| geneid | 126767 |
|---|---|
| ensemblid | ENSG00000188984.12 |
| hgncid | 32037 |
| symbol | AADACL3 |
| name | arylacetamide deacetylase like 3 |
| refseq_nuc | NM_001103170.3 |
| refseq_prot | NP_001096640.2 |
| ensembl_nuc | ENST00000359318.8 |
| ensembl_prot | ENSP00000352268.6 |
| mane_status | MANE Select |
| chr | chr1 |
| start | 12716110 |
| end | 12728760 |
| strand | + |
| ver | v1.2 |
| region | chr1:12716110-12728760 |
| region5000 | chr1:12711110-12733760 |
| regionname0 | AADACL3_chr1_12716110_12728760 |
| regionname5000 | AADACL3_chr1_12711110_12733760 |
| chr:pos | ref | alt | af | annotation | impact | samples | AHAPIDS | ACHAPIDS | ACTHAPIDS | ACTGHAPIDS | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr1:12725527
|
T | G | 0.2963 | missense_variant | MODERATE | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(125): Show |
a0002a0003a0004others(6): Show | a0002c0003a0002c0018a0002c0019others(14): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(35): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(58): Show | 128 | 432 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 4/4 | c.755T>G | p.Phe252Cys | 822/4055 | 755/1224 | 252/407 | ||
|
chr1:12725782
|
C | T | 0.0532 | missense_variant | MODERATE | HG00642.hp1 HG01106.hp1 HG01192.hp1 others(20): Show |
a0002a0005 | a0002c0019a0005c0006a0005c0014others(1): Show | a0002c0019t0017a0005c0006t0006a0005c0006t0017others(6): Show | a0002c0019t0017g0007a0005c0006t0006g0007a0005c0006t0006g0055others(9): Show | 23 | 432 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 4/4 | c.1010C>T | p.Pro337Leu | 1077/4055 | 1010/1224 | 337/407 |
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr1:12716341
|
T | A | 0.4074 | synonymous_variant | LOW | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(173): Show |
a0001a0002a0003others(11): Show | a0001c0002a0001c0012a0002c0003others(19): Show | a0001c0002t0001a0001c0002t0002a0001c0002t0009others(43): Show | a0001c0002t0001g0002a0001c0002t0001g0082a0001c0002t0002g0010others(89): Show | 176 | 432 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 1/4 | c.165T>A | p.Thr55Thr | 232/4055 | 165/1224 | 55/407 |
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr1:12726103
|
G | A | 0.2269 | 3_prime_UTR_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(95): Show |
a0002a0003a0004others(2): Show | a0002c0003a0002c0018a0002c0019others(7): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(16): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(34): Show | 98 | 432 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 4/4 | c.*107G>A | 107 | |||||
|
chr1:12726306
|
C | T | 0.2732 | 3_prime_UTR_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(115): Show |
a0002a0003a0004others(4): Show | a0002c0003a0002c0018a0002c0019others(11): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(29): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(50): Show | 118 | 432 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 4/4 | c.*310C>T | 310 | |||||
|
chr1:12726396
|
T | C | 0.2732 | 3_prime_UTR_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(115): Show |
a0002a0003a0004others(4): Show | a0002c0003a0002c0018a0002c0019others(11): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(29): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(50): Show | 118 | 432 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 4/4 | c.*400T>C | 400 | |||||
|
chr1:12726450
|
G | A | 0.2732 | 3_prime_UTR_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(115): Show |
a0002a0003a0004others(4): Show | a0002c0003a0002c0018a0002c0019others(11): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(29): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(50): Show | 118 | 432 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 4/4 | c.*454G>A | 454 | |||||
|
chr1:12726477
|
A | G | 0.3495 | 3_prime_UTR_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(148): Show |
a0001a0002a0003others(10): Show | a0001c0012a0002c0003a0002c0018others(21): Show | a0001c0012t0008a0001c0012t0024a0002c0003t0003others(43): Show | a0001c0012t0008g0009a0001c0012t0008g0032a0001c0012t0008g0062others(71): Show | 151 | 432 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 4/4 | c.*481A>G | 481 | |||||
|
chr1:12727665
|
T | C | 0.2732 | 3_prime_UTR_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(115): Show |
a0002a0003a0004others(4): Show | a0002c0003a0002c0018a0002c0019others(11): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(29): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(50): Show | 118 | 432 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 4/4 | c.*1669T>C | 1669 | |||||
|
chr1:12727920
|
G | T | 0.9977 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00280.hp1 others(428): Show |
a0001a0002a0003others(17): Show | a0001c0001a0001c0002a0001c0012others(34): Show | a0001c0001t0001a0001c0001t0010a0001c0001t0013others(77): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(184): Show | 431 | 432 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 4/4 | c.*1924G>T | 1924 | |||||
|
chr1:12728013
|
G | A | 0.2732 | 3_prime_UTR_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(115): Show |
a0002a0003a0004others(4): Show | a0002c0003a0002c0018a0002c0019others(11): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(29): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(50): Show | 118 | 432 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 4/4 | c.*2017G>A | 2017 |
| chr:pos | ref | alt | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | af | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr1:12717317
|
T | C | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(167): Show |
a0001a0002a0003others(11): Show | a0001c0002a0001c0012a0002c0003others(21): Show | a0001c0002t0001a0001c0002t0002a0001c0002t0009others(45): Show | a0001c0002t0001g0082a0001c0002t0002g0010a0001c0002t0002g0012others(86): Show | 170 | 432 | 0.3935 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 1/3 | c.168+973T>C | ||||||
|
chr1:12717928
|
C | T | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(160): Show |
a0001a0002a0003others(9): Show | a0001c0002a0001c0012a0002c0003others(18): Show | a0001c0002t0001a0001c0002t0002a0001c0002t0009others(39): Show | a0001c0002t0001g0082a0001c0002t0002g0010a0001c0002t0002g0012others(79): Show | 163 | 432 | 0.3773 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 1/3 | c.169-1547C>T | ||||||
|
chr1:12718342
|
A | G | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(165): Show |
a0001a0002a0003others(11): Show | a0001c0002a0001c0012a0002c0003others(21): Show | a0001c0002t0001a0001c0002t0002a0001c0002t0009others(44): Show | a0001c0002t0001g0082a0001c0002t0002g0010a0001c0002t0002g0012others(84): Show | 168 | 432 | 0.3889 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 1/3 | c.169-1133A>G | ||||||
|
chr1:12718359
|
CA | C | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(100): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0002a0002c0003others(16): Show | a0001c0001t0001a0001c0001t0010a0001c0001t0013others(31): Show | a0001c0001t0001g0131a0001c0001t0010g0132a0001c0001t0013g0133others(46): Show | 103 | 432 | 0.2384 | -1 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 1/3 | c.169-1093delA | INFO_REALIGN_3_PRIME | |||||
|
chr1:12718596
|
A | T | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(79): Show |
a0001a0002a0003others(1): Show | a0001c0002a0002c0003a0002c0004others(7): Show | a0001c0002t0002a0002c0003t0003a0002c0003t0005others(14): Show | a0001c0002t0002g0087a0002c0003t0003g0004a0002c0003t0003g0005others(28): Show | 82 | 432 | 0.1898 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 1/3 | c.169-879A>T | ||||||
|
chr1:12720019
|
T | A | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(148): Show |
a0001a0002a0003others(10): Show | a0001c0001a0001c0012a0002c0003others(22): Show | a0001c0001t0001a0001c0012t0008a0001c0012t0024others(44): Show | a0001c0001t0001g0102a0001c0001t0001g0110a0001c0001t0001g0111others(72): Show | 151 | 432 | 0.3495 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 2/3 | c.385+328T>A | ||||||
|
chr1:12721140
|
C | T | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(115): Show |
a0001a0002a0003others(5): Show | a0001c0001a0002c0003a0002c0018others(11): Show | a0001c0001t0001a0002c0003t0003a0002c0003t0005others(28): Show | a0001c0001t0001g0102a0001c0001t0001g0110a0001c0001t0001g0111others(51): Show | 118 | 432 | 0.2732 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 3/3 | c.449+194C>T | ||||||
|
chr1:12722072
|
T | C | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(148): Show |
a0001a0002a0003others(10): Show | a0001c0012a0002c0003a0002c0018others(21): Show | a0001c0012t0008a0001c0012t0024a0002c0003t0003others(43): Show | a0001c0012t0008g0009a0001c0012t0008g0032a0001c0012t0008g0062others(71): Show | 151 | 432 | 0.3495 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 3/3 | c.449+1126T>C | ||||||
|
chr1:12722341
|
AAAAAAAA others(2): Show |
A | intron_variant | MODIFIER | HG01106.hp1 HG01192.hp1 HG01243.hp1 others(20): Show |
a0002a0005a0007 | a0002c0019a0005c0006a0005c0014others(3): Show | a0002c0019t0017a0005c0006t0006a0005c0006t0017others(5): Show | a0002c0019t0017g0007a0005c0006t0006g0007a0005c0006t0017g0048others(7): Show | 23 | 432 | 0.0532 | -9 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 3/3 | c.449+1396_449+1404delAAAAAAAAT | ||||||
|
chr1:12722535
|
C | A | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(148): Show |
a0001a0002a0003others(10): Show | a0001c0012a0002c0003a0002c0018others(21): Show | a0001c0012t0008a0001c0012t0024a0002c0003t0003others(43): Show | a0001c0012t0008g0009a0001c0012t0008g0032a0001c0012t0008g0062others(71): Show | 151 | 432 | 0.3495 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 3/3 | c.449+1589C>A | ||||||
|
chr1:12722999
|
T | A | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(125): Show |
a0002a0003a0004others(6): Show | a0002c0003a0002c0018a0002c0019others(14): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(35): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(58): Show | 128 | 432 | 0.2963 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 3/3 | c.449+2053T>A | ||||||
|
chr1:12723133
|
G | A | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(125): Show |
a0002a0003a0004others(6): Show | a0002c0003a0002c0018a0002c0019others(14): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(35): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(58): Show | 128 | 432 | 0.2963 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 3/3 | c.450-2089G>A | ||||||
|
chr1:12723175
|
C | G | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(126): Show |
a0002a0003a0004others(7): Show | a0002c0003a0002c0018a0002c0019others(15): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(36): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(59): Show | 129 | 432 | 0.2986 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 3/3 | c.450-2047C>G | ||||||
|
chr1:12723788
|
A | AT | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(115): Show |
a0001a0002a0003others(5): Show | a0001c0001a0002c0003a0002c0018others(12): Show | a0001c0001t0001a0002c0003t0003a0002c0003t0005others(29): Show | a0001c0001t0001g0120a0002c0003t0003g0004a0002c0003t0003g0005others(50): Show | 118 | 432 | 0.2732 | 1 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 3/3 | c.450-1422dupT | INFO_REALIGN_3_PRIME | |||||
|
chr1:12723864
|
ACTTCTGC others(19): Show |
A | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(115): Show |
a0002a0003a0004others(4): Show | a0002c0003a0002c0018a0002c0019others(11): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(29): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(50): Show | 118 | 432 | 0.2732 | -26 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 3/3 | c.450-1347_450-1322delCTGGGTTCAAGGGATTCTTCTGCCTC | INFO_REALIGN_3_PRIME | |||||
|
chr1:12724165
|
G | A | intron_variant | MODIFIER | HG01106.hp1 HG01192.hp1 HG01243.hp1 others(17): Show |
a0002a0005 | a0002c0019a0005c0006a0005c0014others(1): Show | a0002c0019t0017a0005c0006t0006a0005c0006t0017others(3): Show | a0002c0019t0017g0007a0005c0006t0006g0007a0005c0006t0006g0055others(6): Show | 20 | 432 | 0.0463 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 3/3 | c.450-1057G>A | ||||||
|
chr1:12724265
|
A | G | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(115): Show |
a0002a0003a0004others(4): Show | a0002c0003a0002c0018a0002c0019others(11): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(29): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(50): Show | 118 | 432 | 0.2732 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 3/3 | c.450-957A>G | ||||||
|
chr1:12724722
|
T | G | intron_variant | MODIFIER | HG00323.hp1 HG00323.hp2 HG00423.hp1 others(125): Show |
a0002a0003a0004others(6): Show | a0002c0003a0002c0018a0002c0019others(14): Show | a0002c0003t0003a0002c0003t0005a0002c0003t0039others(35): Show | a0002c0003t0003g0004a0002c0003t0003g0005a0002c0003t0003g0136others(58): Show | 128 | 432 | 0.2963 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 3/3 | c.450-500T>G | ||||||
|
chr1:12724740
|
C | A | intron_variant | MODIFIER | HG00642.hp1 HG01106.hp1 HG01109.hp2 others(37): Show |
a0002a0004a0005others(2): Show | a0002c0018a0002c0019a0004c0007others(7): Show | a0002c0018t0047a0002c0019t0017a0004c0007t0012others(16): Show | a0002c0018t0047g0086a0002c0019t0017g0007a0004c0007t0012g0126others(22): Show | 40 | 432 | 0.0926 | 0 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 3/3 | c.450-482C>A | ||||||
|
chr1:12724969
|
ATT | A | intron_variant | MODIFIER | HG00642.hp1 HG01106.hp1 HG01109.hp2 others(37): Show |
a0002a0004a0005others(2): Show | a0002c0018a0002c0019a0004c0007others(7): Show | a0002c0018t0047a0002c0019t0017a0004c0007t0012others(16): Show | a0002c0018t0047g0086a0002c0019t0017g0007a0004c0007t0012g0126others(22): Show | 40 | 432 | 0.0926 | -2 | AADACL3 | ENSG00000188984.12 | transcript | ENST00000359318.8 | protein_coding | 3/3 | c.450-251_450-250delTT | INFO_REALIGN_3_PRIME |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
ahapid | alen | total | AFR | AMR | EAS | EUR | SAS | aseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AADACL3 | 0/0 | a0005 | 407 | 21 | 13 | 3 | 1 | 1 | 3 | subcellular location copy fasta | chr1 | 12711110 | 12733760 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
chapid | clen | total | AFR | AMR | EAS | EUR | SAS | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AADACL3 | 0/0 | c0006 | 1224 | 15 | 13 | 2 | 0 | 0 | 0 | copy fasta | chr1 | 12711110 | 12733760 |
| genename | grch38/chm13v2 | thapid | tlen | total | AFR | AMR | EAS | EUR | SAS | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AADACL3 | 0/0 | t0006 | 2832 | 15 | 8 | 2 | 1 | 1 | 3 | copy fasta | chr1 | 12711110 | 12733760 |
| genename | grch38/chm13v2 | ghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| AADACL3 | 0/0 | g0007 | 10 | 8 | 2 | 0 | 0 | 0 | chr1 | 12711110 | 12733760 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
achapid | total | AFR | AMR | EAS | EUR | SAS | clen | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AADACL3 | 0/0 | a0005c0006 | 15 | 13 | 2 | 0 | 0 | 0 | 1224 | copy fasta | chr1 | 12711110 | 12733760 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
acthapid | total | AFR | AMR | EAS | EUR | SAS | tlen | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AADACL3 | 0/0 | a0005c0006t0006 | 9 | 8 | 1 | 0 | 0 | 0 | 4055 | copy fasta | chr1 | 12711110 | 12733760 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
actghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| AADACL3 | 0/0 | a0005c0006t0006g0007 | 8 | 7 | 1 | 0 | 0 | 0 | chr1 | 12711110 | 12733760 |
Click to load Haplotype QTL data...
| pos | S. Strand |
E# Exon Number |
max | median | min | diff | type | haplotypeid | max_hap_list | min_hap_list | symbol | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 12716344 | + | 1 | -0.2872 | -0.2872 | -0.2872 | 0.0000 | acceptor | a0005c0006t0006g0007 | HG01243.hp1 HG01884.hp2 HG02280.hp1 HG02572.hp2 HG02630.hp2 others(3): Show |
HG01243.hp1 HG01884.hp2 HG02280.hp1 HG02572.hp2 HG02630.hp2 others(3): Show |
AADACL3 | chr1 | 12711110 | 12733760 |
| 12719475 | + | 2 | 0.9695 | 0.9695 | 0.9695 | 0.0000 | donor | a0005c0006t0006g0007 | HG01243.hp1 HG01884.hp2 HG02280.hp1 HG02572.hp2 HG02630.hp2 others(3): Show |
HG01243.hp1 HG01884.hp2 HG02280.hp1 HG02572.hp2 HG02630.hp2 others(3): Show |
AADACL3 | chr1 | 12711110 | 12733760 |
| 12719691 | + | 2 | -0.9696 | -0.9696 | -0.9696 | 0.0000 | acceptor | a0005c0006t0006g0007 | HG01243.hp1 HG01884.hp2 HG02280.hp1 HG02572.hp2 HG02630.hp2 others(3): Show |
HG01243.hp1 HG01884.hp2 HG02280.hp1 HG02572.hp2 HG02630.hp2 others(3): Show |
AADACL3 | chr1 | 12711110 | 12733760 |
| 12720883 | + | 3 | 0.7933 | 0.7933 | 0.7933 | 0.0000 | donor | a0005c0006t0006g0007 | HG01243.hp1 HG01884.hp2 HG02280.hp1 HG02572.hp2 HG02630.hp2 others(3): Show |
HG01243.hp1 HG01884.hp2 HG02280.hp1 HG02572.hp2 HG02630.hp2 others(3): Show |
AADACL3 | chr1 | 12711110 | 12733760 |
| 12720946 | + | 3 | -0.6612 | -0.6612 | -0.6612 | 0.0000 | acceptor | a0005c0006t0006g0007 | HG01243.hp1 HG01884.hp2 HG02280.hp1 HG02572.hp2 HG02630.hp2 others(3): Show |
HG01243.hp1 HG01884.hp2 HG02280.hp1 HG02572.hp2 HG02630.hp2 others(3): Show |
AADACL3 | chr1 | 12711110 | 12733760 |
| 12725222 | + | 4 | 0.9820 | 0.9820 | 0.9820 | 0.0000 | donor | a0005c0006t0006g0007 | HG01243.hp1 HG01884.hp2 HG02280.hp1 HG02572.hp2 HG02630.hp2 others(3): Show |
HG01243.hp1 HG01884.hp2 HG02280.hp1 HG02572.hp2 HG02630.hp2 others(3): Show |
AADACL3 | chr1 | 12711110 | 12733760 |
| pos | annotationhgvs_chgvs_p | clinvarid | clnsig | geneinfo | mc | clndisdb | strand strand
|
ahapid ahapid_count
|
chapid chapid count
|
thapid thapid_count
|
ghapid ghapid_count
|
AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
impact | chr | ref | alt | external |
|---|
| CHR:POS | annotationhgvs_chgvs_p | disease trait-log10podds or beta | AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
study | initial sample size/replication sample size | report genes | mapped gene | strongest snp risk allele | strand strand
|
impact | chr | ref | alt |
|---|