| geneid | 344752 |
|---|---|
| ensemblid | ENSG00000197953.6 |
| hgncid | 24427 |
| symbol | AADACL2 |
| name | arylacetamide deacetylase like 2 |
| refseq_nuc | NM_207365.4 |
| refseq_prot | NP_997248.2 |
| ensembl_nuc | ENST00000356517.4 |
| ensembl_prot | ENSP00000348911.3 |
| mane_status | MANE Select |
| chr | chr3 |
| start | 151733927 |
| end | 151761339 |
| strand | + |
| ver | v1.2 |
| region | chr3:151733927-151761339 |
| region5000 | chr3:151728927-151766339 |
| regionname0 | AADACL2_chr3_151733927_151761339 |
| regionname5000 | AADACL2_chr3_151728927_151766339 |
| chr:pos | ref | alt | af | annotation | impact | samples | AHAPIDS | ACHAPIDS | ACTHAPIDS | ACTGHAPIDS | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr3:151745633
|
G | T | 0.6636 | missense_variant | MODERATE | HG00099.hp1 HG00099.hp2 HG00140.hp2 others(281): Show |
a0001a0003a0005others(3): Show | a0001c0001a0001c0005a0003c0003others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(52): Show | a0001c0001t0001g0001a0001c0001t0001g0015a0001c0001t0001g0018others(152): Show | 284 | 428 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 4/5 | c.556G>T | p.Ala186Ser | 665/5060 | 556/1206 | 186/401 |
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr3:151758516
|
A | ATATTTTC others(10): Show |
0.4977 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00280.hp2 others(210): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0005a0002c0002others(3): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0006others(26): Show | a0001c0001t0001g0001a0001c0001t0001g0015a0001c0001t0001g0018others(99): Show | 213 | 428 | 17 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 5/5 | c.*928_*929insCAGTCAAATTTTATTTT | 929 | INFO_REALIGN_3_PRIME | ||||
|
chr3:151758726
|
A | G | 0.2173 | 3_prime_UTR_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00323.hp2 others(90): Show |
a0001a0002 | a0001c0001a0001c0005a0002c0002 | a0001c0001t0003a0001c0001t0007a0001c0001t0008others(10): Show | a0001c0001t0003g0002a0001c0001t0003g0008a0001c0001t0003g0009others(44): Show | 93 | 428 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 5/5 | c.*1132A>G | 1132 | |||||
|
chr3:151760981
|
T | C | 0.6402 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp2 others(271): Show |
a0001a0002a0003others(4): Show | a0001c0001a0001c0005a0002c0002others(5): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0006others(50): Show | a0001c0001t0001g0001a0001c0001t0001g0015a0001c0001t0001g0018others(146): Show | 274 | 428 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 5/5 | c.*3387T>C | 3387 | |||||
|
chr3:151761146
|
T | G | 0.2150 | 3_prime_UTR_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00323.hp2 others(89): Show |
a0001a0002 | a0001c0001a0001c0005a0002c0002 | a0001c0001t0003a0001c0001t0007a0001c0001t0008others(9): Show | a0001c0001t0003g0002a0001c0001t0003g0008a0001c0001t0003g0009others(43): Show | 92 | 428 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 5/5 | c.*3552T>G | 3552 | |||||
|
chr3:151761149
|
ATATATAT others(17): Show |
A | 0.1682 | 3_prime_UTR_variant | MODIFIER | HG00099.hp2 HG00323.hp2 HG00423.hp2 others(69): Show |
a0001a0002 | a0001c0001a0001c0005a0002c0002 | a0001c0001t0003a0001c0001t0007a0001c0001t0009others(6): Show | a0001c0001t0003g0002a0001c0001t0003g0008a0001c0001t0003g0009others(31): Show | 72 | 428 | -24 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 5/5 | c.*3578_*3601delTTTATATATATGGTGAGATATATA | 3578 | INFO_REALIGN_3_PRIME | ||||
|
chr3:151761204
|
GATAT | G | 0.0374 | 3_prime_UTR_variant | MODIFIER | HG00099.hp2 HG00323.hp2 HG00639.hp1 others(13): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0009a0002c0002t0038 | a0001c0001t0009g0008a0001c0001t0009g0010a0001c0001t0009g0044others(3): Show | 16 | 428 | -4 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 5/5 | c.*3645_*3648delATAT | 3645 | INFO_REALIGN_3_PRIME |
| chr:pos | ref | alt | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | af | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr3:151736157
|
A | T | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp2 others(307): Show |
a0001a0002a0003others(5): Show | a0001c0001a0001c0005a0002c0002others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(68): Show | a0001c0001t0001g0001a0001c0001t0001g0015a0001c0001t0001g0018others(171): Show | 310 | 428 | 0.7243 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 1/4 | c.138+1984A>T | ||||||
|
chr3:151736302
|
CT | C | intron_variant | MODIFIER | HG00099.hp1 HG00280.hp2 HG00323.hp2 others(266): Show |
a0001a0002a0003others(5): Show | a0001c0001a0002c0002a0003c0003others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(58): Show | a0001c0001t0001g0001a0001c0001t0001g0015a0001c0001t0001g0018others(141): Show | 269 | 428 | 0.6285 | -1 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 1/4 | c.138+2144delT | INFO_REALIGN_3_PRIME | |||||
|
chr3:151736346
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00323.hp2 HG00423.hp1 others(124): Show |
a0001a0002a0003others(3): Show | a0001c0001a0002c0002a0003c0003others(3): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(29): Show | a0001c0001t0001g0001a0001c0001t0001g0018a0001c0001t0001g0023others(53): Show | 127 | 428 | 0.2967 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 1/4 | c.138+2173G>A | ||||||
|
chr3:151737358
|
T | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp2 others(308): Show |
a0001a0002a0003others(5): Show | a0001c0001a0001c0005a0002c0002others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(68): Show | a0001c0001t0001g0001a0001c0001t0001g0015a0001c0001t0001g0018others(172): Show | 311 | 428 | 0.7266 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 1/4 | c.138+3185T>G | ||||||
|
chr3:151737447
|
T | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp2 others(308): Show |
a0001a0002a0003others(5): Show | a0001c0001a0001c0005a0002c0002others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(68): Show | a0001c0001t0001g0001a0001c0001t0001g0015a0001c0001t0001g0018others(172): Show | 311 | 428 | 0.7266 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 1/4 | c.139-3199T>G | ||||||
|
chr3:151737955
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00323.hp2 HG00423.hp1 others(125): Show |
a0001a0002a0003others(3): Show | a0001c0001a0002c0002a0003c0003others(3): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(29): Show | a0001c0001t0001g0001a0001c0001t0001g0018a0001c0001t0001g0023others(54): Show | 128 | 428 | 0.2991 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 1/4 | c.139-2691T>C | ||||||
|
chr3:151738000
|
T | A | intron_variant | MODIFIER | HG00099.hp1 HG00280.hp2 HG00323.hp2 others(188): Show |
a0001a0002a0003others(4): Show | a0001c0001a0002c0002a0003c0003others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(40): Show | a0001c0001t0001g0001a0001c0001t0001g0018a0001c0001t0001g0023others(86): Show | 191 | 428 | 0.4463 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 1/4 | c.139-2646T>A | ||||||
|
chr3:151738406
|
G | T | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp2 others(308): Show |
a0001a0002a0003others(5): Show | a0001c0001a0001c0005a0002c0002others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(68): Show | a0001c0001t0001g0001a0001c0001t0001g0015a0001c0001t0001g0018others(172): Show | 311 | 428 | 0.7266 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 1/4 | c.139-2240G>T | ||||||
|
chr3:151738703
|
G | T | intron_variant | MODIFIER | HG00099.hp1 HG00280.hp2 HG00323.hp2 others(188): Show |
a0001a0002a0003others(4): Show | a0001c0001a0002c0002a0003c0003others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(40): Show | a0001c0001t0001g0001a0001c0001t0001g0018a0001c0001t0001g0023others(86): Show | 191 | 428 | 0.4463 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 1/4 | c.139-1943G>T | ||||||
|
chr3:151738729
|
C | T | intron_variant | MODIFIER | HG00099.hp1 HG00280.hp2 HG00323.hp2 others(188): Show |
a0001a0002a0003others(4): Show | a0001c0001a0002c0002a0003c0003others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(40): Show | a0001c0001t0001g0001a0001c0001t0001g0018a0001c0001t0001g0023others(86): Show | 191 | 428 | 0.4463 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 1/4 | c.139-1917C>T | ||||||
|
chr3:151739478
|
C | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp2 others(308): Show |
a0001a0002a0003others(5): Show | a0001c0001a0001c0005a0002c0002others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(68): Show | a0001c0001t0001g0001a0001c0001t0001g0015a0001c0001t0001g0018others(172): Show | 311 | 428 | 0.7266 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 1/4 | c.139-1168C>G | ||||||
|
chr3:151739972
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00280.hp2 HG00323.hp2 others(188): Show |
a0001a0002a0003others(4): Show | a0001c0001a0002c0002a0003c0003others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(40): Show | a0001c0001t0001g0001a0001c0001t0001g0018a0001c0001t0001g0023others(86): Show | 191 | 428 | 0.4463 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 1/4 | c.139-674A>G | ||||||
|
chr3:151740020
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00280.hp2 HG00323.hp2 others(187): Show |
a0001a0002a0003others(4): Show | a0001c0001a0002c0002a0003c0003others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(40): Show | a0001c0001t0001g0001a0001c0001t0001g0018a0001c0001t0001g0023others(85): Show | 190 | 428 | 0.4439 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 1/4 | c.139-626G>A | ||||||
|
chr3:151740134
|
C | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp2 others(308): Show |
a0001a0002a0003others(5): Show | a0001c0001a0001c0005a0002c0002others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(68): Show | a0001c0001t0001g0001a0001c0001t0001g0015a0001c0001t0001g0018others(172): Show | 311 | 428 | 0.7266 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 1/4 | c.139-512C>G | ||||||
|
chr3:151740302
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp2 others(309): Show |
a0001a0002a0003others(5): Show | a0001c0001a0001c0005a0002c0002others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(69): Show | a0001c0001t0001g0001a0001c0001t0001g0015a0001c0001t0001g0018others(173): Show | 312 | 428 | 0.7290 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 1/4 | c.139-344T>C | ||||||
|
chr3:151740305
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00280.hp2 HG00323.hp2 others(188): Show |
a0001a0002a0003others(4): Show | a0001c0001a0002c0002a0003c0003others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(40): Show | a0001c0001t0001g0001a0001c0001t0001g0018a0001c0001t0001g0023others(86): Show | 191 | 428 | 0.4463 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 1/4 | c.139-341G>A | ||||||
|
chr3:151741051
|
C | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp2 others(309): Show |
a0001a0002a0003others(5): Show | a0001c0001a0001c0005a0002c0002others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(69): Show | a0001c0001t0001g0001a0001c0001t0001g0015a0001c0001t0001g0018others(173): Show | 312 | 428 | 0.7290 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 2/4 | c.361+183C>A | ||||||
|
chr3:151741579
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00280.hp2 HG00323.hp2 others(187): Show |
a0001a0002a0003others(4): Show | a0001c0001a0002c0002a0003c0003others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(40): Show | a0001c0001t0001g0001a0001c0001t0001g0018a0001c0001t0001g0023others(85): Show | 190 | 428 | 0.4439 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 2/4 | c.361+711G>A | ||||||
|
chr3:151741621
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp2 others(309): Show |
a0001a0002a0003others(5): Show | a0001c0001a0001c0005a0002c0002others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(69): Show | a0001c0001t0001g0001a0001c0001t0001g0015a0001c0001t0001g0018others(173): Show | 312 | 428 | 0.7290 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 2/4 | c.361+753T>C | ||||||
|
chr3:151741719
|
C | T | intron_variant | MODIFIER | HG00099.hp1 HG00280.hp2 HG00323.hp2 others(188): Show |
a0001a0002a0003others(4): Show | a0001c0001a0002c0002a0003c0003others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(41): Show | a0001c0001t0001g0001a0001c0001t0001g0018a0001c0001t0001g0023others(86): Show | 191 | 428 | 0.4463 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 2/4 | c.361+851C>T | ||||||
|
chr3:151742198
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00280.hp2 HG00323.hp2 others(188): Show |
a0001a0002a0003others(4): Show | a0001c0001a0002c0002a0003c0003others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(41): Show | a0001c0001t0001g0001a0001c0001t0001g0018a0001c0001t0001g0023others(86): Show | 191 | 428 | 0.4463 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 2/4 | c.361+1330A>G | ||||||
|
chr3:151742275
|
GT | G | intron_variant | MODIFIER | HG00099.hp1 HG00280.hp2 HG00323.hp2 others(188): Show |
a0001a0002a0003others(4): Show | a0001c0001a0002c0002a0003c0003others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(41): Show | a0001c0001t0001g0001a0001c0001t0001g0018a0001c0001t0001g0023others(86): Show | 191 | 428 | 0.4463 | -1 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 2/4 | c.361+1412delT | INFO_REALIGN_3_PRIME | |||||
|
chr3:151742314
|
C | T | intron_variant | MODIFIER | HG00099.hp1 HG00280.hp2 HG00323.hp2 others(188): Show |
a0001a0002a0003others(4): Show | a0001c0001a0002c0002a0003c0003others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(41): Show | a0001c0001t0001g0001a0001c0001t0001g0018a0001c0001t0001g0023others(86): Show | 191 | 428 | 0.4463 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 2/4 | c.361+1446C>T | ||||||
|
chr3:151742518
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00280.hp2 HG00323.hp2 others(189): Show |
a0001a0002a0003others(4): Show | a0001c0001a0002c0002a0003c0003others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(41): Show | a0001c0001t0001g0001a0001c0001t0001g0018a0001c0001t0001g0023others(87): Show | 192 | 428 | 0.4486 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 2/4 | c.362-1575A>G | ||||||
|
chr3:151742582
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00280.hp2 HG00323.hp2 others(189): Show |
a0001a0002a0003others(4): Show | a0001c0001a0002c0002a0003c0003others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(41): Show | a0001c0001t0001g0001a0001c0001t0001g0018a0001c0001t0001g0023others(87): Show | 192 | 428 | 0.4486 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 2/4 | c.362-1511T>C | ||||||
|
chr3:151742584
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00280.hp2 HG00323.hp2 others(189): Show |
a0001a0002a0003others(4): Show | a0001c0001a0002c0002a0003c0003others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(41): Show | a0001c0001t0001g0001a0001c0001t0001g0018a0001c0001t0001g0023others(87): Show | 192 | 428 | 0.4486 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 2/4 | c.362-1509T>C | ||||||
|
chr3:151742602
|
A | T | intron_variant | MODIFIER | HG00099.hp1 HG00280.hp2 HG00323.hp2 others(189): Show |
a0001a0002a0003others(4): Show | a0001c0001a0002c0002a0003c0003others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(41): Show | a0001c0001t0001g0001a0001c0001t0001g0018a0001c0001t0001g0023others(87): Show | 192 | 428 | 0.4486 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 2/4 | c.362-1491A>T | ||||||
|
chr3:151743470
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp2 others(305): Show |
a0001a0002a0003others(5): Show | a0001c0001a0001c0005a0002c0002others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(69): Show | a0001c0001t0001g0001a0001c0001t0001g0018a0001c0001t0001g0023others(172): Show | 308 | 428 | 0.7196 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 2/4 | c.362-623A>G | ||||||
|
chr3:151743597
|
G | T | intron_variant | MODIFIER | HG00099.hp1 HG00280.hp2 HG00323.hp2 others(188): Show |
a0001a0002a0003others(4): Show | a0001c0001a0002c0002a0003c0003others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(41): Show | a0001c0001t0001g0001a0001c0001t0001g0018a0001c0001t0001g0023others(86): Show | 191 | 428 | 0.4463 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 2/4 | c.362-496G>T | ||||||
|
chr3:151744877
|
T | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp2 others(303): Show |
a0001a0002a0003others(4): Show | a0001c0001a0001c0005a0002c0002others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(67): Show | a0001c0001t0001g0001a0001c0001t0001g0015a0001c0001t0001g0018others(166): Show | 306 | 428 | 0.7150 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 3/4 | c.432-632T>G | ||||||
|
chr3:151745157
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp2 others(305): Show |
a0001a0002a0003others(4): Show | a0001c0001a0001c0005a0002c0002others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(67): Show | a0001c0001t0001g0001a0001c0001t0001g0015a0001c0001t0001g0018others(168): Show | 308 | 428 | 0.7196 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 3/4 | c.432-352A>G | ||||||
|
chr3:151746185
|
G | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp2 others(269): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0005a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(47): Show | a0001c0001t0001g0001a0001c0001t0001g0015a0001c0001t0001g0018others(141): Show | 272 | 428 | 0.6355 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 4/4 | c.603+505G>C | ||||||
|
chr3:151746288
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00323.hp2 HG00423.hp1 others(110): Show |
a0001a0002a0003others(2): Show | a0001c0001a0002c0002a0003c0003others(2): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0007others(11): Show | a0001c0001t0001g0001a0001c0001t0001g0015a0001c0001t0001g0018others(42): Show | 113 | 428 | 0.2640 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 4/4 | c.603+608A>G | ||||||
|
chr3:151746365
|
G | GT | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00280.hp2 others(163): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0005a0002c0002others(3): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0006others(18): Show | a0001c0001t0001g0001a0001c0001t0001g0015a0001c0001t0001g0018others(69): Show | 166 | 428 | 0.3879 | 1 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 4/4 | c.603+699dupT | INFO_REALIGN_3_PRIME | |||||
|
chr3:151746905
|
G | GT | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00280.hp2 others(164): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0005a0002c0002others(3): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0006others(19): Show | a0001c0001t0001g0001a0001c0001t0001g0015a0001c0001t0001g0018others(68): Show | 167 | 428 | 0.3902 | 1 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 4/4 | c.603+1237dupT | INFO_REALIGN_3_PRIME | |||||
|
chr3:151747312
|
G | A | intron_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00323.hp2 others(73): Show |
a0001a0002 | a0001c0001a0001c0005a0002c0002 | a0001c0001t0003a0001c0001t0006a0001c0001t0007others(10): Show | a0001c0001t0003g0002a0001c0001t0003g0008a0001c0001t0003g0010others(35): Show | 76 | 428 | 0.1776 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 4/4 | c.603+1632G>A | ||||||
|
chr3:151747765
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp2 others(275): Show |
a0001a0002a0003others(4): Show | a0001c0001a0001c0005a0002c0002others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(53): Show | a0001c0001t0001g0001a0001c0001t0001g0015a0001c0001t0001g0018others(149): Show | 278 | 428 | 0.6495 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 4/4 | c.603+2085A>G | ||||||
|
chr3:151749275
|
T | TTA | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp2 others(222): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0005a0002c0002others(3): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0006others(31): Show | a0001c0001t0001g0001a0001c0001t0001g0015a0001c0001t0001g0018others(108): Show | 225 | 428 | 0.5257 | 2 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 4/4 | c.603+3596_603+3597insAT | INFO_REALIGN_3_PRIME | |||||
|
chr3:151749454
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00280.hp2 others(210): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0005a0002c0002others(3): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0006others(26): Show | a0001c0001t0001g0001a0001c0001t0001g0015a0001c0001t0001g0018others(99): Show | 213 | 428 | 0.4977 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 4/4 | c.603+3774G>A | ||||||
|
chr3:151749486
|
T | C | intron_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00323.hp2 others(90): Show |
a0001a0002 | a0001c0001a0001c0005a0002c0002 | a0001c0001t0003a0001c0001t0007a0001c0001t0008others(10): Show | a0001c0001t0003g0002a0001c0001t0003g0008a0001c0001t0003g0009others(44): Show | 93 | 428 | 0.2173 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 4/4 | c.603+3806T>C | ||||||
|
chr3:151749495
|
G | T | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(390): Show |
a0001a0002a0003others(5): Show | a0001c0001a0001c0005a0002c0002others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(79): Show | a0001c0001t0001g0001a0001c0001t0001g0015a0001c0001t0001g0018others(216): Show | 393 | 428 | 0.9182 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 4/4 | c.603+3815G>T | ||||||
|
chr3:151749563
|
C | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00280.hp2 others(210): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0005a0002c0002others(3): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0006others(26): Show | a0001c0001t0001g0001a0001c0001t0001g0015a0001c0001t0001g0018others(99): Show | 213 | 428 | 0.4977 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 4/4 | c.603+3883C>A | ||||||
|
chr3:151749568
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00280.hp2 others(210): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0005a0002c0002others(3): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0006others(26): Show | a0001c0001t0001g0001a0001c0001t0001g0015a0001c0001t0001g0018others(99): Show | 213 | 428 | 0.4977 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 4/4 | c.603+3888T>C | ||||||
|
chr3:151749975
|
T | A | intron_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00323.hp2 others(90): Show |
a0001a0002 | a0001c0001a0001c0005a0002c0002 | a0001c0001t0003a0001c0001t0007a0001c0001t0008others(10): Show | a0001c0001t0003g0002a0001c0001t0003g0008a0001c0001t0003g0009others(44): Show | 93 | 428 | 0.2173 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 4/4 | c.603+4295T>A | ||||||
|
chr3:151751662
|
G | A | intron_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00323.hp2 others(110): Show |
a0001a0002 | a0001c0001a0001c0005a0002c0002 | a0001c0001t0003a0001c0001t0006a0001c0001t0007others(15): Show | a0001c0001t0003g0002a0001c0001t0003g0008a0001c0001t0003g0009others(59): Show | 113 | 428 | 0.2640 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 4/4 | c.604-5330G>A | ||||||
|
chr3:151751987
|
C | T | intron_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00323.hp2 others(110): Show |
a0001a0002 | a0001c0001a0001c0005a0002c0002 | a0001c0001t0003a0001c0001t0006a0001c0001t0007others(15): Show | a0001c0001t0003g0002a0001c0001t0003g0008a0001c0001t0003g0009others(59): Show | 113 | 428 | 0.2640 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 4/4 | c.604-5005C>T | ||||||
|
chr3:151752129
|
A | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp2 others(273): Show |
a0001a0002a0003others(4): Show | a0001c0001a0001c0005a0002c0002others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(51): Show | a0001c0001t0001g0001a0001c0001t0001g0015a0001c0001t0001g0018others(147): Show | 276 | 428 | 0.6449 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 4/4 | c.604-4863A>C | ||||||
|
chr3:151752437
|
C | G | intron_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00323.hp2 others(110): Show |
a0001a0002 | a0001c0001a0001c0005a0002c0002 | a0001c0001t0003a0001c0001t0006a0001c0001t0007others(15): Show | a0001c0001t0003g0002a0001c0001t0003g0008a0001c0001t0003g0009others(59): Show | 113 | 428 | 0.2640 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 4/4 | c.604-4555C>G | ||||||
|
chr3:151753174
|
T | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00280.hp2 others(209): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0005a0002c0002others(3): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0006others(25): Show | a0001c0001t0001g0001a0001c0001t0001g0015a0001c0001t0001g0018others(98): Show | 212 | 428 | 0.4953 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 4/4 | c.604-3818T>A | ||||||
|
chr3:151753349
|
T | G | intron_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00323.hp2 others(111): Show |
a0001a0002 | a0001c0001a0001c0005a0002c0002 | a0001c0001t0003a0001c0001t0006a0001c0001t0007others(16): Show | a0001c0001t0003g0002a0001c0001t0003g0008a0001c0001t0003g0009others(60): Show | 114 | 428 | 0.2664 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 4/4 | c.604-3643T>G | ||||||
|
chr3:151753550
|
T | A | intron_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00323.hp2 others(111): Show |
a0001a0002 | a0001c0001a0001c0005a0002c0002 | a0001c0001t0003a0001c0001t0006a0001c0001t0007others(16): Show | a0001c0001t0003g0002a0001c0001t0003g0008a0001c0001t0003g0009others(60): Show | 114 | 428 | 0.2664 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 4/4 | c.604-3442T>A | ||||||
|
chr3:151754031
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp2 others(229): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0005a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0006others(35): Show | a0001c0001t0001g0001a0001c0001t0001g0015a0001c0001t0001g0018others(115): Show | 232 | 428 | 0.5421 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 4/4 | c.604-2961T>C | ||||||
|
chr3:151754599
|
G | C | intron_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00323.hp2 others(111): Show |
a0001a0002 | a0001c0001a0001c0005a0002c0002 | a0001c0001t0003a0001c0001t0006a0001c0001t0007others(16): Show | a0001c0001t0003g0002a0001c0001t0003g0008a0001c0001t0003g0009others(60): Show | 114 | 428 | 0.2664 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 4/4 | c.604-2393G>C | ||||||
|
chr3:151754904
|
T | C | intron_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00323.hp2 others(111): Show |
a0001a0002 | a0001c0001a0001c0005a0002c0002 | a0001c0001t0003a0001c0001t0006a0001c0001t0007others(16): Show | a0001c0001t0003g0002a0001c0001t0003g0008a0001c0001t0003g0009others(60): Show | 114 | 428 | 0.2664 | 0 | AADACL2 | ENSG00000197953.6 | transcript | ENST00000356517.4 | protein_coding | 4/4 | c.604-2088T>C |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
ahapid | alen | total | AFR | AMR | EAS | EUR | SAS | aseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AADACL2 | 0/1 | a0001 | 401 | 277 | 68 | 53 | 115 | 12 | 28 | subcellular location copy fasta | chr3 | 151728927 | 151766339 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
chapid | clen | total | AFR | AMR | EAS | EUR | SAS | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AADACL2 | 0/1 | c0001 | 1206 | 275 | 68 | 53 | 115 | 12 | 26 | copy fasta | chr3 | 151728927 | 151766339 |
| genename | grch38/chm13v2 | thapid | tlen | total | AFR | AMR | EAS | EUR | SAS | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AADACL2 | 0/0 | t0009 | 3844 | 14 | 0 | 8 | 1 | 4 | 1 | copy fasta | chr3 | 151728927 | 151766339 |
| genename | grch38/chm13v2 | ghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| AADACL2 | 0/0 | g0008 | 10 | 0 | 6 | 1 | 3 | 0 | chr3 | 151728927 | 151766339 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
achapid | total | AFR | AMR | EAS | EUR | SAS | clen | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AADACL2 | 0/1 | a0001c0001 | 275 | 68 | 53 | 115 | 12 | 26 | 1206 | copy fasta | chr3 | 151728927 | 151766339 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
acthapid | total | AFR | AMR | EAS | EUR | SAS | tlen | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AADACL2 | 0/0 | a0001c0001t0009 | 14 | 0 | 8 | 1 | 4 | 1 | 5049 | copy fasta | chr3 | 151728927 | 151766339 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
actghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| AADACL2 | 0/0 | a0001c0001t0009g0008 | 8 | 0 | 5 | 0 | 3 | 0 | chr3 | 151728927 | 151766339 |
Click to load Haplotype QTL data...
| pos | S. Strand |
E# Exon Number |
max | median | min | diff | type | haplotypeid | max_hap_list | min_hap_list | symbol | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 151734173 | + | 1 | -0.8002 | -0.8002 | -0.8002 | 0.0000 | acceptor | a0001c0001t0009g0008 | HG00323.hp2 HG00639.hp1 HG00642.hp1 HG01192.hp1 HG01358.hp2 others(3): Show |
HG00323.hp2 HG00639.hp1 HG00642.hp1 HG01192.hp1 HG01358.hp2 others(3): Show |
AADACL2 | chr3 | 151728927 | 151766339 |
| 151740646 | + | 2 | 0.9868 | 0.9868 | 0.9868 | 0.0000 | donor | a0001c0001t0009g0008 | HG00323.hp2 HG00639.hp1 HG00642.hp1 HG01192.hp1 HG01358.hp2 others(3): Show |
HG00323.hp2 HG00639.hp1 HG00642.hp1 HG01192.hp1 HG01358.hp2 others(3): Show |
AADACL2 | chr3 | 151728927 | 151766339 |
| 151740868 | + | 2 | -0.8189 | -0.8189 | -0.8189 | 0.0000 | acceptor | a0001c0001t0009g0008 | HG00323.hp2 HG00639.hp1 HG00642.hp1 HG01192.hp1 HG01358.hp2 others(3): Show |
HG00323.hp2 HG00639.hp1 HG00642.hp1 HG01192.hp1 HG01358.hp2 others(3): Show |
AADACL2 | chr3 | 151728927 | 151766339 |
| 151744093 | + | 3 | 0.4875 | 0.4875 | 0.4875 | 0.0000 | donor | a0001c0001t0009g0008 | HG00323.hp2 HG00639.hp1 HG00642.hp1 HG01192.hp1 HG01358.hp2 others(3): Show |
HG00323.hp2 HG00639.hp1 HG00642.hp1 HG01192.hp1 HG01358.hp2 others(3): Show |
AADACL2 | chr3 | 151728927 | 151766339 |
| 151744162 | + | 3 | -0.6160 | -0.6160 | -0.6160 | 0.0000 | acceptor | a0001c0001t0009g0008 | HG00323.hp2 HG00639.hp1 HG00642.hp1 HG01192.hp1 HG01358.hp2 others(3): Show |
HG00323.hp2 HG00639.hp1 HG00642.hp1 HG01192.hp1 HG01358.hp2 others(3): Show |
AADACL2 | chr3 | 151728927 | 151766339 |
| 151745509 | + | 4 | 0.8638 | 0.8638 | 0.8638 | 0.0000 | donor | a0001c0001t0009g0008 | HG00323.hp2 HG00639.hp1 HG00642.hp1 HG01192.hp1 HG01358.hp2 others(3): Show |
HG00323.hp2 HG00639.hp1 HG00642.hp1 HG01192.hp1 HG01358.hp2 others(3): Show |
AADACL2 | chr3 | 151728927 | 151766339 |
| 151745680 | + | 4 | -0.8553 | -0.8553 | -0.8553 | 0.0000 | acceptor | a0001c0001t0009g0008 | HG00323.hp2 HG00639.hp1 HG00642.hp1 HG01192.hp1 HG01358.hp2 others(3): Show |
HG00323.hp2 HG00639.hp1 HG00642.hp1 HG01192.hp1 HG01358.hp2 others(3): Show |
AADACL2 | chr3 | 151728927 | 151766339 |
| 151756992 | + | 5 | 0.2704 | 0.2704 | 0.2704 | 0.0000 | donor | a0001c0001t0009g0008 | HG00323.hp2 HG00639.hp1 HG00642.hp1 HG01192.hp1 HG01358.hp2 others(3): Show |
HG00323.hp2 HG00639.hp1 HG00642.hp1 HG01192.hp1 HG01358.hp2 others(3): Show |
AADACL2 | chr3 | 151728927 | 151766339 |
| pos | annotationhgvs_chgvs_p | clinvarid | clnsig | geneinfo | mc | clndisdb | strand strand
|
ahapid ahapid_count
|
chapid chapid count
|
thapid thapid_count
|
ghapid ghapid_count
|
AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
impact | chr | ref | alt | external |
|---|
| CHR:POS | annotationhgvs_chgvs_p | disease trait-log10podds or beta | AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
study | initial sample size/replication sample size | report genes | mapped gene | strongest snp risk allele | strand strand
|
impact | chr | ref | alt |
|---|