0006t0000a0001c0014t0000others(11): Show | a0001c0001t0000g0001a0001c0001t0000g0002a0001c0001t0000g0004others(191): Show | 317 | 418 | 0.7584 | 0 | A3GALT2 | ENSG00000184389.9 | transcript | ENST00000442999.3 | protein_coding | 1/4 | c.23+2531A>G | ||||||
|
chr1:33319026
|
C | T | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00423.hp2 others(166): Show |
a0001a0002a0003others(5): Show | a0001c0001a0001c0015a0002c0002others(6): Show | a0001c0001t0000a0001c0015t0000a0002c0002t0000others(6): Show | a0001c0001t0000g0004a0001c0001t0000g0009a0001c0001t0000g0012others(124): Show | 169 | 418 | 0.4043 | 0 | A3GALT2 | ENSG00000184389.9 | transcript | ENST00000442999.3 | protein_coding | 1/4 | c.23+2050G>A | ||||||
|
chr1:33319328
|
C | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00323.hp2 others(314): Show |
a0001a0002a0003others(8): Show | a0001c0001a0001c0006a0001c0014others(11): Show | a0001c0001t0000a0001c0006t0000a0001c0014t0000others(11): Show | a0001c0001t0000g0001a0001c0001t0000g0002a0001c0001t0000g0004others(191): Show | 317 | 418 | 0.7584 | 0 | A3GALT2 | ENSG00000184389.9 | transcript | ENST00000442999.3 | protein_coding | 1/4 | c.23+1748G>C | ||||||
|
chr1:33320377
|
A | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00423.hp2 others(166): Show |
a0001a0002a0003others(5): Show | a0001c0001a0001c0015a0002c0002others(6): Show | a0001c0001t0000a0001c0015t0000a0002c0002t0000others(6): Show | a0001c0001t0000g0004a0001c0001t0000g0009a0001c0001t0000g0012others(124): Show | 169 | 418 | 0.4043 | 0 | A3GALT2 | ENSG00000184389.9 | transcript | ENST00000442999.3 | protein_coding | 1/4 | c.23+699T>G |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
ahapid | alen | total | AFR | AMR | EAS | EUR | SAS | aseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A3GALT2 | 1/1 | a0001 | 340 | 398 | 84 | 62 | 187 | 15 | 48 | subcellular location copy fasta | chr1 | 33301766 | 33326098 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
chapid | clen | total | AFR | AMR | EAS | EUR | SAS | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A3GALT2 | 1/1 | c0001 | 1023 | 394 | 80 | 62 | 187 | 15 | 48 | copy fasta | chr1 | 33301766 | 33326098 |
| genename | grch38/chm13v2 | ghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| A3GALT2 | 0/0 | g0062 | 1 | 0 | 1 | 0 | 0 | 0 | chr1 | 33301766 | 33326098 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
achapid | total | AFR | AMR | EAS | EUR | SAS | clen | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A3GALT2 | 1/1 | a0001c0001 | 394 | 80 | 62 | 187 | 15 | 48 | 1023 | copy fasta | chr1 | 33301766 | 33326098 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
acthapid | total | AFR | AMR | EAS | EUR | SAS | tlen | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A3GALT2 | 1/1 | a0001c0001t0000 | 394 | 80 | 62 | 187 | 15 | 48 | 1023 | copy fasta | chr1 | 33301766 | 33326098 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
actghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| A3GALT2 | 0/0 | a0001c0001t0000g0062 | 1 | 0 | 1 | 0 | 0 | 0 | chr1 | 33301766 | 33326098 |
Click to load Haplotype QTL data...
| pos | S. Strand |
E# Exon Number |
max | median | min | diff | type | haplotypeid | max_hap_list | min_hap_list | symbol | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 33312807 | - | 2 | -0.5509 | -0.5509 | -0.5509 | 0.0000 | acceptor | a0001c0001t0000g0062 | HG00639.hp2 | HG00639.hp2 | A3GALT2 | chr1 | 33301766 | 33326098 |
| 33312890 | - | 2 | 0.6522 | 0.6522 | 0.6522 | 0.0000 | donor | a0001c0001t0000g0062 | HG00639.hp2 | HG00639.hp2 | A3GALT2 | chr1 | 33301766 | 33326098 |
| 33312501 | - | 3 | -0.8328 | -0.8328 | -0.8328 | 0.0000 | acceptor | a0001c0001t0000g0062 | HG00639.hp2 | HG00639.hp2 | A3GALT2 | chr1 | 33301766 | 33326098 |
| 33312590 | - | 3 | 0.7751 | 0.7751 | 0.7751 | 0.0000 | donor | a0001c0001t0000g0062 | HG00639.hp2 | HG00639.hp2 | A3GALT2 | chr1 | 33301766 | 33326098 |
| 33312052 | - | 4 | -0.4774 | -0.4774 | -0.4774 | 0.0000 | acceptor | a0001c0001t0000g0062 | HG00639.hp2 | HG00639.hp2 | A3GALT2 | chr1 | 33301766 | 33326098 |
| 33312189 | - | 4 | 0.3174 | 0.3174 | 0.3174 | 0.0000 | donor | a0001c0001t0000g0062 | HG00639.hp2 | HG00639.hp2 | A3GALT2 | chr1 | 33301766 | 33326098 |
| 33307453 | - | 5 | 0.7962 | 0.7962 | 0.7962 | 0.0000 | donor | a0001c0001t0000g0062 | HG00639.hp2 | HG00639.hp2 | A3GALT2 | chr1 | 33301766 | 33326098 |
| pos | annotationhgvs_chgvs_p | clinvarid | clnsig | geneinfo | mc | clndisdb | strand strand
|
ahapid ahapid_count
|
chapid chapid count
|
thapid thapid_count
|
ghapid ghapid_count
|
AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
impact | chr | ref | alt | external |
|---|
| CHR:POS | annotationhgvs_chgvs_p | disease trait-log10podds or beta | AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
study | initial sample size/replication sample size | report genes | mapped gene | strongest snp risk allele | strand strand
|
impact | chr | ref | alt |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr1:33318545
|
c.23+2531A>G | Body mass index | a0001a0002a0003a0004a0005others(6): Show | a0001c0001a0001c0006a0001c0014a0001c0015a0002c0002others(9): Show | a0001c0001t0000a0001c0006t0000a0001c0014t0000a0001c0015t0000a0002c0002t0000others(9): Show | a0001c0001t0000g0001a0001c0001t0000g0002a0001c0001t0000g0004a0001c0001t0000g0005a0001c0001t0000g0006others(189): Show | HG00099.hp1 HG00099.hp2 HG00323.hp2 HG00408.hp1 HG00423.hp1 others(312): Show |
Leveraging Polygenic Functional Enrichment to Impr others(15): Show |
approximately 458,000 European ancestry individual others(2): Show |
A3GALT2 | rs6682438-? | - | MODIFIER | chr1 | T | C | |
|
chr1:33315380
|
c.24-2491delT | Smoking and associated risk behaviours (confirmatory factor analysis Factor 6)others(38): Show | a0001a0002a0003a0004a0005others(4): Show | a0001c0001a0001c0006a0001c0014a0002c0002a0003c0003others(6): Show | a0001c0001t0000a0001c0006t0000a0001c0014t0000a0002c0002t0000a0003c0003t0000others(6): Show | a0001c0001t0000g0001a0001c0001t0000g0002a0001c0001t0000g0004a0001c0001t0000g0005a0001c0001t0000g0006others(164): Show | HG00099.hp1 HG00099.hp2 HG00323.hp2 HG00408.hp1 HG00423.hp1 others(285): Show |
Principled distillation of UK Biobank phenotype da others(51): Show |
310,267 European ancestry individuals/ | A3GALT2 | rs750713403-? | - | MODIFIER | chr1 | CA | C | |
|
chr1:33311127
|
c.335+925G>A | Body mass index (MTAG)0.011928 | a0001a0002a0003a0004a0005others(6): Show | a0001c0001a0001c0006a0001c0014a0001c0015a0002c0002others(9): Show | a0001c0001t0000a0001c0006t0000a0001c0014t0000a0001c0015t0000a0002c0002t0000others(9): Show | a0001c0001t0000g0001a0001c0001t0000g0002a0001c0001t0000g0004a0001c0001t0000g0005a0001c0001t0000g0006others(189): Show | HG00099.hp1 HG00099.hp2 HG00323.hp2 HG00408.hp1 HG00423.hp1 others(312): Show |
Pleiotropic genetic architecture and novel loci fo others(28): Show |
694,649 European ancestry individuals/ | A3GALT2 | rs4653017-T | - | MODIFIER | chr1 | C | T | |
|
chr1:33322555
|
c.-1457T>A | Memory decline in impaired cognition x sex interactionothers(22): Show | a0001a0005a0006a0008a0011others(1): Show | a0001c0001a0001c0015a0005c0005a0006c0004a0008c0009others(2): Show | a0001c0001t0000a0001c0015t0000a0005c0005t0000a0006c0004t0000a0008c0009t0000others(2): Show | a0001c0001t0000g0001a0001c0001t0000g0004a0001c0001t0000g0005a0001c0001t0000g0006a0001c0001t0000g0011others(74): Show | HG00423.hp1 HG00438.hp1 HG00558.hp1 HG00597.hp1 HG00621.hp1 others(140): Show |
Sex-specific genetic architecture of late-life mem others(16): Show |
8,465 European ancestry individuals/ | A3GALT2 - PHC2 | rs12123240-? | - | MODIFIER | chr1 | A | T | |
|
chr1:33309151
|
c.336-1698T>G |
Eosinophil percentage of white cells0.01 others(7): Show |
a0001a0002a0003a0004a0005others(6): Show | a0001c0001a0001c0006a0001c0014a0001c0015a0002c0002others(9): Show | a0001c0001t0000a0001c0006t0000a0001c0014t0000a0001c0015t0000a0002c0002t0000others(9): Show | a0001c0001t0000g0001a0001c0001t0000g0002a0001c0001t0000g0004a0001c0001t0000g0005a0001c0001t0000g0006others(189): Show | HG00099.hp1 HG00099.hp2 HG00323.hp2 HG00408.hp1 HG00423.hp1 others(310): Show |
The Polygenic and Monogenic Basis of Blood Traits others(13): Show |
408,112 British individuals/ | A3GALT2, RP11-415J8.3 | A3GALT2 | rs10753280-C | - | MODIFIER | chr1 | A | C |
