| geneid | 79719 |
|---|---|
| ensemblid | ENSG00000103591.13 |
| hgncid | 25662 |
| symbol | AAGAB |
| name | alpha and gamma adaptin binding protein |
| refseq_nuc | NM_024666.5 |
| refseq_prot | NP_078942.3 |
| ensembl_nuc | ENST00000261880.10 |
| ensembl_prot | ENSP00000261880.5 |
| mane_status | MANE Select |
| chr | chr15 |
| start | 67200667 |
| end | 67254661 |
| strand | - |
| ver | v1.2 |
| region | chr15:67200667-67254661 |
| region5000 | chr15:67195667-67259661 |
| regionname0 | AAGAB_chr15_67200667_67254661 |
| regionname5000 | AAGAB_chr15_67195667_67259661 |
| chr:pos | ref | alt | af | annotation | impact | samples | AHAPIDS | ACHAPIDS | ACTHAPIDS | ACTGHAPIDS | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr15:67236036
|
T | G | 0.4421 | missense_variant | MODERATE | HG00280.hp2 HG00438.hp1 HG00438.hp2 others(165): Show |
a0002a0005 | a0002c0002a0005c0007 | a0002c0002t0001a0002c0002t0002a0002c0002t0003others(5): Show | a0002c0002t0001g0151a0002c0002t0001g0336a0002c0002t0002g0004others(161): Show | 168 | 380 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 4/10 | c.394A>C | p.Ile132Leu | 424/3132 | 394/948 | 132/315 |
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr15:67201289
|
G | GA | 0.2895 | 3_prime_UTR_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(107): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0011a0001c0001t0015a0001c0001t0017others(2): Show | a0001c0001t0011g0012a0001c0001t0015g0253a0001c0001t0017g0258others(104): Show | 110 | 380 | 1 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 10/10 | c.*1531dupT | 1531 | |||||
|
chr15:67201388
|
T | C | 0.2816 | 3_prime_UTR_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(104): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0020a0002c0002t0003a0002c0002t0007 | a0001c0001t0020g0023a0002c0002t0003g0007a0002c0002t0003g0008others(102): Show | 107 | 380 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 10/10 | c.*1433A>G | 1433 | |||||
|
chr15:67202485
|
G | C | 0.2947 | 3_prime_UTR_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(109): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0006a0001c0001t0020a0002c0002t0003others(2): Show | a0001c0001t0006g0236a0001c0001t0006g0237a0001c0001t0006g0238others(107): Show | 112 | 380 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 10/10 | c.*336C>G | 336 | |||||
|
chr15:67202584
|
T | C | 0.2763 | 3_prime_UTR_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(102): Show |
a0002 | a0002c0002 | a0002c0002t0003a0002c0002t0013 | a0002c0002t0003g0007a0002c0002t0003g0008a0002c0002t0003g0132others(100): Show | 105 | 380 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 10/10 | c.*237A>G | 237 |
| chr:pos | ref | alt | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | af | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr15:67205837
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(354): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0003a0001c0004others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004others(25): Show | a0001c0001t0001g0001a0001c0001t0001g0009a0001c0001t0001g0010others(335): Show | 357 | 380 | 0.9395 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 7/9 | c.716-1689T>C | ||||||
|
chr15:67205926
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(353): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0003a0001c0004others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0005others(24): Show | a0001c0001t0001g0001a0001c0001t0001g0009a0001c0001t0001g0010others(334): Show | 356 | 380 | 0.9368 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 7/9 | c.716-1778A>G | ||||||
|
chr15:67207139
|
A | C | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(117): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0006a0001c0001t0020a0002c0002t0001others(4): Show | a0001c0001t0006g0236a0001c0001t0006g0237a0001c0001t0006g0238others(114): Show | 120 | 380 | 0.3158 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 7/9 | c.715+1423T>G | ||||||
|
chr15:67207856
|
TTTC | T | intron_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp2 others(232): Show |
a0001a0002a0003others(1): Show | a0001c0001a0002c0002a0003c0005others(1): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006others(14): Show | a0001c0001t0002g0003a0001c0001t0002g0026a0001c0001t0002g0027others(226): Show | 235 | 380 | 0.6184 | -3 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 7/9 | c.715+703_715+705delGAA | ||||||
|
chr15:67207992
|
T | C | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(106): Show |
a0002 | a0002c0002 | a0002c0002t0001a0002c0002t0003a0002c0002t0007others(1): Show | a0002c0002t0001g0151a0002c0002t0003g0007a0002c0002t0003g0008others(104): Show | 109 | 380 | 0.2868 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 7/9 | c.715+570A>G | ||||||
|
chr15:67208695
|
G | A | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(106): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0020a0002c0002t0003a0002c0002t0007others(1): Show | a0001c0001t0020g0023a0002c0002t0003g0007a0002c0002t0003g0008others(104): Show | 109 | 380 | 0.2868 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 6/9 | c.619-37C>T | ||||||
|
chr15:67209254
|
C | T | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(105): Show |
a0002 | a0002c0002 | a0002c0002t0003a0002c0002t0007a0002c0002t0013 | a0002c0002t0003g0007a0002c0002t0003g0008a0002c0002t0003g0132others(103): Show | 108 | 380 | 0.2842 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 6/9 | c.618+208G>A | ||||||
|
chr15:67210245
|
G | A | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(110): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0006a0001c0001t0020a0002c0002t0001others(3): Show | a0001c0001t0006g0236a0001c0001t0006g0237a0001c0001t0006g0238others(108): Show | 113 | 380 | 0.2974 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.536-701C>T | ||||||
|
chr15:67211470
|
G | C | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(116): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0005a0001c0001t0006a0001c0001t0009others(5): Show | a0001c0001t0005g0232a0001c0001t0005g0233a0001c0001t0005g0234others(113): Show | 119 | 380 | 0.3132 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.536-1926C>G | ||||||
|
chr15:67211885
|
CT | C | intron_variant | MODIFIER | HG00438.hp2 HG00609.hp2 HG00673.hp2 others(13): Show |
a0002 | a0002c0002 | a0002c0002t0003 | a0002c0002t0003g0197a0002c0002t0003g0200a0002c0002t0003g0212others(13): Show | 16 | 380 | 0.0421 | -1 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.536-2342delA | ||||||
|
chr15:67212012
|
C | T | intron_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp2 others(233): Show |
a0001a0002a0003others(1): Show | a0001c0001a0002c0002a0003c0005others(1): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006others(15): Show | a0001c0001t0002g0003a0001c0001t0002g0026a0001c0001t0002g0027others(227): Show | 236 | 380 | 0.6211 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.536-2468G>A | ||||||
|
chr15:67213622
|
T | A | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(110): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0006a0001c0001t0020a0002c0002t0001others(3): Show | a0001c0001t0006g0236a0001c0001t0006g0237a0001c0001t0006g0238others(108): Show | 113 | 380 | 0.2974 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.536-4078A>T | ||||||
|
chr15:67214195
|
CTCTTT | C | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(107): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0020a0002c0002t0001a0002c0002t0003others(2): Show | a0001c0001t0020g0023a0002c0002t0001g0151a0002c0002t0003g0007others(105): Show | 110 | 380 | 0.2895 | -5 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.536-4656_536-4652delAAAGA | ||||||
|
chr15:67215252
|
C | T | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(106): Show |
a0002 | a0002c0002 | a0002c0002t0001a0002c0002t0003a0002c0002t0007others(1): Show | a0002c0002t0001g0151a0002c0002t0003g0007a0002c0002t0003g0008others(104): Show | 109 | 380 | 0.2868 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.536-5708G>A | ||||||
|
chr15:67215430
|
C | T | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(113): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0005a0001c0001t0009a0001c0001t0020others(4): Show | a0001c0001t0005g0232a0001c0001t0005g0233a0001c0001t0005g0234others(110): Show | 116 | 380 | 0.3053 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.536-5886G>A | ||||||
|
chr15:67215606
|
G | A | intron_variant | MODIFIER | HG00609.hp2 | a0002 | a0002c0002 | a0002c0002t0003 | a0002c0002t0003g0221 | 1 | 380 | 0.0026 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.536-6062C>T | ||||||
|
chr15:67216170
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(353): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0003a0001c0004others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0005others(24): Show | a0001c0001t0001g0001a0001c0001t0001g0009a0001c0001t0001g0010others(334): Show | 356 | 380 | 0.9368 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.536-6626T>C | ||||||
|
chr15:67216442
|
GAA | G | intron_variant | MODIFIER | HG00438.hp2 HG00609.hp2 HG00673.hp2 others(14): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0001a0001c0001t0006a0001c0001t0017others(2): Show | a0001c0001t0001g0315a0001c0001t0006g0236a0001c0001t0017g0258others(14): Show | 17 | 380 | 0.0447 | -2 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.536-6900_536-6899delTT | ||||||
|
chr15:67217809
|
C | T | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(376): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0003a0001c0004others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004others(25): Show | a0001c0001t0001g0001a0001c0001t0001g0009a0001c0001t0001g0010others(357): Show | 379 | 380 | 0.9974 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.536-8265G>A | ||||||
|
chr15:67218266
|
G | C | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(106): Show |
a0002 | a0002c0002 | a0002c0002t0001a0002c0002t0003a0002c0002t0007others(1): Show | a0002c0002t0001g0151a0002c0002t0003g0007a0002c0002t0003g0008others(104): Show | 109 | 380 | 0.2868 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.536-8722C>G | ||||||
|
chr15:67218846
|
G | A | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(376): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0003a0001c0004others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004others(25): Show | a0001c0001t0001g0001a0001c0001t0001g0009a0001c0001t0001g0010others(357): Show | 379 | 380 | 0.9974 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.536-9302C>T | ||||||
|
chr15:67219051
|
G | A | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(116): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0005a0001c0001t0006a0001c0001t0009others(5): Show | a0001c0001t0005g0232a0001c0001t0005g0233a0001c0001t0005g0234others(113): Show | 119 | 380 | 0.3132 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.536-9507C>T | ||||||
|
chr15:67219152
|
A | G | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(116): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0005a0001c0001t0006a0001c0001t0009others(5): Show | a0001c0001t0005g0232a0001c0001t0005g0233a0001c0001t0005g0234others(113): Show | 119 | 380 | 0.3132 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.536-9608T>C | ||||||
|
chr15:67221852
|
T | C | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(106): Show |
a0002 | a0002c0002 | a0002c0002t0001a0002c0002t0003a0002c0002t0007others(1): Show | a0002c0002t0001g0151a0002c0002t0003g0007a0002c0002t0003g0008others(104): Show | 109 | 380 | 0.2868 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.535+9962A>G | ||||||
|
chr15:67221879
|
T | C | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(103): Show |
a0002 | a0002c0002 | a0002c0002t0001a0002c0002t0003a0002c0002t0013 | a0002c0002t0001g0151a0002c0002t0003g0007a0002c0002t0003g0008others(101): Show | 106 | 380 | 0.2790 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.535+9935A>G | ||||||
|
chr15:67222071
|
C | T | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(107): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0020a0002c0002t0001a0002c0002t0003others(2): Show | a0001c0001t0020g0023a0002c0002t0001g0151a0002c0002t0003g0007others(105): Show | 110 | 380 | 0.2895 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.535+9743G>A | ||||||
|
chr15:67222242
|
G | GCGCACAC others(7): Show |
intron_variant | MODIFIER | HG00609.hp2 HG01255.hp2 HG02895.hp2 others(3): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0002a0002c0002t0003 | a0001c0001t0002g0055a0002c0002t0003g0191a0002c0002t0003g0200others(3): Show | 6 | 380 | 0.0158 | 14 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.535+9571_535+9572insTGTGTGTGTGTGCG | ||||||
|
chr15:67222282
|
A | C | intron_variant | MODIFIER | HG00438.hp2 HG00609.hp2 HG00673.hp2 others(16): Show |
a0002 | a0002c0002 | a0002c0002t0003 | a0002c0002t0003g0146a0002c0002t0003g0150a0002c0002t0003g0153others(16): Show | 19 | 380 | 0.0500 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.535+9532T>G | ||||||
|
chr15:67224003
|
T | C | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(106): Show |
a0002 | a0002c0002 | a0002c0002t0001a0002c0002t0003a0002c0002t0007others(1): Show | a0002c0002t0001g0151a0002c0002t0003g0007a0002c0002t0003g0008others(104): Show | 109 | 380 | 0.2868 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.535+7811A>G | ||||||
|
chr15:67224610
|
T | C | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(110): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0006a0001c0001t0020a0002c0002t0001others(3): Show | a0001c0001t0006g0236a0001c0001t0006g0237a0001c0001t0006g0238others(108): Show | 113 | 380 | 0.2974 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.535+7204A>G | ||||||
|
chr15:67224815
|
T | G | intron_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp2 others(232): Show |
a0001a0002a0003others(1): Show | a0001c0001a0002c0002a0003c0005others(1): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006others(14): Show | a0001c0001t0002g0003a0001c0001t0002g0026a0001c0001t0002g0027others(226): Show | 235 | 380 | 0.6184 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.535+6999A>C | ||||||
|
chr15:67225663
|
G | A | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(106): Show |
a0002 | a0002c0002 | a0002c0002t0001a0002c0002t0003a0002c0002t0007others(1): Show | a0002c0002t0001g0151a0002c0002t0003g0007a0002c0002t0003g0008others(104): Show | 109 | 380 | 0.2868 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.535+6151C>T | ||||||
|
chr15:67226702
|
C | T | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(124): Show |
a0001a0002a0003 | a0001c0001a0002c0002a0003c0005 | a0001c0001t0002a0001c0001t0005a0001c0001t0006others(8): Show | a0001c0001t0002g0026a0001c0001t0002g0027a0001c0001t0002g0028others(121): Show | 127 | 380 | 0.3342 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.535+5112G>A | ||||||
|
chr15:67228279
|
T | C | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(110): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0006a0001c0001t0020a0002c0002t0001others(3): Show | a0001c0001t0006g0236a0001c0001t0006g0237a0001c0001t0006g0238others(108): Show | 113 | 380 | 0.2974 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.535+3535A>G | ||||||
|
chr15:67229472
|
C | A | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(106): Show |
a0002 | a0002c0002 | a0002c0002t0001a0002c0002t0003a0002c0002t0007others(1): Show | a0002c0002t0001g0151a0002c0002t0003g0007a0002c0002t0003g0008others(104): Show | 109 | 380 | 0.2868 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.535+2342G>T | ||||||
|
chr15:67229800
|
C | G | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(124): Show |
a0001a0002a0003 | a0001c0001a0002c0002a0003c0005 | a0001c0001t0002a0001c0001t0005a0001c0001t0006others(8): Show | a0001c0001t0002g0026a0001c0001t0002g0027a0001c0001t0002g0028others(121): Show | 127 | 380 | 0.3342 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.535+2014G>C | ||||||
|
chr15:67230705
|
A | G | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(116): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0005a0001c0001t0006a0001c0001t0009others(5): Show | a0001c0001t0005g0232a0001c0001t0005g0233a0001c0001t0005g0234others(113): Show | 119 | 380 | 0.3132 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.535+1109T>C | ||||||
|
chr15:67231547
|
C | T | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(353): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0003a0001c0004others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0005others(24): Show | a0001c0001t0001g0001a0001c0001t0001g0009a0001c0001t0001g0010others(334): Show | 356 | 380 | 0.9368 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 5/9 | c.535+267G>A | ||||||
|
chr15:67232249
|
C | CAA | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(103): Show |
a0002 | a0002c0002 | a0002c0002t0001a0002c0002t0003a0002c0002t0007others(1): Show | a0002c0002t0001g0151a0002c0002t0003g0007a0002c0002t0003g0008others(101): Show | 106 | 380 | 0.2790 | 2 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 4/9 | c.452-354_452-353dupTT | ||||||
|
chr15:67233434
|
T | C | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(106): Show |
a0002 | a0002c0002 | a0002c0002t0001a0002c0002t0003a0002c0002t0007others(1): Show | a0002c0002t0001g0151a0002c0002t0003g0007a0002c0002t0003g0008others(104): Show | 109 | 380 | 0.2868 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 4/9 | c.452-1537A>G | ||||||
|
chr15:67234086
|
C | CAA | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(102): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0006a0001c0001t0020a0002c0002t0001others(3): Show | a0001c0001t0006g0236a0001c0001t0006g0237a0001c0001t0006g0238others(100): Show | 105 | 380 | 0.2763 | 2 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 4/9 | c.451+1891_451+1892dupTT | ||||||
|
chr15:67234161
|
G | A | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(106): Show |
a0002 | a0002c0002 | a0002c0002t0001a0002c0002t0003a0002c0002t0007others(1): Show | a0002c0002t0001g0151a0002c0002t0003g0007a0002c0002t0003g0008others(104): Show | 109 | 380 | 0.2868 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 4/9 | c.451+1818C>T | ||||||
|
chr15:67236212
|
C | T | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(376): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0003a0001c0004others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004others(25): Show | a0001c0001t0001g0001a0001c0001t0001g0009a0001c0001t0001g0010others(357): Show | 379 | 380 | 0.9974 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 3/9 | c.362-144G>A | ||||||
|
chr15:67238061
|
A | G | intron_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp2 others(232): Show |
a0001a0002a0003others(1): Show | a0001c0001a0002c0002a0003c0005others(1): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006others(14): Show | a0001c0001t0002g0003a0001c0001t0002g0026a0001c0001t0002g0027others(226): Show | 235 | 380 | 0.6184 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 1/9 | c.74-1241T>C | ||||||
|
chr15:67238698
|
A | ATTTT | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(111): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0005a0001c0001t0006a0001c0001t0009others(4): Show | a0001c0001t0005g0232a0001c0001t0005g0233a0001c0001t0005g0234others(108): Show | 114 | 380 | 0.3000 | 4 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 1/9 | c.74-1882_74-1879dupAAAA | ||||||
|
chr15:67238985
|
A | G | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(116): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0005a0001c0001t0006a0001c0001t0009others(5): Show | a0001c0001t0005g0232a0001c0001t0005g0233a0001c0001t0005g0234others(113): Show | 119 | 380 | 0.3132 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 1/9 | c.74-2165T>C | ||||||
|
chr15:67240045
|
C | T | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(116): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0005a0001c0001t0006a0001c0001t0009others(5): Show | a0001c0001t0005g0232a0001c0001t0005g0233a0001c0001t0005g0234others(113): Show | 119 | 380 | 0.3132 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 1/9 | c.74-3225G>A | ||||||
|
chr15:67240966
|
T | C | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(106): Show |
a0002 | a0002c0002 | a0002c0002t0001a0002c0002t0003a0002c0002t0007others(1): Show | a0002c0002t0001g0151a0002c0002t0003g0007a0002c0002t0003g0008others(104): Show | 109 | 380 | 0.2868 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 1/9 | c.74-4146A>G | ||||||
|
chr15:67241040
|
TAC | T | intron_variant | MODIFIER | HG00438.hp2 HG00609.hp2 HG00673.hp2 others(42): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0001a0001c0001t0004a0002c0002t0003others(1): Show | a0001c0001t0001g0344a0001c0001t0001g0345a0001c0001t0004g0129others(42): Show | 45 | 380 | 0.1184 | -2 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 1/9 | c.74-4222_74-4221delGT | ||||||
|
chr15:67242127
|
TAAAAATC others(327): Show |
T | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(116): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0005a0001c0001t0006a0001c0001t0009others(5): Show | a0001c0001t0005g0232a0001c0001t0005g0233a0001c0001t0005g0234others(113): Show | 119 | 380 | 0.3132 | -334 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 1/9 | c.74-5641_74-5308del | ||||||
|
chr15:67242874
|
C | G | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(116): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0005a0001c0001t0006a0001c0001t0009others(5): Show | a0001c0001t0005g0232a0001c0001t0005g0233a0001c0001t0005g0234others(113): Show | 119 | 380 | 0.3132 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 1/9 | c.74-6054G>C | ||||||
|
chr15:67243102
|
T | C | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(103): Show |
a0002 | a0002c0002 | a0002c0002t0001a0002c0002t0003a0002c0002t0013 | a0002c0002t0001g0151a0002c0002t0003g0007a0002c0002t0003g0008others(101): Show | 106 | 380 | 0.2790 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 1/9 | c.74-6282A>G | ||||||
|
chr15:67244731
|
G | T | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(110): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0006a0001c0001t0020a0002c0002t0001others(3): Show | a0001c0001t0006g0236a0001c0001t0006g0237a0001c0001t0006g0238others(108): Show | 113 | 380 | 0.2974 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 1/9 | c.74-7911C>A | ||||||
|
chr15:67244872
|
A | G | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(102): Show |
a0002 | a0002c0002 | a0002c0002t0001a0002c0002t0003a0002c0002t0013 | a0002c0002t0001g0151a0002c0002t0003g0007a0002c0002t0003g0008others(100): Show | 105 | 380 | 0.2763 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 1/9 | c.74-8052T>C | ||||||
|
chr15:67246628
|
CACCAATC others(59): Show |
C | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(106): Show |
a0002 | a0002c0002 | a0002c0002t0001a0002c0002t0003a0002c0002t0007others(1): Show | a0002c0002t0001g0151a0002c0002t0003g0007a0002c0002t0003g0008others(104): Show | 109 | 380 | 0.2868 | -66 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 1/9 | c.73+7865_73+7930delACATTTACAATCCTTTAGCTAGACACAGAGTGCTGATTGGTGTGTTTTTACAGAGTGCTGATTGGT | ||||||
|
chr15:67246854
|
A | G | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(110): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0006a0001c0001t0020a0002c0002t0001others(3): Show | a0001c0001t0006g0236a0001c0001t0006g0237a0001c0001t0006g0238others(108): Show | 113 | 380 | 0.2974 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 1/9 | c.73+7705T>C | ||||||
|
chr15:67247579
|
T | G | intron_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp2 others(234): Show |
a0001a0002a0003others(1): Show | a0001c0001a0002c0002a0003c0005others(1): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006others(16): Show | a0001c0001t0002g0003a0001c0001t0002g0026a0001c0001t0002g0027others(228): Show | 237 | 380 | 0.6237 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 1/9 | c.73+6980A>C | ||||||
|
chr15:67247749
|
T | C | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(116): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0005a0001c0001t0006a0001c0001t0009others(5): Show | a0001c0001t0005g0232a0001c0001t0005g0233a0001c0001t0005g0234others(113): Show | 119 | 380 | 0.3132 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 1/9 | c.73+6810A>G | ||||||
|
chr15:67249841
|
C | G | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(110): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0006a0001c0001t0020a0002c0002t0001others(3): Show | a0001c0001t0006g0236a0001c0001t0006g0237a0001c0001t0006g0238others(108): Show | 113 | 380 | 0.2974 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 1/9 | c.73+4718G>C | ||||||
|
chr15:67250011
|
T | A | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(110): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0006a0001c0001t0020a0002c0002t0001others(3): Show | a0001c0001t0006g0236a0001c0001t0006g0237a0001c0001t0006g0238others(108): Show | 113 | 380 | 0.2974 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 1/9 | c.73+4548A>T | ||||||
|
chr15:67251236
|
C | CTGTGTG | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00558.hp1 others(90): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0020a0002c0002t0001a0002c0002t0003others(2): Show | a0001c0001t0020g0023a0002c0002t0001g0151a0002c0002t0003g0007others(89): Show | 93 | 380 | 0.2447 | 6 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 1/9 | c.73+3317_73+3322dupCACACA | ||||||
|
chr15:67251384
|
A | C | intron_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp2 others(232): Show |
a0001a0002a0003others(1): Show | a0001c0001a0002c0002a0003c0005others(1): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006others(14): Show | a0001c0001t0002g0003a0001c0001t0002g0026a0001c0001t0002g0027others(226): Show | 235 | 380 | 0.6184 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 1/9 | c.73+3175T>G | ||||||
|
chr15:67253260
|
CGGGG | C | intron_variant | MODIFIER | HG00438.hp2 HG00609.hp2 HG01928.hp1 others(16): Show |
a0002 | a0002c0002 | a0002c0002t0003 | a0002c0002t0003g0212a0002c0002t0003g0213a0002c0002t0003g0214others(16): Show | 19 | 380 | 0.0500 | -4 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 1/9 | c.73+1295_73+1298delCCCC | ||||||
|
chr15:67253554
|
G | A | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(110): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0006a0001c0001t0020a0002c0002t0001others(3): Show | a0001c0001t0006g0236a0001c0001t0006g0237a0001c0001t0006g0238others(108): Show | 113 | 380 | 0.2974 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 1/9 | c.73+1005C>T | ||||||
|
chr15:67253983
|
C | T | intron_variant | MODIFIER | HG00280.hp2 HG00438.hp2 HG00544.hp2 others(116): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0005a0001c0001t0006a0001c0001t0009others(5): Show | a0001c0001t0005g0232a0001c0001t0005g0233a0001c0001t0005g0234others(113): Show | 119 | 380 | 0.3132 | 0 | AAGAB | ENSG00000103591.13 | transcript | ENST00000261880.10 | protein_coding | 1/9 | c.73+576G>A |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
ahapid | alen | total | AFR | AMR | EAS | EUR | SAS | aseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AAGAB | 0/0 | a0002 | 315 | 167 | 9 | 26 | 109 | 6 | 17 | subcellular location copy fasta | chr15 | 67195667 | 67259661 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
chapid | clen | total | AFR | AMR | EAS | EUR | SAS | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AAGAB | 0/0 | c0002 | 948 | 167 | 9 | 26 | 109 | 6 | 17 | copy fasta | chr15 | 67195667 | 67259661 |
| genename | grch38/chm13v2 | thapid | tlen | total | AFR | AMR | EAS | EUR | SAS | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AAGAB | 0/0 | t0003 | 2186 | 103 | 5 | 24 | 60 | 5 | 9 | copy fasta | chr15 | 67195667 | 67259661 |
| genename | grch38/chm13v2 | ghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| AAGAB | 0/0 | g0221 | 1 | 0 | 0 | 1 | 0 | 0 | chr15 | 67195667 | 67259661 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
achapid | total | AFR | AMR | EAS | EUR | SAS | clen | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AAGAB | 0/0 | a0002c0002 | 167 | 9 | 26 | 109 | 6 | 17 | 948 | copy fasta | chr15 | 67195667 | 67259661 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
acthapid | total | AFR | AMR | EAS | EUR | SAS | tlen | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AAGAB | 0/0 | a0002c0002t0003 | 103 | 5 | 24 | 60 | 5 | 9 | 3133 | copy fasta | chr15 | 67195667 | 67259661 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
actghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| AAGAB | 0/0 | a0002c0002t0003g0221 | 1 | 0 | 0 | 1 | 0 | 0 | chr15 | 67195667 | 67259661 |
Click to load Haplotype QTL data...
| pos | S. Strand |
E# Exon Number |
max | median | min | diff | type | haplotypeid | max_hap_list | min_hap_list | symbol | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 67254559 | - | 1 | -0.6602 | -0.6602 | -0.6602 | 0.0000 | acceptor | a0002c0002t0003g0221 | HG00609.hp2 | HG00609.hp2 | AAGAB | chr15 | 67195667 | 67259661 |
| 67236630 | - | 2 | -0.9898 | -0.9898 | -0.9898 | 0.0000 | acceptor | a0002c0002t0003g0221 | HG00609.hp2 | HG00609.hp2 | AAGAB | chr15 | 67195667 | 67259661 |
| 67236820 | - | 2 | 0.9984 | 0.9984 | 0.9984 | 0.0000 | donor | a0002c0002t0003g0221 | HG00609.hp2 | HG00609.hp2 | AAGAB | chr15 | 67195667 | 67259661 |
| 67236408 | - | 3 | -0.9831 | -0.9831 | -0.9831 | 0.0000 | acceptor | a0002c0002t0003g0221 | HG00609.hp2 | HG00609.hp2 | AAGAB | chr15 | 67195667 | 67259661 |
| 67236504 | - | 3 | 0.9741 | 0.9741 | 0.9741 | 0.0000 | donor | a0002c0002t0003g0221 | HG00609.hp2 | HG00609.hp2 | AAGAB | chr15 | 67195667 | 67259661 |
| 67235979 | - | 4 | -0.9964 | -0.9964 | -0.9964 | 0.0000 | acceptor | a0002c0002t0003g0221 | HG00609.hp2 | HG00609.hp2 | AAGAB | chr15 | 67195667 | 67259661 |
| 67236068 | - | 4 | 0.9953 | 0.9953 | 0.9953 | 0.0000 | donor | a0002c0002t0003g0221 | HG00609.hp2 | HG00609.hp2 | AAGAB | chr15 | 67195667 | 67259661 |
| 67231814 | - | 5 | -0.9814 | -0.9814 | -0.9814 | 0.0000 | acceptor | a0002c0002t0003g0221 | HG00609.hp2 | HG00609.hp2 | AAGAB | chr15 | 67195667 | 67259661 |
| 67231897 | - | 5 | 0.9599 | 0.9599 | 0.9599 | 0.0000 | donor | a0002c0002t0003g0221 | HG00609.hp2 | HG00609.hp2 | AAGAB | chr15 | 67195667 | 67259661 |
| 67209462 | - | 6 | -0.9942 | -0.9942 | -0.9942 | 0.0000 | acceptor | a0002c0002t0003g0221 | HG00609.hp2 | HG00609.hp2 | AAGAB | chr15 | 67195667 | 67259661 |
| 67209544 | - | 6 | 0.9912 | 0.9912 | 0.9912 | 0.0000 | donor | a0002c0002t0003g0221 | HG00609.hp2 | HG00609.hp2 | AAGAB | chr15 | 67195667 | 67259661 |
| 67208562 | - | 7 | -0.9970 | -0.9970 | -0.9970 | 0.0000 | acceptor | a0002c0002t0003g0221 | HG00609.hp2 | HG00609.hp2 | AAGAB | chr15 | 67195667 | 67259661 |
| 67208658 | - | 7 | 0.9851 | 0.9851 | 0.9851 | 0.0000 | donor | a0002c0002t0003g0221 | HG00609.hp2 | HG00609.hp2 | AAGAB | chr15 | 67195667 | 67259661 |
| 67204044 | - | 8 | -0.9650 | -0.9650 | -0.9650 | 0.0000 | acceptor | a0002c0002t0003g0221 | HG00609.hp2 | HG00609.hp2 | AAGAB | chr15 | 67195667 | 67259661 |
| 67204148 | - | 8 | 0.8912 | 0.8912 | 0.8912 | 0.0000 | donor | a0002c0002t0003g0221 | HG00609.hp2 | HG00609.hp2 | AAGAB | chr15 | 67195667 | 67259661 |
| 67203548 | - | 9 | -0.6159 | -0.6159 | -0.6159 | 0.0000 | acceptor | a0002c0002t0003g0221 | HG00609.hp2 | HG00609.hp2 | AAGAB | chr15 | 67195667 | 67259661 |
| 67203597 | - | 9 | 0.6982 | 0.6982 | 0.6982 | 0.0000 | donor | a0002c0002t0003g0221 | HG00609.hp2 | HG00609.hp2 | AAGAB | chr15 | 67195667 | 67259661 |
| 67202898 | - | 10 | 0.8243 | 0.8243 | 0.8243 | 0.0000 | donor | a0002c0002t0003g0221 | HG00609.hp2 | HG00609.hp2 | AAGAB | chr15 | 67195667 | 67259661 |
| pos | annotationhgvs_chgvs_p | clinvarid | clnsig | geneinfo | mc | clndisdb | strand strand
|
ahapid ahapid_count
|
chapid chapid count
|
thapid thapid_count
|
ghapid ghapid_count
|
AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
impact | chr | ref | alt | external |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 67236212:splice 67236212:variant goto | c.362-144G>A | 1253044 | Benign | AAGAB:79719 | SO:0001627 intron_variant |
MedGen:C3661900 | - | 5 | 7 | 28 | 360 | a0001a0002a0003a0004a0005 | a0001c0001a0001c0003a0001c0004a0002c0002a0003c0005others(2): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004a0001c0001t0005a0001c0001t0006others(23): Show | a0001c0001t0001g0001a0001c0001t0001g0009a0001c0001t0001g0010a0001c0001t0001g0011a0001c0001t0001g0013others(355): Show | HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 HG00323.hp1 others(374): Show |
MODIFIER | chr15 | C | T | TogoVar |
| 67231547:splice 67231547:variant goto | c.535+267G>A | 1239423 | Benign | AAGAB:79719 | SO:0001627 intron_variant |
MedGen:C3661900 | - | 5 | 7 | 27 | 337 | a0001a0002a0003a0004a0005 | a0001c0001a0001c0003a0001c0004a0002c0002a0003c0005others(2): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0005a0001c0001t0006a0001c0001t0008others(22): Show | a0001c0001t0001g0001a0001c0001t0001g0009a0001c0001t0001g0010a0001c0001t0001g0011a0001c0001t0001g0013others(332): Show | HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 HG00323.hp1 others(351): Show |
MODIFIER | chr15 | C | T | TogoVar |
| 67254963:splice 67254963:variant goto | c.-332G>T | 1235883 | Benign | AAGAB:79719 IQCH:64799 |
SO:0001627 intron_variant |
MedGen:C3661900 | - | 2 | 2 | 6 | 109 | a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0020a0001c0001t0021a0002c0002t0001a0002c0002t0003a0002c0002t0007others(1): Show | a0001c0001t0020g0023a0001c0001t0021g0025a0002c0002t0001g0151a0002c0002t0003g0007a0002c0002t0003g0008others(104): Show | HG00280.hp2 HG00438.hp2 HG00544.hp2 HG00558.hp1 HG00609.hp2 others(106): Show |
MODIFIER | chr15 | C | A | TogoVar |
| 67208695:splice 67208695:variant goto | c.619-37C>T | 1257765 | Benign | AAGAB:79719 | SO:0001627 intron_variant |
MedGen:C3661900|MONDO:MONDO:0007858 MedGen:CN031225 OMIM:148600 Orphanet:79501 |
- | 2 | 2 | 4 | 107 | a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0020a0002c0002t0003a0002c0002t0007a0002c0002t0013 | a0001c0001t0020g0023a0002c0002t0003g0007a0002c0002t0003g0008a0002c0002t0003g0132a0002c0002t0003g0133others(102): Show | HG00280.hp2 HG00438.hp2 HG00544.hp2 HG00558.hp1 HG00609.hp2 others(104): Show |
MODIFIER | chr15 | G | A | TogoVar |
| 67236036:splice 67236036:variant goto | c.394A>Cp.Ile132Leu | 803103 | Benign | AAGAB:79719 | SO:0001583 missense_variant |
MONDO:MONDO:0007858 MedGen:CN031225 OMIM:148600 Orphanet:79501|MedGen:C3661900 |
- | 2 | 2 | 8 | 164 | a0002a0005 | a0002c0002a0005c0007 | a0002c0002t0001a0002c0002t0002a0002c0002t0003a0002c0002t0007a0002c0002t0012others(3): Show | a0002c0002t0001g0151a0002c0002t0001g0336a0002c0002t0002g0004a0002c0002t0002g0005a0002c0002t0002g0024others(159): Show | HG00280.hp2 HG00438.hp1 HG00438.hp2 HG00544.hp2 HG00558.hp1 others(163): Show |
MODERATE | chr15 | T | G | TogoVar |
| 67209254:splice 67209254:variant goto | c.618+208G>A | 1237371 | Benign | AAGAB:79719 | SO:0001627 intron_variant |
MedGen:C3661900 | - | 1 | 1 | 3 | 106 | a0002 | a0002c0002 | a0002c0002t0003a0002c0002t0007a0002c0002t0013 | a0002c0002t0003g0007a0002c0002t0003g0008a0002c0002t0003g0132a0002c0002t0003g0133a0002c0002t0003g0135others(101): Show | HG00280.hp2 HG00438.hp2 HG00544.hp2 HG00558.hp1 HG00609.hp2 others(103): Show |
MODIFIER | chr15 | C | T | TogoVar |
| 67202584:splice 67202584:variant goto | c.*237A>G | 1283054 | Benign | AAGAB:79719 | SO:0001624 3_prime_UTR_variant |
MedGen:C3661900 | - | 1 | 1 | 2 | 103 | a0002 | a0002c0002 | a0002c0002t0003a0002c0002t0013 | a0002c0002t0003g0007a0002c0002t0003g0008a0002c0002t0003g0132a0002c0002t0003g0133a0002c0002t0003g0135others(98): Show | HG00280.hp2 HG00438.hp2 HG00544.hp2 HG00558.hp1 HG00609.hp2 others(100): Show |
MODIFIER | chr15 | T | C | TogoVar |
| CHR:POS | annotationhgvs_chgvs_p | disease trait-log10podds or beta | AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
study | initial sample size/replication sample size | report genes | mapped gene | strongest snp risk allele | strand strand
|
impact | chr | ref | alt |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr15:67254963
|
c.-332G>T | Total body bone mineral density0.0519 | a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0020a0001c0001t0021a0002c0002t0001a0002c0002t0003a0002c0002t0007others(1): Show | a0001c0001t0020g0023a0001c0001t0021g0025a0002c0002t0001g0151a0002c0002t0003g0007a0002c0002t0003g0008others(104): Show | HG00280.hp2 HG00438.hp2 HG00544.hp2 HG00558.hp1 HG00609.hp2 others(106): Show |
Life-Course Genome-wide Association Study Meta-ana others(63): Show |
56,284 European ancestry individuals, up to 1,333 others(62): Show |
NR | IQCH, AAGAB | rs3743347-A | - | MODIFIER | chr15 | C | A |
|
chr15:67236036
|
c.394A>Cp.Ile132Leu | Cardiovascular disease | a0002a0005 | a0002c0002a0005c0007 | a0002c0002t0001a0002c0002t0002a0002c0002t0003a0002c0002t0007a0002c0002t0012others(3): Show | a0002c0002t0001g0151a0002c0002t0001g0336a0002c0002t0002g0004a0002c0002t0002g0005a0002c0002t0002g0024others(159): Show | HG00280.hp2 HG00438.hp1 HG00438.hp2 HG00544.hp2 HG00558.hp1 others(163): Show |
Leveraging Polygenic Functional Enrichment to Impr others(15): Show |
approximately 459,000 European ancestry individual others(2): Show |
AAGAB | rs7173826-? | - | MODERATE | chr15 | T | G | |
|
chr15:67236036
|
c.394A>Cp.Ile132Leu | Waist-hip index0.0193774 | a0002a0005 | a0002c0002a0005c0007 | a0002c0002t0001a0002c0002t0002a0002c0002t0003a0002c0002t0007a0002c0002t0012others(3): Show | a0002c0002t0001g0151a0002c0002t0001g0336a0002c0002t0002g0004a0002c0002t0002g0005a0002c0002t0002g0024others(159): Show | HG00280.hp2 HG00438.hp1 HG00438.hp2 HG00544.hp2 HG00558.hp1 others(163): Show |
GWAS of allometric body-shape indices in UK Bioban others(109): Show |
186,825 British ancestry men/ | AAGAB | AAGAB | rs7173826-G | - | MODERATE | chr15 | T | G |
|
chr15:67236036
|
c.394A>Cp.Ile132Leu | Waist circumference adjusted for body mass indexothers(17): Show | a0002a0005 | a0002c0002a0005c0007 | a0002c0002t0001a0002c0002t0002a0002c0002t0003a0002c0002t0007a0002c0002t0012others(3): Show | a0002c0002t0001g0151a0002c0002t0001g0336a0002c0002t0002g0004a0002c0002t0002g0005a0002c0002t0002g0024others(159): Show | HG00280.hp2 HG00438.hp1 HG00438.hp2 HG00544.hp2 HG00558.hp1 others(163): Show |
GWAS of allometric body-shape indices in UK Bioban others(109): Show |
186,825 British ancestry men/ | AAGAB | AAGAB | rs7173826-G | - | MODERATE | chr15 | T | G |
|
chr15:67236036
|
c.394A>Cp.Ile132Leu |
Waist-to-hip ratio adjusted for BMI0.018 others(4): Show |
a0002a0005 | a0002c0002a0005c0007 | a0002c0002t0001a0002c0002t0002a0002c0002t0003a0002c0002t0007a0002c0002t0012others(3): Show | a0002c0002t0001g0151a0002c0002t0001g0336a0002c0002t0002g0004a0002c0002t0002g0005a0002c0002t0002g0024others(159): Show | HG00280.hp2 HG00438.hp1 HG00438.hp2 HG00544.hp2 HG00558.hp1 others(163): Show |
GWAS of allometric body-shape indices in UK Bioban others(109): Show |
186,825 British ancestry men/ | AAGAB | AAGAB | rs7173826-G | - | MODERATE | chr15 | T | G |
|
chr15:67254963
|
c.-332G>T | FVC or gastro-oesophageal reflux disease (pleiotropy)others(13): Show | a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0020a0001c0001t0021a0002c0002t0001a0002c0002t0003a0002c0002t0007others(1): Show | a0001c0001t0020g0023a0001c0001t0021g0025a0002c0002t0001g0151a0002c0002t0003g0007a0002c0002t0003g0008others(104): Show | HG00280.hp2 HG00438.hp2 HG00544.hp2 HG00558.hp1 HG00609.hp2 others(106): Show |
Genetic and observational associations of lung fun others(93): Show |
400,102 European ancestry individuals with FVC mea others(82): Show |
IQCH, AAGAB | rs3743347-? | - | MODIFIER | chr15 | C | A | |
|
chr15:67207992
|
c.715+570A>G | FEV1 | a0002 | a0002c0002 | a0002c0002t0001a0002c0002t0003a0002c0002t0007a0002c0002t0013 | a0002c0002t0001g0151a0002c0002t0003g0007a0002c0002t0003g0008a0002c0002t0003g0132a0002c0002t0003g0133others(102): Show | HG00280.hp2 HG00438.hp2 HG00544.hp2 HG00558.hp1 HG00609.hp2 others(104): Show |
A genome-wide association study identifies distinc others(104): Show |
383,471 European ancestry individuals/ | AAGAB | rs4776905-? | - | MODIFIER | chr15 | T | C | |
|
chr15:67207992
|
c.715+570A>G | FVC | a0002 | a0002c0002 | a0002c0002t0001a0002c0002t0003a0002c0002t0007a0002c0002t0013 | a0002c0002t0001g0151a0002c0002t0003g0007a0002c0002t0003g0008a0002c0002t0003g0132a0002c0002t0003g0133others(102): Show | HG00280.hp2 HG00438.hp2 HG00544.hp2 HG00558.hp1 HG00609.hp2 others(104): Show |
A genome-wide association study identifies distinc others(104): Show |
383,471 European ancestry individuals/ | AAGAB | rs4776905-? | - | MODIFIER | chr15 | T | C | |
|
chr15:67243102
|
c.74-6282A>G | Estimated glomerular filtration rate (creatinine)others(14): Show | a0002 | a0002c0002 | a0002c0002t0001a0002c0002t0003a0002c0002t0013 | a0002c0002t0001g0151a0002c0002t0003g0007a0002c0002t0003g0008a0002c0002t0003g0132a0002c0002t0003g0133others(99): Show | HG00280.hp2 HG00438.hp2 HG00544.hp2 HG00558.hp1 HG00609.hp2 others(101): Show |
Epigenomic and transcriptomic analyses define core others(64): Show |
1,205,871 European ancestry individuals, 168,300 E others(384): Show |
AAGAB | rs12900708-C | - | MODIFIER | chr15 | T | C | |
|
chr15:67202584
|
c.*237A>G | Estimated glomerular filtration rate (creatinine)others(16): Show | a0002 | a0002c0002 | a0002c0002t0003a0002c0002t0013 | a0002c0002t0003g0007a0002c0002t0003g0008a0002c0002t0003g0132a0002c0002t0003g0133a0002c0002t0003g0135others(98): Show | HG00280.hp2 HG00438.hp2 HG00544.hp2 HG00558.hp1 HG00609.hp2 others(100): Show |
Discovery and prioritization of variants and genes others(49): Show |
1,004,040 European ancestry individuals, 165,726 E others(189): Show |
AAGAB | rs12148121-C | - | MODIFIER | chr15 | T | C | |
|
chr15:67198936
|
c.*3885G>T | Lung function (FVC)0.0228 | a0002 | a0002c0002 | a0002c0002t0003a0002c0002t0007a0002c0002t0013 | a0002c0002t0003g0007a0002c0002t0003g0008a0002c0002t0003g0132a0002c0002t0003g0133a0002c0002t0003g0135others(99): Show | HG00280.hp2 HG00438.hp2 HG00544.hp2 HG00558.hp1 HG00609.hp2 others(101): Show |
New genetic signals for lung function highlight pa others(89): Show |
321,047 European ancestry individuals/79,005 Europ others(24): Show |
AAGAB | SMAD3 - AAGAB | rs12917612-A | - | MODIFIER | chr15 | C | A |
|
chr15:67198936
|
c.*3885G>T | FEV10.0136 | a0002 | a0002c0002 | a0002c0002t0003a0002c0002t0007a0002c0002t0013 | a0002c0002t0003g0007a0002c0002t0003g0008a0002c0002t0003g0132a0002c0002t0003g0133a0002c0002t0003g0135others(99): Show | HG00280.hp2 HG00438.hp2 HG00544.hp2 HG00558.hp1 HG00609.hp2 others(101): Show |
New genetic signals for lung function highlight pa others(89): Show |
321,047 European ancestry individuals/79,005 Europ others(24): Show |
AAGAB | SMAD3 - AAGAB | rs12917612-A | - | MODIFIER | chr15 | C | A |
|
chr15:67198936
|
c.*3885G>T | Lung function (FEV1/FVC)0.0141 | a0002 | a0002c0002 | a0002c0002t0003a0002c0002t0007a0002c0002t0013 | a0002c0002t0003g0007a0002c0002t0003g0008a0002c0002t0003g0132a0002c0002t0003g0133a0002c0002t0003g0135others(99): Show | HG00280.hp2 HG00438.hp2 HG00544.hp2 HG00558.hp1 HG00609.hp2 others(101): Show |
New genetic signals for lung function highlight pa others(89): Show |
321,047 European ancestry individuals/79,005 Europ others(24): Show |
AAGAB | SMAD3 - AAGAB | rs12917612-A | - | MODIFIER | chr15 | C | A |
|
chr15:67218266
|
c.536-8722C>G | Whole body fat mass (UKB data field 23100)others(11): Show | a0002 | a0002c0002 | a0002c0002t0001a0002c0002t0003a0002c0002t0007a0002c0002t0013 | a0002c0002t0001g0151a0002c0002t0003g0007a0002c0002t0003g0008a0002c0002t0003g0132a0002c0002t0003g0133others(102): Show | HG00280.hp2 HG00438.hp2 HG00544.hp2 HG00558.hp1 HG00609.hp2 others(104): Show |
New role of fat-free mass in cancer risk linked wi others(26): Show |
337,196 European ancestry individuals/ | AAGAB | rs16950776-C | - | MODIFIER | chr15 | G | C | |
|
chr15:67236036
|
c.394A>Cp.Ile132Leu | A body shape index0.0195852 | a0002a0005 | a0002c0002a0005c0007 | a0002c0002t0001a0002c0002t0002a0002c0002t0003a0002c0002t0007a0002c0002t0012others(3): Show | a0002c0002t0001g0151a0002c0002t0001g0336a0002c0002t0002g0004a0002c0002t0002g0005a0002c0002t0002g0024others(159): Show | HG00280.hp2 HG00438.hp1 HG00438.hp2 HG00544.hp2 HG00558.hp1 others(163): Show |
GWAS of allometric body-shape indices in UK Bioban others(109): Show |
186,825 British ancestry men/ | AAGAB | AAGAB | rs7173826-G | - | MODERATE | chr15 | T | G |
|
chr15:67249841
|
c.73+4718G>C | Smoking initiation0.00959 | a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0006a0001c0001t0020a0002c0002t0001a0002c0002t0003a0002c0002t0007others(1): Show | a0001c0001t0006g0236a0001c0001t0006g0237a0001c0001t0006g0238a0001c0001t0020g0023a0002c0002t0001g0151others(106): Show | HG00280.hp2 HG00438.hp2 HG00544.hp2 HG00558.hp1 HG00609.hp2 others(108): Show |
Genetic diversity fuels gene discovery for tobacco others(17): Show |
3,382,012 European ancestry, East Asian ancestry, others(57): Show |
AAGAB | rs4776350-G | - | MODIFIER | chr15 | C | G | |
|
chr15:67250011
|
c.73+4548A>T | Smoking initiation0.00959 | a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0006a0001c0001t0020a0002c0002t0001a0002c0002t0003a0002c0002t0007others(1): Show | a0001c0001t0006g0236a0001c0001t0006g0237a0001c0001t0006g0238a0001c0001t0020g0023a0002c0002t0001g0151others(106): Show | HG00280.hp2 HG00438.hp2 HG00544.hp2 HG00558.hp1 HG00609.hp2 others(108): Show |
Genetic diversity fuels gene discovery for tobacco others(17): Show |
3,382,012 European ancestry, East Asian ancestry, others(57): Show |
AAGAB | rs4776909-A | - | MODIFIER | chr15 | T | A | |
|
chr15:67253554
|
c.73+1005C>T | Smoking initiation0.00961 | a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0006a0001c0001t0020a0002c0002t0001a0002c0002t0003a0002c0002t0007others(1): Show | a0001c0001t0006g0236a0001c0001t0006g0237a0001c0001t0006g0238a0001c0001t0020g0023a0002c0002t0001g0151others(106): Show | HG00280.hp2 HG00438.hp2 HG00544.hp2 HG00558.hp1 HG00609.hp2 others(108): Show |
Genetic diversity fuels gene discovery for tobacco others(17): Show |
3,382,012 European ancestry, East Asian ancestry, others(57): Show |
AAGAB | rs58074225-A | - | MODIFIER | chr15 | G | A | |
|
chr15:67254963
|
c.-332G>T |
Risk-taking behavior (multivariate analysis)< others(4): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0020a0001c0001t0021a0002c0002t0001a0002c0002t0003a0002c0002t0007others(1): Show | a0001c0001t0020g0023a0001c0001t0021g0025a0002c0002t0001g0151a0002c0002t0003g0007a0002c0002t0003g0008others(104): Show | HG00280.hp2 HG00438.hp2 HG00544.hp2 HG00558.hp1 HG00609.hp2 others(106): Show |
The Genetic and Neural Substrates of Externalizing others(10): Show |
1,506,537 European ancestry individuals/ | IQCH, AAGAB | rs3743347-? | - | MODIFIER | chr15 | C | A | |
|
chr15:67207139
|
c.715+1423T>G | Serum albumin levels0.0157 | a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0006a0001c0001t0020a0002c0002t0001a0002c0002t0002a0002c0002t0003others(2): Show | a0001c0001t0006g0236a0001c0001t0006g0237a0001c0001t0006g0238a0001c0001t0020g0023a0002c0002t0001g0151others(112): Show | HG00280.hp2 HG00438.hp2 HG00544.hp2 HG00558.hp1 HG00609.hp2 others(115): Show |
A cross-population atlas of genetic associations f others(24): Show |
315,268 European ancestry individuals, 120,539 Eas others(29): Show |
AAGAB | rs11071940-C | - | MODIFIER | chr15 | A | C |
