| geneid | 26574 |
|---|---|
| ensemblid | ENSG00000275700.6 |
| hgncid | 19235 |
| symbol | AATF |
| name | apoptosis antagonizing transcription factor |
| refseq_nuc | NM_012138.4 |
| refseq_prot | NP_036270.1 |
| ensembl_nuc | ENST00000619387.5 |
| ensembl_prot | ENSP00000477848.1 |
| mane_status | MANE Select |
| chr | chr17 |
| start | 36948954 |
| end | 37056871 |
| strand | + |
| ver | v1.2 |
| region | chr17:36948954-37056871 |
| region5000 | chr17:36943954-37061871 |
| regionname0 | AATF_chr17_36948954_37056871 |
| regionname5000 | AATF_chr17_36943954_37061871 |
| chr:pos | ref | alt | af | annotation | impact | samples | AHAPIDS | ACHAPIDS | ACTHAPIDS | ACTGHAPIDS | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr17:36989342
|
T | C | 0.1265 | synonymous_variant | LOW | HG00140.hp2 HG00280.hp1 HG00621.hp1 others(28): Show |
a0001 | a0001c0002 | a0001c0002t0001a0001c0002t0002a0001c0002t0005others(1): Show | a0001c0002t0001g0124a0001c0002t0001g0125a0001c0002t0002g0109others(28): Show | 31 | 245 | 0 | AATF | ENSG00000275700.6 | transcript | ENST00000619387.5 | protein_coding | 7/12 | c.1245T>C | p.Ser415Ser | 1417/2062 | 1245/1683 | 415/560 |
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr17:36949012
|
G | C | 0.2531 | 5_prime_UTR_variant | MODIFIER | HG00140.hp2 HG00280.hp1 HG00280.hp2 others(59): Show |
a0001 | a0001c0001a0001c0002 | a0001c0001t0002a0001c0002t0002a0001c0002t0005 | a0001c0001t0002g0001a0001c0001t0002g0002a0001c0001t0002g0003others(58): Show | 62 | 245 | 0 | AATF | ENSG00000275700.6 | transcript | ENST00000619387.5 | protein_coding | 1/12 | c.-114G>C | 114 |
| chr:pos | ref | alt | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | af | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr17:36952214
|
C | G | intron_variant | MODIFIER | HG01109.hp2 | a0001 | a0001c0002 | a0001c0002t0002 | a0001c0002t0002g0235 | 1 | 245 | 0.0041 | 0 | AATF | ENSG00000275700.6 | transcript | ENST00000619387.5 | protein_coding | 2/11 | c.284-672C>G | ||||||
|
chr17:36954402
|
T | C | intron_variant | MODIFIER | HG01109.hp2 | a0001 | a0001c0002 | a0001c0002t0002 | a0001c0002t0002g0235 | 1 | 245 | 0.0041 | 0 | AATF | ENSG00000275700.6 | transcript | ENST00000619387.5 | protein_coding | 4/11 | c.832+495T>C | ||||||
|
chr17:36955202
|
T | A | intron_variant | MODIFIER | HG01109.hp2 | a0001 | a0001c0002 | a0001c0002t0002 | a0001c0002t0002g0235 | 1 | 245 | 0.0041 | 0 | AATF | ENSG00000275700.6 | transcript | ENST00000619387.5 | protein_coding | 4/11 | c.832+1295T>A | ||||||
|
chr17:36959273
|
G | A | intron_variant | MODIFIER | HG00140.hp2 HG00280.hp1 HG00408.hp1 others(57): Show |
a0001 | a0001c0001a0001c0002 | a0001c0001t0001a0001c0001t0002a0001c0002t0001others(3): Show | a0001c0001t0001g0147a0001c0001t0001g0242a0001c0001t0002g0001others(56): Show | 60 | 245 | 0.2449 | 0 | AATF | ENSG00000275700.6 | transcript | ENST00000619387.5 | protein_coding | 4/11 | c.832+5366G>A | ||||||
|
chr17:36960099
|
T | C | intron_variant | MODIFIER | HG00099.hp2 HG00140.hp2 HG00280.hp1 others(160): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0002a0001c0003others(7): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(16): Show | a0001c0001t0001g0014a0001c0001t0001g0015a0001c0001t0001g0017others(159): Show | 163 | 245 | 0.6653 | 0 | AATF | ENSG00000275700.6 | transcript | ENST00000619387.5 | protein_coding | 4/11 | c.832+6192T>C | ||||||
|
chr17:36961440
|
T | C | intron_variant | MODIFIER | HG00140.hp2 HG00280.hp1 HG00408.hp1 others(56): Show |
a0001 | a0001c0001a0001c0002 | a0001c0001t0001a0001c0001t0002a0001c0002t0002others(2): Show | a0001c0001t0001g0147a0001c0001t0002g0001a0001c0001t0002g0002others(55): Show | 59 | 245 | 0.2408 | 0 | AATF | ENSG00000275700.6 | transcript | ENST00000619387.5 | protein_coding | 4/11 | c.832+7533T>C | ||||||
|
chr17:36968270
|
CT | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(95): Show |
a0001a0004 | a0001c0001a0001c0002a0004c0010 | a0001c0001t0001a0001c0001t0002a0001c0001t0007others(6): Show | a0001c0001t0001g0021a0001c0001t0001g0032a0001c0001t0001g0049others(95): Show | 98 | 245 | 0.4000 | -1 | AATF | ENSG00000275700.6 | transcript | ENST00000619387.5 | protein_coding | 4/11 | c.832+14393delT | INFO_REALIGN_3_PRIME | |||||
|
chr17:36973537
|
A | G | intron_variant | MODIFIER | HG00140.hp2 HG00280.hp1 HG00621.hp1 others(26): Show |
a0001 | a0001c0002 | a0001c0002t0002a0001c0002t0005a0001c0002t0009 | a0001c0002t0002g0109a0001c0002t0002g0127a0001c0002t0002g0128others(26): Show | 29 | 245 | 0.1184 | 0 | AATF | ENSG00000275700.6 | transcript | ENST00000619387.5 | protein_coding | 4/11 | c.833-13080A>G | ||||||
|
chr17:36979795
|
A | T | intron_variant | MODIFIER | HG01109.hp2 | a0001 | a0001c0002 | a0001c0002t0002 | a0001c0002t0002g0235 | 1 | 245 | 0.0041 | 0 | AATF | ENSG00000275700.6 | transcript | ENST00000619387.5 | protein_coding | 4/11 | c.833-6822A>T | ||||||
|
chr17:36982233
|
G | GT | intron_variant | MODIFIER | HG01109.hp2 HG02486.hp2 HG02647.hp1 others(6): Show |
a0001a0003 | a0001c0001a0001c0002a0001c0003others(1): Show | a0001c0001t0001a0001c0002t0002a0001c0003t0004others(1): Show | a0001c0001t0001g0160a0001c0001t0001g0163a0001c0001t0001g0218others(6): Show | 9 | 245 | 0.0367 | 1 | AATF | ENSG00000275700.6 | transcript | ENST00000619387.5 | protein_coding | 4/11 | c.833-4368dupT | INFO_REALIGN_3_PRIME | |||||
|
chr17:36987153
|
AT | A | intron_variant | MODIFIER | HG00140.hp2 HG00280.hp1 HG00408.hp1 others(116): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0002a0001c0003others(7): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(13): Show | a0001c0001t0001g0014a0001c0001t0001g0017a0001c0001t0001g0021others(115): Show | 119 | 245 | 0.4857 | -1 | AATF | ENSG00000275700.6 | transcript | ENST00000619387.5 | protein_coding | 5/11 | c.947+440delT | INFO_REALIGN_3_PRIME | |||||
|
chr17:36987225
|
G | A | intron_variant | MODIFIER | HG00140.hp2 HG00280.hp1 HG00621.hp1 others(35): Show |
a0001a0002a0005 | a0001c0001a0001c0002a0001c0003others(2): Show | a0001c0001t0001a0001c0002t0001a0001c0002t0002others(5): Show | a0001c0001t0001g0096a0001c0002t0001g0124a0001c0002t0001g0125others(35): Show | 38 | 245 | 0.1551 | 0 | AATF | ENSG00000275700.6 | transcript | ENST00000619387.5 | protein_coding | 5/11 | c.947+494G>A | ||||||
|
chr17:37001405
|
G | GAGGGAGG others(1): Show |
intron_variant | MODIFIER | HG00099.hp2 HG00735.hp1 HG01106.hp1 others(8): Show |
a0001 | a0001c0001a0001c0002 | a0001c0001t0001a0001c0002t0002 | a0001c0001t0001g0020a0001c0001t0001g0086a0001c0001t0001g0159others(8): Show | 11 | 245 | 0.0449 | 8 | AATF | ENSG00000275700.6 | transcript | ENST00000619387.5 | protein_coding | 8/11 | c.1398+10551_1398+10552insGAGGAAGG | INFO_REALIGN_3_PRIME | |||||
|
chr17:37003471
|
C | CT | intron_variant | MODIFIER | HG00621.hp2 HG01106.hp1 HG01109.hp1 others(54): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(10): Show | a0001c0001t0001g0015a0001c0001t0001g0017a0001c0001t0001g0021others(54): Show | 57 | 245 | 0.2327 | 1 | AATF | ENSG00000275700.6 | transcript | ENST00000619387.5 | protein_coding | 8/11 | c.1398+12639dupT | INFO_REALIGN_3_PRIME | |||||
|
chr17:37009298
|
A | AT | intron_variant | MODIFIER | HG01109.hp1 HG01109.hp2 HG01243.hp2 others(38): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(5): Show | a0001c0001t0001a0001c0001t0003a0001c0002t0002others(7): Show | a0001c0001t0001g0015a0001c0001t0001g0019a0001c0001t0001g0033others(38): Show | 41 | 245 | 0.1674 | 1 | AATF | ENSG00000275700.6 | transcript | ENST00000619387.5 | protein_coding | 8/11 | c.1399-9689dupT | INFO_REALIGN_3_PRIME | |||||
|
chr17:37009739
|
T | C | intron_variant | MODIFIER | HG00099.hp2 HG00140.hp2 HG00280.hp1 others(196): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0002a0001c0003others(7): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(17): Show | a0001c0001t0001g0014a0001c0001t0001g0015a0001c0001t0001g0017others(195): Show | 199 | 245 | 0.8122 | 0 | AATF | ENSG00000275700.6 | transcript | ENST00000619387.5 | protein_coding | 8/11 | c.1399-9266T>C | ||||||
|
chr17:37009823
|
C | CA | intron_variant | MODIFIER | HG00544.hp1 HG00621.hp1 HG00621.hp2 others(48): Show |
a0001a0002 | a0001c0001a0001c0002a0001c0003others(1): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0006others(4): Show | a0001c0001t0001g0023a0001c0001t0001g0038a0001c0001t0001g0040others(48): Show | 51 | 245 | 0.2082 | 1 | AATF | ENSG00000275700.6 | transcript | ENST00000619387.5 | protein_coding | 8/11 | c.1399-9155dupA | INFO_REALIGN_3_PRIME | |||||
|
chr17:37012074
|
T | A | intron_variant | MODIFIER | HG01109.hp2 | a0001 | a0001c0002 | a0001c0002t0002 | a0001c0002t0002g0235 | 1 | 245 | 0.0041 | 0 | AATF | ENSG00000275700.6 | transcript | ENST00000619387.5 | protein_coding | 8/11 | c.1399-6931T>A | ||||||
|
chr17:37021822
|
T | A | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(82): Show |
a0001a0006 | a0001c0001a0001c0002a0006c0006 | a0001c0001t0001a0001c0001t0002a0001c0001t0008others(5): Show | a0001c0001t0001g0017a0001c0001t0001g0021a0001c0001t0001g0022others(82): Show | 85 | 245 | 0.3469 | 0 | AATF | ENSG00000275700.6 | transcript | ENST00000619387.5 | protein_coding | 10/11 | c.1547+808T>A | ||||||
|
chr17:37022113
|
CGT | C | intron_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00408.hp2 others(90): Show |
a0001 | a0001c0001a0001c0002 | a0001c0001t0001a0001c0001t0002a0001c0002t0001others(3): Show | a0001c0001t0001g0020a0001c0001t0001g0021a0001c0001t0001g0049others(90): Show | 93 | 245 | 0.3796 | -2 | AATF | ENSG00000275700.6 | transcript | ENST00000619387.5 | protein_coding | 10/11 | c.1547+1137_1547+1138delTG | INFO_REALIGN_3_PRIME | |||||
|
chr17:37023490
|
T | TATTCTTT others(53): Show |
intron_variant | MODIFIER | HG01074.hp1 HG01109.hp2 HG01257.hp2 others(24): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004others(9): Show | a0001c0001t0001g0019a0001c0001t0001g0021a0001c0001t0001g0049others(24): Show | 27 | 245 | 0.1102 | 60 | AATF | ENSG00000275700.6 | transcript | ENST00000619387.5 | protein_coding | 10/11 | c.1547+2616_1547+2675dupTAAAAAGAGGCATTCTTTTTAAACAGAGTTTAAAAAGAGGCATTCTTTTTAAACAGAGTT | INFO_REALIGN_3_PRIME | |||||
|
chr17:37027891
|
C | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(242): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0002a0001c0003others(7): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(17): Show | a0001c0001t0001g0014a0001c0001t0001g0015a0001c0001t0001g0017others(241): Show | 245 | 245 | 1.0000 | 0 | AATF | ENSG00000275700.6 | transcript | ENST00000619387.5 | protein_coding | 10/11 | c.1548-3723C>G | ||||||
|
chr17:37040471
|
T | TA | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(241): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0002a0001c0003others(7): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(17): Show | a0001c0001t0001g0014a0001c0001t0001g0015a0001c0001t0001g0017others(240): Show | 244 | 245 | 0.9959 | 1 | AATF | ENSG00000275700.6 | transcript | ENST00000619387.5 | protein_coding | 11/11 | c.1619+8796dupA | INFO_REALIGN_3_PRIME | |||||
|
chr17:37040681
|
T | C | intron_variant | MODIFIER | HG00099.hp2 HG00140.hp2 HG00280.hp1 others(162): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0002a0001c0003others(7): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(17): Show | a0001c0001t0001g0014a0001c0001t0001g0015a0001c0001t0001g0017others(161): Show | 165 | 245 | 0.6735 | 0 | AATF | ENSG00000275700.6 | transcript | ENST00000619387.5 | protein_coding | 11/11 | c.1619+8996T>C |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
ahapid | alen | total | AFR | AMR | EAS | EUR | SAS | aseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AATF | 0/1 | a0001 | 560 | 233 | 78 | 43 | 80 | 8 | 23 | subcellular location copy fasta | chr17 | 36943954 | 37061871 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
chapid | clen | total | AFR | AMR | EAS | EUR | SAS | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AATF | 0/0 | c0002 | 1683 | 31 | 4 | 8 | 10 | 2 | 7 | copy fasta | chr17 | 36943954 | 37061871 |
| genename | grch38/chm13v2 | thapid | tlen | total | AFR | AMR | EAS | EUR | SAS | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AATF | 0/1 | t0002 | 380 | 57 | 2 | 10 | 33 | 2 | 9 | copy fasta | chr17 | 36943954 | 37061871 |
| genename | grch38/chm13v2 | ghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| AATF | 0/0 | g0235 | 1 | 0 | 1 | 0 | 0 | 0 | chr17 | 36943954 | 37061871 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
achapid | total | AFR | AMR | EAS | EUR | SAS | clen | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AATF | 0/0 | a0001c0002 | 31 | 4 | 8 | 10 | 2 | 7 | 1683 | copy fasta | chr17 | 36943954 | 37061871 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
acthapid | total | AFR | AMR | EAS | EUR | SAS | tlen | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AATF | 0/0 | a0001c0002t0002 | 23 | 1 | 6 | 10 | 1 | 5 | 2062 | copy fasta | chr17 | 36943954 | 37061871 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
actghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| AATF | 0/0 | a0001c0002t0002g0235 | 1 | 0 | 1 | 0 | 0 | 0 | chr17 | 36943954 | 37061871 |
Click to load Haplotype QTL data...
| pos | S. Strand |
E# Exon Number |
max | median | min | diff | type | haplotypeid | max_hap_list | min_hap_list | symbol | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 36949216 | + | 1 | -0.9560 | -0.9560 | -0.9560 | 0.0000 | acceptor | a0001c0002t0002g0235 | HG01109.hp2 | HG01109.hp2 | AATF | chr17 | 36943954 | 37061871 |
| 36950214 | + | 2 | 0.9890 | 0.9890 | 0.9890 | 0.0000 | donor | a0001c0002t0002g0235 | HG01109.hp2 | HG01109.hp2 | AATF | chr17 | 36943954 | 37061871 |
| 36950405 | + | 2 | -0.9937 | -0.9937 | -0.9937 | 0.0000 | acceptor | a0001c0002t0002g0235 | HG01109.hp2 | HG01109.hp2 | AATF | chr17 | 36943954 | 37061871 |
| 36952886 | + | 3 | 0.9974 | 0.9974 | 0.9974 | 0.0000 | donor | a0001c0002t0002g0235 | HG01109.hp2 | HG01109.hp2 | AATF | chr17 | 36943954 | 37061871 |
| 36953296 | + | 3 | -0.9971 | -0.9971 | -0.9971 | 0.0000 | acceptor | a0001c0002t0002g0235 | HG01109.hp2 | HG01109.hp2 | AATF | chr17 | 36943954 | 37061871 |
| 36953770 | + | 4 | 0.9450 | 0.9450 | 0.9450 | 0.0000 | donor | a0001c0002t0002g0235 | HG01109.hp2 | HG01109.hp2 | AATF | chr17 | 36943954 | 37061871 |
| 36953907 | + | 4 | -0.9458 | -0.9458 | -0.9458 | 0.0000 | acceptor | a0001c0002t0002g0235 | HG01109.hp2 | HG01109.hp2 | AATF | chr17 | 36943954 | 37061871 |
| 36986617 | + | 5 | 0.9549 | 0.9549 | 0.9549 | 0.0000 | donor | a0001c0002t0002g0235 | HG01109.hp2 | HG01109.hp2 | AATF | chr17 | 36943954 | 37061871 |
| 36986731 | + | 5 | -0.9767 | -0.9767 | -0.9767 | 0.0000 | acceptor | a0001c0002t0002g0235 | HG01109.hp2 | HG01109.hp2 | AATF | chr17 | 36943954 | 37061871 |
| 36988519 | + | 6 | 0.9952 | 0.9952 | 0.9952 | 0.0000 | donor | a0001c0002t0002g0235 | HG01109.hp2 | HG01109.hp2 | AATF | chr17 | 36943954 | 37061871 |
| 36988720 | + | 6 | -0.8071 | -0.8071 | -0.8071 | 0.0000 | acceptor | a0001c0002t0002g0235 | HG01109.hp2 | HG01109.hp2 | AATF | chr17 | 36943954 | 37061871 |
| 36989247 | + | 7 | 0.9985 | 0.9985 | 0.9985 | 0.0000 | donor | a0001c0002t0002g0235 | HG01109.hp2 | HG01109.hp2 | AATF | chr17 | 36943954 | 37061871 |
| 36989411 | + | 7 | -0.9988 | -0.9988 | -0.9988 | 0.0000 | acceptor | a0001c0002t0002g0235 | HG01109.hp2 | HG01109.hp2 | AATF | chr17 | 36943954 | 37061871 |
| 36990774 | + | 8 | 0.9944 | 0.9944 | 0.9944 | 0.0000 | donor | a0001c0002t0002g0235 | HG01109.hp2 | HG01109.hp2 | AATF | chr17 | 36943954 | 37061871 |
| 36990857 | + | 8 | -0.9995 | -0.9995 | -0.9995 | 0.0000 | acceptor | a0001c0002t0002g0235 | HG01109.hp2 | HG01109.hp2 | AATF | chr17 | 36943954 | 37061871 |
| 37019005 | + | 9 | 0.9988 | 0.9988 | 0.9988 | 0.0000 | donor | a0001c0002t0002g0235 | HG01109.hp2 | HG01109.hp2 | AATF | chr17 | 36943954 | 37061871 |
| 37019072 | + | 9 | -0.9980 | -0.9980 | -0.9980 | 0.0000 | acceptor | a0001c0002t0002g0235 | HG01109.hp2 | HG01109.hp2 | AATF | chr17 | 36943954 | 37061871 |
| 37020934 | + | 10 | 0.9920 | 0.9920 | 0.9920 | 0.0000 | donor | a0001c0002t0002g0235 | HG01109.hp2 | HG01109.hp2 | AATF | chr17 | 36943954 | 37061871 |
| 37021014 | + | 10 | -0.9908 | -0.9908 | -0.9908 | 0.0000 | acceptor | a0001c0002t0002g0235 | HG01109.hp2 | HG01109.hp2 | AATF | chr17 | 36943954 | 37061871 |
| 37031614 | + | 11 | 0.9726 | 0.9726 | 0.9726 | 0.0000 | donor | a0001c0002t0002g0235 | HG01109.hp2 | HG01109.hp2 | AATF | chr17 | 36943954 | 37061871 |
| 37031685 | + | 11 | -0.9917 | -0.9917 | -0.9917 | 0.0000 | acceptor | a0001c0002t0002g0235 | HG01109.hp2 | HG01109.hp2 | AATF | chr17 | 36943954 | 37061871 |
| 37056601 | + | 12 | 0.6919 | 0.6919 | 0.6919 | 0.0000 | donor | a0001c0002t0002g0235 | HG01109.hp2 | HG01109.hp2 | AATF | chr17 | 36943954 | 37061871 |
| pos | annotationhgvs_chgvs_p | clinvarid | clnsig | geneinfo | mc | clndisdb | strand strand
|
ahapid ahapid_count
|
chapid chapid count
|
thapid thapid_count
|
ghapid ghapid_count
|
AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
impact | chr | ref | alt | external |
|---|
| CHR:POS | annotationhgvs_chgvs_p | disease trait-log10podds or beta | AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
study | initial sample size/replication sample size | report genes | mapped gene | strongest snp risk allele | strand strand
|
impact | chr | ref | alt |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr17:36949012
|
c.-114G>C | Obesity-related traits0.02 | a0001 | a0001c0001a0001c0002 | a0001c0001t0002a0001c0002t0002a0001c0002t0005 | a0001c0001t0002g0001a0001c0001t0002g0002a0001c0001t0002g0003a0001c0001t0002g0004a0001c0001t0002g0005others(56): Show | HG00140.hp2 HG00280.hp1 HG00280.hp2 HG00408.hp1 HG00544.hp2 others(57): Show |
Novel genetic loci identified for the pathophysiol others(52): Show |
815 Hispanic children from 263 families/ | AATF | AATF | rs2306658-G | + | MODIFIER | chr17 | G | C |
|
chr17:36949012
|
c.-114G>C | Obesity-related traits0.03 | a0001 | a0001c0001a0001c0002 | a0001c0001t0002a0001c0002t0002a0001c0002t0005 | a0001c0001t0002g0001a0001c0001t0002g0002a0001c0001t0002g0003a0001c0001t0002g0004a0001c0001t0002g0005others(56): Show | HG00140.hp2 HG00280.hp1 HG00280.hp2 HG00408.hp1 HG00544.hp2 others(57): Show |
Novel genetic loci identified for the pathophysiol others(52): Show |
815 Hispanic children from 263 families/ | AATF | AATF | rs2306658-G | + | MODIFIER | chr17 | G | C |