| geneid | 53947 |
|---|---|
| ensemblid | ENSG00000128274.17 |
| hgncid | 18149 |
| symbol | A4GALT |
| name | alpha 1,4-galactosyltransferase (P blood group) |
| refseq_nuc | NM_017436.7 |
| refseq_prot | NP_059132.1 |
| ensembl_nuc | ENST00000642412.2 |
| ensembl_prot | ENSP00000494127.1 |
| mane_status | MANE Select |
| chr | chr22 |
| start | 42692121 |
| end | 42720870 |
| strand | - |
| ver | v1.2 |
| region | chr22:42692121-42720870 |
| region5000 | chr22:42687121-42725870 |
| regionname0 | A4GALT_chr22_42692121_42720870 |
| regionname5000 | A4GALT_chr22_42687121_42725870 |
| chr:pos | ref | alt | af | annotation | impact | samples | AHAPIDS | ACHAPIDS | ACTHAPIDS | ACTGHAPIDS | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr22:42720811
|
GCGGCGGG others(18): Show |
G | 0.1872 | 5_prime_UTR_variant | MODIFIER | HG00140.hp2 HG00280.hp2 HG00423.hp2 others(73): Show |
a0001a0002a0006 | a0001c0001a0001c0002a0002c0003others(1): Show | a0001c0001t0007a0001c0001t0016a0001c0001t0020others(6): Show | a0001c0001t0007g0017a0001c0001t0007g0027a0001c0001t0007g0033others(72): Show | 76 | 406 | -25 | A4GALT | ENSG00000128274.17 | transcript | ENST00000642412.2 | protein_coding | 1/3 | c.-227_-203delGGGCCCCGCTGTCCGCCGCCCGCCG | 26861 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
ahapid | alen | total | AFR | AMR | EAS | EUR | SAS | aseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A4GALT | 1/0 | a0001 | 353 | 274 | 36 | 57 | 150 | 7 | 23 | subcellular location copy fasta | chr22 | 42687121 | 42725870 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
chapid | clen | total | AFR | AMR | EAS | EUR | SAS | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A4GALT | 1/0 | c0002 | 1062 | 113 | 11 | 32 | 51 | 6 | 12 | copy fasta | chr22 | 42687121 | 42725870 |
| genename | grch38/chm13v2 | thapid | tlen | total | AFR | AMR | EAS | EUR | SAS | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A4GALT | 0/0 | t0012 | 1006 | 3 | 0 | 3 | 0 | 0 | 0 | copy fasta | chr22 | 42687121 | 42725870 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
achapid | total | AFR | AMR | EAS | EUR | SAS | clen | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A4GALT | 1/0 | a0001c0002 | 113 | 11 | 32 | 51 | 6 | 12 | 1062 | copy fasta | chr22 | 42687121 | 42725870 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
acthapid | total | AFR | AMR | EAS | EUR | SAS | tlen | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A4GALT | 0/0 | a0001c0002t0012 | 3 | 0 | 3 | 0 | 0 | 0 | 2067 | copy fasta | chr22 | 42687121 | 42725870 |
Click to load Haplotype QTL data...
| pos | S. Strand |
E# Exon Number |
max | median | min | diff | type | haplotypeid | max_hap_list | min_hap_list | symbol | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 42720797 | - | 1 | -0.8530 | -0.8530 | -0.8530 | 0.0000 | acceptor | a0001c0002t0012 | HG01167.hp2 HG01169.hp2 HG01256.hp2 |
HG01167.hp2 HG01169.hp2 HG01256.hp2 |
A4GALT | chr22 | 42687121 | 42725870 |
| 42695491 | - | 2 | -0.8320 | -0.8316 | -0.8316 | 0.0004 | acceptor | a0001c0002t0012 | HG01256.hp2 | HG01167.hp2 HG01169.hp2 |
A4GALT | chr22 | 42687121 | 42725870 |
| 42695631 | - | 2 | 0.9119 | 0.9063 | 0.9064 | 0.0055 | donor | a0001c0002t0012 | HG01256.hp2 | HG01167.hp2 HG01169.hp2 |
A4GALT | chr22 | 42687121 | 42725870 |
| 42693997 | - | 3 | 0.7366 | 0.7366 | 0.7366 | 0.0000 | donor | a0001c0002t0012 | HG01167.hp2 HG01169.hp2 HG01256.hp2 |
HG01167.hp2 HG01169.hp2 HG01256.hp2 |
A4GALT | chr22 | 42687121 | 42725870 |
| pos | annotationhgvs_chgvs_p | clinvarid | clnsig | geneinfo | mc | clndisdb | strand strand
|
ahapid ahapid_count
|
chapid chapid count
|
thapid thapid_count
|
ghapid ghapid_count
|
AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
impact | chr | ref | alt | external |
|---|
| CHR:POS | annotationhgvs_chgvs_p | disease trait-log10podds or beta | AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
study | initial sample size/replication sample size | report genes | mapped gene | strongest snp risk allele | strand strand
|
impact | chr | ref | alt |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr22:42709150
|
c.-188+11647C>G | Mean corpuscular volume0.0302 | a0001a0002a0003a0006 | a0001c0001a0001c0002a0001c0009a0001c0011a0002c0003others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(230): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(234): Show |
Genetic analysis of quantitative traits in the Jap others(60): Show |
108,256 Japanese ancestry individuals/ | A4GALT | CYB5R3, A4GALT | rs5758884-? | - | MODIFIER | chr22 | G | C |
|
chr22:42716812
|
c.-188+3985G>T |
Estimated glomerular filtration rate0.00 others(2): Show |
a0001a0002a0003a0004a0005others(1): Show | a0001c0001a0001c0002a0001c0007a0001c0009a0001c0010others(7): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0018others(27): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(281): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp1 HG00323.hp2 others(286): Show |
A catalog of genetic loci associated with kidney f others(47): Show |
567,460 European ancestry individuals/216,518 Euro others(25): Show |
A4GALT | CYB5R3, A4GALT | rs1883991-A | - | MODIFIER | chr22 | C | A |
|
chr22:42716955
|
c.-188+3842A>G |
Estimated glomerular filtration rate0.00 others(2): Show |
a0001a0002a0003a0004a0005others(1): Show | a0001c0001a0001c0002a0001c0007a0001c0009a0001c0010others(7): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0018others(32): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(301): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp1 HG00323.hp2 others(307): Show |
A catalog of genetic loci associated with kidney f others(47): Show |
567,460 European ancestry individuals, 165,726 Eas others(211): Show |
A4GALT | A4GALT, CYB5R3 | rs738527-T | - | MODIFIER | chr22 | T | C |
|
chr22:42714109
|
c.-188+6688T>C | Estimated glomerular filtration rate in non-diabeticsothers(18): Show | a0001a0002a0003a0006 | a0001c0001a0001c0002a0001c0009a0001c0011a0002c0003others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(230): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(234): Show |
Mapping eGFR loci to the renal transcriptome and p others(41): Show |
152,624 European ancestry individuals, 36,369 Afri others(25): Show |
A4GALT | A4GALT, CYB5R3 | rs5758891-A | - | MODIFIER | chr22 | A | G |
|
chr22:42718034
|
c.-188+2763C>G |
Estimated glomerular filtration rate0.00 others(2): Show |
a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0001c0011a0002c0003others(4): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(21): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(232): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(236): Show |
Mapping eGFR loci to the renal transcriptome and p others(41): Show |
70,762 European ancestry diabetic individuals, 152 others(346): Show |
A4GALT | CYB5R3, A4GALT | rs2143919-C | - | MODIFIER | chr22 | G | C |
|
chr22:42709150
|
c.-188+11647C>G |
Estimated glomerular filtration rate0.00 others(2): Show |
a0001a0002a0003a0006 | a0001c0001a0001c0002a0001c0009a0001c0011a0002c0003others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(230): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(234): Show |
Mapping eGFR loci to the renal transcriptome and p others(41): Show |
70,762 European ancestry diabetic individuals, 152 others(346): Show |
A4GALT | CYB5R3, A4GALT | rs5758884-C | - | MODIFIER | chr22 | G | C |
|
chr22:42718545
|
c.-188+2252C>T | Red blood cell count | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
Leveraging Polygenic Functional Enrichment to Impr others(15): Show |
approximately 445,000 European ancestry individual others(2): Show |
CYB5R3, A4GALT | rs8138197-? | - | MODIFIER | chr22 | G | A | |
|
chr22:42718014
|
c.-188+2783T>G | Red cell distribution width | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
Leveraging Polygenic Functional Enrichment to Impr others(15): Show |
approximately 445,000 European ancestry individual others(2): Show |
CYB5R3, A4GALT | rs2143918-? | - | MODIFIER | chr22 | A | C | |
|
chr22:42719570
|
c.-188+1227A>G | Hemoglobin levels0.026 | a0001a0002a0003a0004a0005others(1): Show | a0001c0001a0001c0002a0001c0007a0001c0009a0001c0010others(6): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0018others(26): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(262): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp1 HG00323.hp2 others(267): Show |
Predicted loss and gain of function mutations in A others(39): Show |
684,122 European ancestry individuals/ | A4GALT | CYB5R3, A4GALT | rs5758896-T | - | MODIFIER | chr22 | T | C |
|
chr22:42719570
|
c.-188+1227A>G | Venous thromboembolism0.0513 | a0001a0002a0003a0004a0005others(1): Show | a0001c0001a0001c0002a0001c0007a0001c0009a0001c0010others(6): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0018others(26): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(262): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp1 HG00323.hp2 others(267): Show |
Genomic and Transcriptomic Association Studies Ide others(62): Show |
29,435 European ancestry cases, 157,769 European a others(17): Show |
NR | CYB5R3, A4GALT | rs5758896-? | - | MODIFIER | chr22 | T | C |
|
chr22:42718545
|
c.-188+2252C>T | Hematocrit0.024381 | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
Trans-ethnic and Ancestry-Specific Blood-Cell Gene others(54): Show |
562,259 European ancestry individuals/ | NR | CYB5R3, A4GALT | rs8138197-A | - | MODIFIER | chr22 | G | A |
|
chr22:42718545
|
c.-188+2252C>T | Hemoglobin concentration0.02714 | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
Trans-ethnic and Ancestry-Specific Blood-Cell Gene others(54): Show |
563,946 European ancestry individuals/ | NR | CYB5R3, A4GALT | rs8138197-A | - | MODIFIER | chr22 | G | A |
|
chr22:42718545
|
c.-188+2252C>T | Hematocrit | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
Trans-ethnic and Ancestry-Specific Blood-Cell Gene others(54): Show |
737,823 African American or Afro-Caribbean, Africa others(116): Show |
NR | CYB5R3, A4GALT | rs8138197-A | - | MODIFIER | chr22 | G | A |
|
chr22:42718545
|
c.-188+2252C>T | Serum levels of protein A4GALT0.219303 | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
A genome-wide association study of serum proteins others(41): Show |
5,365 Icelandic ancestry individuals/ | CYB5R3, A4GALT | rs8138197-A | - | MODIFIER | chr22 | G | A | |
|
chr22:42718545
|
c.-188+2252C>T | Mean corpuscular volume0.08 | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
Assessing the impact of alcohol consumption on the others(49): Show |
362,595 British ancestry individuals/ | CYB5R3, A4GALT | rs8138197-G | - | MODIFIER | chr22 | G | A | |
|
chr22:42719570
|
c.-188+1227A>G | Hematocrit0.02718178 | a0001a0002a0003a0004a0005others(1): Show | a0001c0001a0001c0002a0001c0007a0001c0009a0001c0010others(6): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0018others(26): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(262): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp1 HG00323.hp2 others(267): Show |
The Allelic Landscape of Human Blood Cell Trait Va others(44): Show |
173,039 European ancestry individuals/ | A4GALT | CYB5R3, A4GALT | rs5758896-C | - | MODIFIER | chr22 | T | C |
|
chr22:42719570
|
c.-188+1227A>G | Hemoglobin concentration0.03104328 | a0001a0002a0003a0004a0005others(1): Show | a0001c0001a0001c0002a0001c0007a0001c0009a0001c0010others(6): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0018others(26): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(262): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp1 HG00323.hp2 others(267): Show |
The Allelic Landscape of Human Blood Cell Trait Va others(44): Show |
172,925 European ancestry individuals/ | A4GALT | CYB5R3, A4GALT | rs5758896-C | - | MODIFIER | chr22 | T | C |
|
chr22:42713833
|
c.-188+6964G>T | Platelet distribution width0.03858408 | a0001a0002a0003a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(2): Show | a0001c0001t0002a0001c0001t0007a0001c0001t0016a0001c0001t0019a0001c0001t0020others(16): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0101a0001c0001t0002g0102a0001c0001t0002g0103others(200): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00408.hp1 HG00423.hp2 others(204): Show |
The Allelic Landscape of Human Blood Cell Trait Va others(44): Show |
164,433 European ancestry individuals/ | A4GALT | CYB5R3, A4GALT | rs8139674-A | - | MODIFIER | chr22 | C | A |
|
chr22:42709252
|
c.-188+11545C>T | Cystatin C levels0.0317 | a0001a0002a0003a0004a0005others(1): Show | a0001c0001a0001c0002a0001c0007a0001c0009a0001c0010others(8): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0018others(33): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(374): Show | HG00099.hp2 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(382): Show |
Genetics of 35 blood and urine biomarkers in the U others(10): Show |
342,399 European ancestry individuals, 6,015 Afric others(64): Show |
NR | A4GALT, CYB5R3 | rs5758885-A | - | MODIFIER | chr22 | G | A |
|
chr22:42720983
|
c.-374C>T |
Dihexosylceramide (d18:1/20:0) levels0.1 others(2): Show |
a0001a0002a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0006c0013 | a0001c0001t0007a0001c0001t0016a0001c0001t0020a0001c0002t0003a0001c0002t0012others(6): Show | a0001c0001t0007g0017a0001c0001t0007g0027a0001c0001t0007g0033a0001c0001t0007g0034a0001c0001t0007g0039others(75): Show | HG00140.hp2 HG00280.hp2 HG00423.hp2 HG00621.hp1 HG00733.hp1 others(76): Show |
Comprehensive genetic analysis of the human lipido others(91): Show |
4,492 European ancestry individuals/1,565 European others(21): Show |
A4GALT | rs28910284-A | - | MODIFIER | chr22 | G | A | |
|
chr22:42720983
|
c.-374C>T |
Dihexosylceramide (d18:1/22:0) levels0.1 others(2): Show |
a0001a0002a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0006c0013 | a0001c0001t0007a0001c0001t0016a0001c0001t0020a0001c0002t0003a0001c0002t0012others(6): Show | a0001c0001t0007g0017a0001c0001t0007g0027a0001c0001t0007g0033a0001c0001t0007g0034a0001c0001t0007g0039others(75): Show | HG00140.hp2 HG00280.hp2 HG00423.hp2 HG00621.hp1 HG00733.hp1 others(76): Show |
Comprehensive genetic analysis of the human lipido others(91): Show |
4,492 European ancestry individuals/1,565 European others(21): Show |
A4GALT | rs28910284-A | - | MODIFIER | chr22 | G | A | |
|
chr22:42718465
|
c.-188+2332T>G |
Dihexosylceramide (d18:1/24:0) levels0.1 others(2): Show |
a0001a0002a0003a0006 | a0001c0001a0001c0002a0002c0003a0003c0004a0006c0013 | a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0020a0001c0002t0003others(7): Show | a0001c0001t0004g0381a0001c0001t0007g0017a0001c0001t0007g0027a0001c0001t0007g0033a0001c0001t0007g0034others(79): Show | HG00140.hp2 HG00280.hp2 HG00423.hp2 HG00558.hp1 HG00621.hp1 others(81): Show |
Comprehensive genetic analysis of the human lipido others(91): Show |
4,492 European ancestry individuals/1,565 European others(21): Show |
CYB5R3, A4GALT | rs13056962-C | - | MODIFIER | chr22 | A | C | |
|
chr22:42720983
|
c.-374C>T |
Trihexosylcermide (d18:1/18:0) levels0.2 others(2): Show |
a0001a0002a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0006c0013 | a0001c0001t0007a0001c0001t0016a0001c0001t0020a0001c0002t0003a0001c0002t0012others(6): Show | a0001c0001t0007g0017a0001c0001t0007g0027a0001c0001t0007g0033a0001c0001t0007g0034a0001c0001t0007g0039others(75): Show | HG00140.hp2 HG00280.hp2 HG00423.hp2 HG00621.hp1 HG00733.hp1 others(76): Show |
Comprehensive genetic analysis of the human lipido others(91): Show |
4,492 European ancestry individuals/1,565 European others(21): Show |
A4GALT | rs28910284-A | - | MODIFIER | chr22 | G | A | |
|
chr22:42716955
|
c.-188+3842A>G | Estimated glomerular filtration rate (creatinine)others(15): Show | a0001a0002a0003a0004a0005others(1): Show | a0001c0001a0001c0002a0001c0007a0001c0009a0001c0010others(7): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0018others(32): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(301): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp1 HG00323.hp2 others(307): Show |
Epigenomic and transcriptomic analyses define core others(64): Show |
1,205,871 European ancestry individuals, 168,300 E others(384): Show |
A4GALT, CYB5R3 | rs738527-C | - | MODIFIER | chr22 | T | C | |
|
chr22:42720983
|
c.-374C>T |
Trihexosylcermide (d18:1/18:0) levels0.3 others(2): Show |
a0001a0002a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0006c0013 | a0001c0001t0007a0001c0001t0016a0001c0001t0020a0001c0002t0003a0001c0002t0012others(6): Show | a0001c0001t0007g0017a0001c0001t0007g0027a0001c0001t0007g0033a0001c0001t0007g0034a0001c0001t0007g0039others(75): Show | HG00140.hp2 HG00280.hp2 HG00423.hp2 HG00621.hp1 HG00733.hp1 others(76): Show |
Comprehensive genetic analysis of the human lipido others(91): Show |
4,492 European ancestry individuals/ | A4GALT | rs28910284-A | - | MODIFIER | chr22 | G | A | |
|
chr22:42718465
|
c.-188+2332T>G |
Dihexosylceramide (d18:1/24:0) levels0.1 others(2): Show |
a0001a0002a0003a0006 | a0001c0001a0001c0002a0002c0003a0003c0004a0006c0013 | a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0020a0001c0002t0003others(7): Show | a0001c0001t0004g0381a0001c0001t0007g0017a0001c0001t0007g0027a0001c0001t0007g0033a0001c0001t0007g0034others(79): Show | HG00140.hp2 HG00280.hp2 HG00423.hp2 HG00558.hp1 HG00621.hp1 others(81): Show |
Comprehensive genetic analysis of the human lipido others(91): Show |
4,492 European ancestry individuals/ | CYB5R3, A4GALT | rs13056962-C | - | MODIFIER | chr22 | A | C | |
|
chr22:42720983
|
c.-374C>T |
Dihexosylceramide (d18:1/20:0) levels0.1 others(2): Show |
a0001a0002a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0006c0013 | a0001c0001t0007a0001c0001t0016a0001c0001t0020a0001c0002t0003a0001c0002t0012others(6): Show | a0001c0001t0007g0017a0001c0001t0007g0027a0001c0001t0007g0033a0001c0001t0007g0034a0001c0001t0007g0039others(75): Show | HG00140.hp2 HG00280.hp2 HG00423.hp2 HG00621.hp1 HG00733.hp1 others(76): Show |
Comprehensive genetic analysis of the human lipido others(91): Show |
4,492 European ancestry individuals/ | A4GALT | rs28910284-A | - | MODIFIER | chr22 | G | A | |
|
chr22:42720983
|
c.-374C>T |
Dihexosylceramide (d18:1/22:0) levels0.2 others(2): Show |
a0001a0002a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0006c0013 | a0001c0001t0007a0001c0001t0016a0001c0001t0020a0001c0002t0003a0001c0002t0012others(6): Show | a0001c0001t0007g0017a0001c0001t0007g0027a0001c0001t0007g0033a0001c0001t0007g0034a0001c0001t0007g0039others(75): Show | HG00140.hp2 HG00280.hp2 HG00423.hp2 HG00621.hp1 HG00733.hp1 others(76): Show |
Comprehensive genetic analysis of the human lipido others(91): Show |
4,492 European ancestry individuals/ | A4GALT | rs28910284-A | - | MODIFIER | chr22 | G | A | |
|
chr22:42720983
|
c.-374C>T | Trihexosylcermide (d18:1/18:0) levels | a0001a0002a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0006c0013 | a0001c0001t0007a0001c0001t0016a0001c0001t0020a0001c0002t0003a0001c0002t0012others(6): Show | a0001c0001t0007g0017a0001c0001t0007g0027a0001c0001t0007g0033a0001c0001t0007g0034a0001c0001t0007g0039others(75): Show | HG00140.hp2 HG00280.hp2 HG00423.hp2 HG00621.hp1 HG00733.hp1 others(76): Show |
Comprehensive genetic analysis of the human lipido others(91): Show |
6,057 European ancestry individuals/ | A4GALT | rs28910284-A | - | MODIFIER | chr22 | G | A | |
|
chr22:42720979
|
c.-370A>G | Estimated glomerular filtration rate (creatinine)others(16): Show | a0001a0002a0003a0004a0005others(1): Show | a0001c0001a0001c0002a0001c0007a0001c0009a0001c0010others(7): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0018others(30): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(296): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp1 HG00323.hp2 others(301): Show |
Discovery and prioritization of variants and genes others(49): Show |
1,004,040 European ancestry individuals, 165,726 E others(189): Show |
A4GALT | rs28910285-C | - | MODIFIER | chr22 | T | C | |
|
chr22:42716812
|
c.-188+3985G>T | Estimated glomerular filtration rate (creatinine)others(19): Show | a0001a0002a0003a0004a0005others(1): Show | a0001c0001a0001c0002a0001c0007a0001c0009a0001c0010others(7): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0018others(27): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(281): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp1 HG00323.hp2 others(286): Show |
Discovery and prioritization of variants and genes others(49): Show |
1,004,040 European ancestry individuals/417,288 Eu others(27): Show |
CYB5R3, A4GALT | rs1883991-A | - | MODIFIER | chr22 | C | A | |
|
chr22:42718014
|
c.-188+2783T>G | Mean corpuscular volume0.018057 | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
Trans-ethnic and Ancestry-Specific Blood-Cell Gene others(54): Show |
544,127 European ancestry individuals/ | NR | CYB5R3, A4GALT | rs2143918-C | - | MODIFIER | chr22 | A | C |
|
chr22:42718545
|
c.-188+2252C>T | Hemoglobin concentration | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
Trans-ethnic and Ancestry-Specific Blood-Cell Gene others(54): Show |
746,431 African American or Afro-Caribbean, Africa others(116): Show |
NR | CYB5R3, A4GALT | rs8138197-A | - | MODIFIER | chr22 | G | A |
|
chr22:42718545
|
c.-188+2252C>T | Red blood cell count | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
Trans-ethnic and Ancestry-Specific Blood-Cell Gene others(54): Show |
727,624 African American or Afro-Caribbean, Africa others(116): Show |
NR | CYB5R3, A4GALT | rs8138197-A | - | MODIFIER | chr22 | G | A |
|
chr22:42718545
|
c.-188+2252C>T | Red blood cell count0.032823 | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
Trans-ethnic and Ancestry-Specific Blood-Cell Gene others(54): Show |
545,203 European ancestry individuals/ | NR | CYB5R3, A4GALT | rs8138197-A | - | MODIFIER | chr22 | G | A |
|
chr22:42716469
|
c.-188+4328G>A | Height0.0069 | a0001a0002a0003a0004a0005others(1): Show | a0001c0001a0001c0002a0001c0007a0001c0009a0001c0010others(7): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0018others(27): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(275): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp1 HG00323.hp2 others(280): Show |
A saturated map of common genetic variants associa others(22): Show |
5,314,291 European ancestry, Hispanic or Latin Ame others(79): Show |
CYB5R3, A4GALT | rs738526-C | - | MODIFIER | chr22 | C | T | |
|
chr22:42719570
|
c.-188+1227A>G | Red blood cell count | a0001a0002a0003a0004a0005others(1): Show | a0001c0001a0001c0002a0001c0007a0001c0009a0001c0010others(6): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0018others(26): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(262): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp1 HG00323.hp2 others(267): Show |
Analysis across Taiwan Biobank, Biobank Japan, and others(73): Show |
92,615 Taiwanese ancestry individuals/ | CYB5R3, A4GALT | rs5758896-? | - | MODIFIER | chr22 | T | C | |
|
chr22:42718545
|
c.-188+2252C>T | hemoglobin (maximum, inv-norm transformed)others(9): Show | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
Diversity and scale: Genetic architecture of 2068 others(41): Show |
114,984 African American or Afro-Caribbean individ others(130): Show |
CYB5R3, A4GALT | rs8138197-G | - | MODIFIER | chr22 | G | A | |
|
chr22:42718545
|
c.-188+2252C>T |
hemoglobin (mean, inv-norm transformed)0 others(5): Show |
a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
Diversity and scale: Genetic architecture of 2068 others(41): Show |
114,985 African American or Afro-Caribbean individ others(130): Show |
CYB5R3, A4GALT | rs8138197-G | - | MODIFIER | chr22 | G | A | |
|
chr22:42717787
|
c.-188+3010G>T | mean corpuscular volume (MCV, maximum, inv-norm transformed)others(27): Show | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
Diversity and scale: Genetic architecture of 2068 others(41): Show |
114,848 African American or Afro-Caribbean individ others(130): Show |
CYB5R3, A4GALT | rs5751348-C | - | MODIFIER | chr22 | C | A | |
|
chr22:42717787
|
c.-188+3010G>T | mean corpuscular volume (MCV, minimum, inv-norm transformed)others(26): Show | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
Diversity and scale: Genetic architecture of 2068 others(41): Show |
114,863 African American or Afro-Caribbean individ others(130): Show |
CYB5R3, A4GALT | rs5751348-C | - | MODIFIER | chr22 | C | A | |
|
chr22:42717787
|
c.-188+3010G>T | mean corpuscular volume (MCV, mean, inv-norm transformed)others(24): Show | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
Diversity and scale: Genetic architecture of 2068 others(41): Show |
114,862 African American or Afro-Caribbean individ others(130): Show |
CYB5R3, A4GALT | rs5751348-C | - | MODIFIER | chr22 | C | A | |
|
chr22:42717787
|
c.-188+3010G>T | mean corpuscular hemoglobin concentration (MCHC, maximum, inv-norm transformed)others(46): Show | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
Diversity and scale: Genetic architecture of 2068 others(41): Show |
114,857 African American or Afro-Caribbean individ others(130): Show |
CYB5R3, A4GALT | rs5751348-C | - | MODIFIER | chr22 | C | A | |
|
chr22:42718545
|
c.-188+2252C>T | red blood cell count (RBC, maximum, inv-norm transformed)others(24): Show | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
Diversity and scale: Genetic architecture of 2068 others(41): Show |
405,357 European ancestry individuals/ | CYB5R3, A4GALT | rs8138197-G | - | MODIFIER | chr22 | G | A | |
|
chr22:42717787
|
c.-188+3010G>T | Hemoglobin A1c levels0.0253 | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
A cross-population atlas of genetic associations f others(24): Show |
344,182 European ancestry individuals, 71,221 East others(28): Show |
CYB5R3, A4GALT | rs5751348-A | - | MODIFIER | chr22 | C | A | |
|
chr22:42718545
|
c.-188+2252C>T | Hemoglobin0.0193 | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
A cross-population atlas of genetic associations f others(24): Show |
350,474 European ancestry individuals, 152,447 Eas others(29): Show |
CYB5R3, A4GALT | rs8138197-A | - | MODIFIER | chr22 | G | A | |
|
chr22:42718545
|
c.-188+2252C>T | Hematocrit0.0164 | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
A cross-population atlas of genetic associations f others(24): Show |
350,475 European ancestry individuals, 153,015 Eas others(29): Show |
CYB5R3, A4GALT | rs8138197-A | - | MODIFIER | chr22 | G | A | |
|
chr22:42718545
|
c.-188+2252C>T | Total bilirubin levels0.0116 | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
A cross-population atlas of genetic associations f others(24): Show |
342,829 European ancestry individuals, 124,341 Eas others(29): Show |
CYB5R3, A4GALT | rs8138197-A | - | MODIFIER | chr22 | G | A | |
|
chr22:42713737
|
c.-188+7060T>C | creatinine (minimum, inv-norm transformed)others(9): Show | a0001a0002a0003a0004a0005others(1): Show | a0001c0001a0001c0002a0001c0007a0001c0009a0001c0010others(7): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0018others(32): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(315): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp1 HG00323.hp2 others(321): Show |
Diversity and scale: Genetic architecture of 2068 others(41): Show |
117,108 African American or Afro-Caribbean individ others(130): Show |
CYB5R3, A4GALT | rs5758889-A | - | MODIFIER | chr22 | A | G | |
|
chr22:42713737
|
c.-188+7060T>C | estimated glomerular filtration rate (eGFR, mean, inv-norm transformed)others(38): Show | a0001a0002a0003a0004a0005others(1): Show | a0001c0001a0001c0002a0001c0007a0001c0009a0001c0010others(7): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0018others(32): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(315): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp1 HG00323.hp2 others(321): Show |
Diversity and scale: Genetic architecture of 2068 others(41): Show |
110,856 African American or Afro-Caribbean individ others(130): Show |
CYB5R3, A4GALT | rs5758889-A | - | MODIFIER | chr22 | A | G | |
|
chr22:42720979
|
c.-370A>G | creatinine (maximum, inv-norm transformed)others(9): Show | a0001a0002a0003a0004a0005others(1): Show | a0001c0001a0001c0002a0001c0007a0001c0009a0001c0010others(7): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0018others(30): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(296): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp1 HG00323.hp2 others(301): Show |
Diversity and scale: Genetic architecture of 2068 others(41): Show |
116,285 African American or Afro-Caribbean individ others(130): Show |
A4GALT | rs28910285-T | - | MODIFIER | chr22 | T | C | |
|
chr22:42720979
|
c.-370A>G |
creatinine (mean, inv-norm transformed)0 others(6): Show |
a0001a0002a0003a0004a0005others(1): Show | a0001c0001a0001c0002a0001c0007a0001c0009a0001c0010others(7): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0018others(30): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(296): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp1 HG00323.hp2 others(301): Show |
Diversity and scale: Genetic architecture of 2068 others(41): Show |
116,707 African American or Afro-Caribbean individ others(130): Show |
A4GALT | rs28910285-T | - | MODIFIER | chr22 | T | C | |
|
chr22:42713737
|
c.-188+7060T>C | estimated glomerular filtration rate (eGFR, maximum, inv-norm transformed)others(41): Show | a0001a0002a0003a0004a0005others(1): Show | a0001c0001a0001c0002a0001c0007a0001c0009a0001c0010others(7): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0018others(32): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(315): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp1 HG00323.hp2 others(321): Show |
Diversity and scale: Genetic architecture of 2068 others(41): Show |
110,850 African American or Afro-Caribbean individ others(130): Show |
CYB5R3, A4GALT | rs5758889-A | - | MODIFIER | chr22 | A | G | |
|
chr22:42720979
|
c.-370A>G | estimated glomerular filtration rate (eGFR, minimum, inv-norm transformed)others(41): Show | a0001a0002a0003a0004a0005others(1): Show | a0001c0001a0001c0002a0001c0007a0001c0009a0001c0010others(7): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0018others(30): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(296): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp1 HG00323.hp2 others(301): Show |
Diversity and scale: Genetic architecture of 2068 others(41): Show |
110,854 African American or Afro-Caribbean individ others(130): Show |
A4GALT | rs28910285-T | - | MODIFIER | chr22 | T | C | |
|
chr22:42719570
|
c.-188+1227A>G | Hemoglobin concentration0.02516 | a0001a0002a0003a0004a0005others(1): Show | a0001c0001a0001c0002a0001c0007a0001c0009a0001c0010others(6): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0018others(26): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(262): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp1 HG00323.hp2 others(267): Show |
Common and Ethnic-Specific Genetic Determinants of others(145): Show |
46,904 European ancestry males/80,822 European anc others(11): Show |
CYB5R3, A4GALT | rs5758896-T | - | MODIFIER | chr22 | T | C | |
|
chr22:42717787
|
c.-188+3010G>T | Mean corpuscular volume0.0198 | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
A cross-population atlas of genetic associations f others(24): Show |
350,473 European ancestry individuals, 129,832 Eas others(29): Show |
CYB5R3, A4GALT | rs5751348-A | - | MODIFIER | chr22 | C | A | |
|
chr22:42718545
|
c.-188+2252C>T | Red blood cell count0.0251 | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
A cross-population atlas of genetic associations f others(24): Show |
350,475 European ancestry individuals, 153,512 Eas others(29): Show |
CYB5R3, A4GALT | rs8138197-A | - | MODIFIER | chr22 | G | A | |
|
chr22:42719570
|
c.-188+1227A>G | Hemoglobin concentration0.01907 | a0001a0002a0003a0004a0005others(1): Show | a0001c0001a0001c0002a0001c0007a0001c0009a0001c0010others(6): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0018others(26): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(262): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp1 HG00323.hp2 others(267): Show |
Common and Ethnic-Specific Genetic Determinants of others(145): Show |
52,141 European ancestry females/89,584 European a others(15): Show |
CYB5R3, A4GALT | rs5758896-T | - | MODIFIER | chr22 | T | C | |
|
chr22:42717787
|
c.-188+3010G>T | Hematocrit0.025362866 | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
The Polygenic and Monogenic Basis of Blood Traits others(13): Show |
408,112 British individuals/ | A4GALT | CYB5R3, A4GALT | rs5751348-A | - | MODIFIER | chr22 | C | A |
|
chr22:42718545
|
c.-188+2252C>T | Hemoglobin0.027923496 | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
The Polygenic and Monogenic Basis of Blood Traits others(13): Show |
408,112 British individuals/ | A4GALT | CYB5R3, A4GALT | rs8138197-A | - | MODIFIER | chr22 | G | A |
|
chr22:42718545
|
c.-188+2252C>T |
Mean spheric corpuscular volume0.0185308 others(2): Show |
a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
The Polygenic and Monogenic Basis of Blood Traits others(13): Show |
408,112 British individuals/ | A4GALT | CYB5R3, A4GALT | rs8138197-A | - | MODIFIER | chr22 | G | A |
|
chr22:42713737
|
c.-188+7060T>C | estimated glomerular filtration rate (eGFR, maximum, inv-norm transformed)others(41): Show | a0001a0002a0003a0004a0005others(1): Show | a0001c0001a0001c0002a0001c0007a0001c0009a0001c0010others(7): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0018others(32): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(315): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp1 HG00323.hp2 others(321): Show |
Diversity and scale: Genetic architecture of 2068 others(41): Show |
398,886 European ancestry individuals/ | CYB5R3, A4GALT | rs5758889-A | - | MODIFIER | chr22 | A | G | |
|
chr22:42717787
|
c.-188+3010G>T | mean corpuscular volume (MCV, mean, inv-norm transformed)others(21): Show | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
Diversity and scale: Genetic architecture of 2068 others(41): Show |
407,350 European ancestry individuals/ | CYB5R3, A4GALT | rs5751348-C | - | MODIFIER | chr22 | C | A | |
|
chr22:42717787
|
c.-188+3010G>T | Red blood cell count0.033694085 | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
The Polygenic and Monogenic Basis of Blood Traits others(13): Show |
408,112 British individuals/ | A4GALT | CYB5R3, A4GALT | rs5751348-A | - | MODIFIER | chr22 | C | A |
|
chr22:42717787
|
c.-188+3010G>T | red blood cell count (RBC, mean, inv-norm transformed)others(21): Show | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
Diversity and scale: Genetic architecture of 2068 others(41): Show |
114,768 African American or Afro-Caribbean individ others(130): Show |
CYB5R3, A4GALT | rs5751348-C | - | MODIFIER | chr22 | C | A | |
|
chr22:42717787
|
c.-188+3010G>T | red blood cell count (RBC, minimum, inv-norm transformed)others(23): Show | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
Diversity and scale: Genetic architecture of 2068 others(41): Show |
114,768 African American or Afro-Caribbean individ others(130): Show |
CYB5R3, A4GALT | rs5751348-C | - | MODIFIER | chr22 | C | A | |
|
chr22:42717787
|
c.-188+3010G>T | red cell diameter width (RDW, mean, inv-norm transformed)others(23): Show | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
Diversity and scale: Genetic architecture of 2068 others(41): Show |
110,558 African American or Afro-Caribbean individ others(130): Show |
CYB5R3, A4GALT | rs5751348-C | - | MODIFIER | chr22 | C | A | |
|
chr22:42717787
|
c.-188+3010G>T | red cell diameter width (RDW, minimum, inv-norm transformed)others(27): Show | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
Diversity and scale: Genetic architecture of 2068 others(41): Show |
110,610 African American or Afro-Caribbean individ others(130): Show |
CYB5R3, A4GALT | rs5751348-C | - | MODIFIER | chr22 | C | A | |
|
chr22:42718545
|
c.-188+2252C>T | Haemoglobin concentration (UKB data field 30020)others(19): Show | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
A scalable variational inference approach for incr others(36): Show |
394,642 European ancestry individuals/ | CYB5R3, A4GALT | rs8138197-A | - | MODIFIER | chr22 | G | A | |
|
chr22:42718014
|
c.-188+2783T>G | Red blood cell erythrocyte distribution width (UKB data field 30070)others(39): Show | a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
A scalable variational inference approach for incr others(36): Show |
394,642 European ancestry individuals/ | CYB5R3, A4GALT | rs2143918-C | - | MODIFIER | chr22 | A | C | |
|
chr22:42718545
|
c.-188+2252C>T |
Platelet crit (UKB data field 30090)0.01 others(8): Show |
a0001a0002a0003a0004a0006 | a0001c0001a0001c0002a0001c0009a0002c0003a0002c0008others(3): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0001t0016a0001c0001t0019others(20): Show | a0001c0001t0002g0003a0001c0001t0002g0087a0001c0001t0002g0091a0001c0001t0002g0092a0001c0001t0002g0095others(219): Show | HG00140.hp1 HG00140.hp2 HG00280.hp2 HG00323.hp2 HG00408.hp1 others(223): Show |
A scalable variational inference approach for incr others(36): Show |
394,642 European ancestry individuals/ | CYB5R3, A4GALT | rs8138197-A | - | MODIFIER | chr22 | G | A |
