| geneid | 126767 |
|---|---|
| ensemblid | ENSG00000188984.12 |
| hgncid | 32037 |
| symbol | AADACL3 |
| name | arylacetamide deacetylase like 3 |
| refseq_nuc | NM_001103170.3 |
| refseq_prot | NP_001096640.2 |
| ensembl_nuc | ENST00000359318.8 |
| ensembl_prot | ENSP00000352268.6 |
| mane_status | MANE Select |
| chr | chr1 |
| start | 12716110 |
| end | 12728760 |
| strand | + |
| ver | v1.2 |
| region | chr1:12716110-12728760 |
| region5000 | chr1:12711110-12733760 |
| regionname0 | AADACL3_chr1_12716110_12728760 |
| regionname5000 | AADACL3_chr1_12711110_12733760 |
| chr:pos | ref | alt | af | annotation | impact | samples | AHAPIDS | ACHAPIDS | ACTHAPIDS | ACTGHAPIDS | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr1:12719616
|
C | T | 0.1620 | missense_variant | MODERATE | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(67): Show |
a0002a0003a0019 | a0002c0003a0002c0022a0003c0005others(2): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(8): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(20): Show | 70 | 432 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 2/4 | c.310C>T | p.Pro104Ser | 377/4055 | 310/1224 | 104/407 | ||
|
chr1:12725527
|
T | G | 0.2963 | missense_variant | MODERATE | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(125): Show |
a0002a0003a0004others(6): Show | a0002c0003a0002c0018a0002c0019others(14): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(35): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(58): Show | 128 | 432 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 4/4 | c.755T>G | p.Phe252Cys | 822/4055 | 755/1224 | 252/407 |
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr1:12719558
|
C | T | 0.1667 | synonymous_variant | LOW | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(69): Show |
a0002a0003a0019 | a0002c0003a0002c0020a0002c0022others(3): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(10): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(22): Show | 72 | 432 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 2/4 | c.252C>T | p.Asp84Asp | 319/4055 | 252/1224 | 84/407 |
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr1:12726103
|
G | A | 0.2269 | 3_prime_UTR_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(95): Show |
a0002a0003a0004others(2): Show | a0002c0003a0002c0018a0002c0019others(7): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(16): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(34): Show | 98 | 432 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 4/4 | c.*107G>A | 107 | |||||
|
chr1:12726306
|
C | T | 0.2732 | 3_prime_UTR_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(115): Show |
a0002a0003a0004others(4): Show | a0002c0003a0002c0018a0002c0019others(11): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(29): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(50): Show | 118 | 432 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 4/4 | c.*310C>T | 310 | |||||
|
chr1:12726396
|
T | C | 0.2732 | 3_prime_UTR_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(115): Show |
a0002a0003a0004others(4): Show | a0002c0003a0002c0018a0002c0019others(11): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(29): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(50): Show | 118 | 432 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 4/4 | c.*400T>C | 400 | |||||
|
chr1:12726450
|
G | A | 0.2732 | 3_prime_UTR_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(115): Show |
a0002a0003a0004others(4): Show | a0002c0003a0002c0018a0002c0019others(11): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(29): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(50): Show | 118 | 432 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 4/4 | c.*454G>A | 454 | |||||
|
chr1:12726477
|
A | G | 0.3495 | 3_prime_UTR_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(148): Show |
a0001a0002a0003others(10): Show | a0001c0012a0002c0003a0002c0018others(21): Show | a0001c0012t0008a0001c0012t0024a0002c0003t0003others(43): Show | a0001c0012t0008g0009a0001c0012t0008g0032a0001c0012t0008g0062others(71): Show | 151 | 432 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 4/4 | c.*481A>G | 481 | |||||
|
chr1:12727665
|
T | C | 0.2732 | 3_prime_UTR_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(115): Show |
a0002a0003a0004others(4): Show | a0002c0003a0002c0018a0002c0019others(11): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(29): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(50): Show | 118 | 432 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 4/4 | c.*1669T>C | 1669 | |||||
|
chr1:12727920
|
G | T | 0.9977 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00280.hp1 others(428): Show |
a0001a0002a0003others(17): Show | a0001c0001a0001c0002a0001c0012others(34): Show | a0001c0001t0001a0001c0001t0010a0001c0001t0013others(77): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(184): Show | 431 | 432 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 4/4 | c.*1924G>T | 1924 | |||||
|
chr1:12728013
|
G | A | 0.2732 | 3_prime_UTR_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(115): Show |
a0002a0003a0004others(4): Show | a0002c0003a0002c0018a0002c0019others(11): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(29): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(50): Show | 118 | 432 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 4/4 | c.*2017G>A | 2017 | |||||
|
chr1:12728439
|
A | G | 0.1806 | 3_prime_UTR_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(75): Show |
a0002a0003a0004others(1): Show | a0002c0003a0002c0018a0003c0005others(3): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(10): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(25): Show | 78 | 432 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 4/4 | c.*2443A>G | 2443 |
| chr:pos | ref | alt | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | af | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr1:12720019
|
T | A | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(148): Show |
a0001a0002a0003others(10): Show | a0001c0001a0001c0012a0002c0003others(22): Show | a0001c0001t0001a0001c0012t0008a0001c0012t0024others(44): Show | a0001c0001t0001g0102a0001c0001t0001g0110a0001c0001t0001g0111others(72): Show | 151 | 432 | 0.3495 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 2/3 | c.385+328T>A | ||||||
|
chr1:12721140
|
C | T | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(115): Show |
a0001a0002a0003others(5): Show | a0001c0001a0002c0003a0002c0018others(11): Show | a0001c0001t0001a0002c0003t0003a0002c0003t0005others(28): Show | a0001c0001t0001g0102a0001c0001t0001g0110a0001c0001t0001g0111others(51): Show | 118 | 432 | 0.2732 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 3/3 | c.449+194C>T | ||||||
|
chr1:12722072
|
T | C | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(148): Show |
a0001a0002a0003others(10): Show | a0001c0012a0002c0003a0002c0018others(21): Show | a0001c0012t0008a0001c0012t0024a0002c0003t0003others(43): Show | a0001c0012t0008g0009a0001c0012t0008g0032a0001c0012t0008g0062others(71): Show | 151 | 432 | 0.3495 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 3/3 | c.449+1126T>C | ||||||
|
chr1:12722340
|
AAAAAAAA others(3): Show |
A | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(97): Show |
a0002a0003a0004others(4): Show | a0002c0003a0002c0018a0003c0005others(8): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(25): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(43): Show | 100 | 432 | 0.2315 | -10 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 3/3 | c.449+1395_449+1404delAAAAAAAAAT | ||||||
|
chr1:12722535
|
C | A | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(148): Show |
a0001a0002a0003others(10): Show | a0001c0012a0002c0003a0002c0018others(21): Show | a0001c0012t0008a0001c0012t0024a0002c0003t0003others(43): Show | a0001c0012t0008g0009a0001c0012t0008g0032a0001c0012t0008g0062others(71): Show | 151 | 432 | 0.3495 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 3/3 | c.449+1589C>A | ||||||
|
chr1:12722999
|
T | A | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(125): Show |
a0002a0003a0004others(6): Show | a0002c0003a0002c0018a0002c0019others(14): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(35): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(58): Show | 128 | 432 | 0.2963 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 3/3 | c.449+2053T>A | ||||||
|
chr1:12723133
|
G | A | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(125): Show |
a0002a0003a0004others(6): Show | a0002c0003a0002c0018a0002c0019others(14): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(35): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(58): Show | 128 | 432 | 0.2963 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 3/3 | c.450-2089G>A | ||||||
|
chr1:12723175
|
C | G | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(126): Show |
a0002a0003a0004others(7): Show | a0002c0003a0002c0018a0002c0019others(15): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(36): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(59): Show | 129 | 432 | 0.2986 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 3/3 | c.450-2047C>G | ||||||
|
chr1:12723788
|
A | AT | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(115): Show |
a0001a0002a0003others(5): Show | a0001c0001a0002c0003a0002c0018others(12): Show | a0001c0001t0001a0002c0003t0003a0002c0003t0005others(29): Show | a0001c0001t0001g0120a0002c0003t0003g0004a0002c0003t0003g0005others(50): Show | 118 | 432 | 0.2732 | 1 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 3/3 | c.450-1422dupT | INFO_REALIGN_3_PRIME | |||||
|
chr1:12723864
|
ACTTCTGC others(19): Show |
A | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(115): Show |
a0002a0003a0004others(4): Show | a0002c0003a0002c0018a0002c0019others(11): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(29): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(50): Show | 118 | 432 | 0.2732 | -26 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 3/3 | c.450-1347_450-1322delCTGGGTTCAAGGGATTCTTCTGCCTC | INFO_REALIGN_3_PRIME | |||||
|
chr1:12724080
|
G | A | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(75): Show |
a0002a0003a0004others(1): Show | a0002c0003a0002c0018a0003c0005others(3): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(10): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(25): Show | 78 | 432 | 0.1806 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 3/3 | c.450-1142G>A | ||||||
|
chr1:12724265
|
A | G | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(115): Show |
a0002a0003a0004others(4): Show | a0002c0003a0002c0018a0002c0019others(11): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(29): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(50): Show | 118 | 432 | 0.2732 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 3/3 | c.450-957A>G | ||||||
|
chr1:12724362
|
C | T | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(75): Show |
a0002a0003a0004others(1): Show | a0002c0003a0002c0018a0003c0005others(3): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(10): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(25): Show | 78 | 432 | 0.1806 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 3/3 | c.450-860C>T | ||||||
|
chr1:12724722
|
T | G | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(125): Show |
a0002a0003a0004others(6): Show | a0002c0003a0002c0018a0002c0019others(14): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(35): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(58): Show | 128 | 432 | 0.2963 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 3/3 | c.450-500T>G | ||||||
|
chr1:12725126
|
G | T | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(85): Show |
a0002a0003a0004others(3): Show | a0002c0003a0002c0018a0003c0005others(6): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(16): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(33): Show | 88 | 432 | 0.2037 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 3/3 | c.450-96G>T |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
ahapid | alen | total | AFR | AMR | EAS | EUR | SAS | aseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AADACL3 | 0/0 | a0003 | 407 | 30 | 4 | 7 | 13 | 0 | 6 | subcellular location copy fasta | chr1 | 12711110 | 12733760 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
chapid | clen | total | AFR | AMR | EAS | EUR | SAS | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AADACL3 | 0/0 | c0005 | 1224 | 23 | 2 | 6 | 13 | 0 | 2 | copy fasta | chr1 | 12711110 | 12733760 |
| genename | grch38/chm13v2 | thapid | tlen | total | AFR | AMR | EAS | EUR | SAS | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AADACL3 | 0/0 | t0007 | 2832 | 13 | 5 | 7 | 1 | 0 | 0 | copy fasta | chr1 | 12711110 | 12733760 |
| genename | grch38/chm13v2 | ghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| AADACL3 | 0/1 | g0003 | 23 | 3 | 5 | 12 | 0 | 2 | chr1 | 12711110 | 12733760 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
achapid | total | AFR | AMR | EAS | EUR | SAS | clen | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AADACL3 | 0/0 | a0003c0005 | 23 | 2 | 6 | 13 | 0 | 2 | 1224 | copy fasta | chr1 | 12711110 | 12733760 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
acthapid | total | AFR | AMR | EAS | EUR | SAS | tlen | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AADACL3 | 0/0 | a0003c0005t0007 | 8 | 2 | 5 | 1 | 0 | 0 | 4055 | copy fasta | chr1 | 12711110 | 12733760 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
actghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| AADACL3 | 0/0 | a0003c0005t0007g0003 | 7 | 2 | 4 | 1 | 0 | 0 | chr1 | 12711110 | 12733760 |
Click to load Haplotype QTL data...
| pos | S. Strand |
E# Exon Number |
max | median | min | diff | type | haplotypeid | max_hap_list | min_hap_list | symbol | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 12716344 | + | 1 | -0.2814 | -0.2794 | -0.2794 | 0.0020 | acceptor | a0003c0005t0007g0003 | HG01167.hp1 HG01169.hp2 |
HG00639.hp1 HG01069.hp1 HG02895.hp2 HG02897.hp1 NA19060.hp2 |
AADACL3 | chr1 | 12711110 | 12733760 |
| 12719475 | + | 2 | 0.9703 | 0.9703 | 0.9703 | 0.0000 | donor | a0003c0005t0007g0003 | HG00639.hp1 HG01069.hp1 HG02895.hp2 HG02897.hp1 NA19060.hp2 |
HG01167.hp1 HG01169.hp2 |
AADACL3 | chr1 | 12711110 | 12733760 |
| 12719691 | + | 2 | -0.9570 | -0.9570 | -0.9570 | 0.0000 | acceptor | a0003c0005t0007g0003 | HG00639.hp1 HG01069.hp1 HG01167.hp1 HG01169.hp2 HG02895.hp2 others(2): Show |
HG00639.hp1 HG01069.hp1 HG01167.hp1 HG01169.hp2 HG02895.hp2 others(2): Show |
AADACL3 | chr1 | 12711110 | 12733760 |
| 12720883 | + | 3 | 0.7934 | 0.7934 | 0.7934 | 0.0000 | donor | a0003c0005t0007g0003 | HG00639.hp1 HG01069.hp1 HG01167.hp1 HG01169.hp2 HG02895.hp2 others(2): Show |
HG00639.hp1 HG01069.hp1 HG01167.hp1 HG01169.hp2 HG02895.hp2 others(2): Show |
AADACL3 | chr1 | 12711110 | 12733760 |
| 12720946 | + | 3 | -0.6563 | -0.6563 | -0.6563 | 0.0000 | acceptor | a0003c0005t0007g0003 | HG00639.hp1 HG01069.hp1 HG01167.hp1 HG01169.hp2 HG02895.hp2 others(2): Show |
HG00639.hp1 HG01069.hp1 HG01167.hp1 HG01169.hp2 HG02895.hp2 others(2): Show |
AADACL3 | chr1 | 12711110 | 12733760 |
| 12725222 | + | 4 | 0.9885 | 0.9885 | 0.9885 | 0.0000 | donor | a0003c0005t0007g0003 | HG00639.hp1 HG01069.hp1 HG01167.hp1 HG01169.hp2 HG02895.hp2 others(2): Show |
HG00639.hp1 HG01069.hp1 HG01167.hp1 HG01169.hp2 HG02895.hp2 others(2): Show |
AADACL3 | chr1 | 12711110 | 12733760 |
| pos | annotationhgvs_chgvs_p | clinvarid | clnsig | geneinfo | mc | clndisdb | strand strand
|
ahapid ahapid_count
|
chapid chapid count
|
thapid thapid_count
|
ghapid ghapid_count
|
AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
impact | chr | ref | alt | external |
|---|
| CHR:POS | annotationhgvs_chgvs_p | disease trait-log10podds or beta | AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
study | initial sample size/replication sample size | report genes | mapped gene | strongest snp risk allele | strand strand
|
impact | chr | ref | alt |
|---|
