| geneid | 145447 |
|---|---|
| ensemblid | ENSG00000131969.15 |
| hgncid | 19837 |
| symbol | ABHD12B |
| name | abhydrolase domain containing 12B |
| refseq_nuc | NM_001206673.2 |
| refseq_prot | NP_001193602.1 |
| ensembl_nuc | ENST00000337334.7 |
| ensembl_prot | ENSP00000336693.2 |
| mane_status | MANE Select |
| chr | chr14 |
| start | 50872053 |
| end | 50904970 |
| strand | + |
| ver | v1.2 |
| region | chr14:50872053-50904970 |
| region5000 | chr14:50867053-50909970 |
| regionname0 | ABHD12B_chr14_50872053_50904970 |
| regionname5000 | ABHD12B_chr14_50867053_50909970 |
| chr:pos | ref | alt | af | annotation | impact | samples | AHAPIDS | ACHAPIDS | ACTHAPIDS | ACTGHAPIDS | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr14:50901892
|
A | G | 0.3484 | missense_variant | MODERATE | HG00408.hp2 HG00423.hp2 HG00438.hp2 others(128): Show |
a0002a0005a0009others(1): Show | a0002c0002a0002c0004a0005c0008others(2): Show | a0002c0002t0002a0002c0002t0005a0002c0002t0006others(9): Show | a0002c0002t0002g0001a0002c0002t0002g0003a0002c0002t0002g0009others(120): Show | 131 | 376 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 10/13 | c.844A>G | p.Ile282Val | 966/1815 | 844/1089 | 282/362 |
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr14:50885890
|
T | C | 0.1277 | synonymous_variant | LOW | HG00408.hp1 HG00423.hp1 HG00423.hp2 others(45): Show |
a0001a0002a0003others(1): Show | a0001c0006a0001c0011a0002c0004others(2): Show | a0001c0006t0001a0001c0006t0003a0001c0006t0013others(8): Show | a0001c0006t0001g0059a0001c0006t0001g0073a0001c0006t0001g0092others(43): Show | 48 | 376 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 7/13 | c.657T>C | p.Gly219Gly | 779/1815 | 657/1089 | 219/362 |
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr14:50872157
|
A | C | 0.9282 | 5_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(346): Show |
a0001a0002a0003others(6): Show | a0001c0001a0001c0005a0001c0006others(12): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0014others(23): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(326): Show | 349 | 376 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 1/13 | c.-18A>C | 18 | |||||
|
chr14:50904403
|
C | T | 0.3484 | 3_prime_UTR_variant | MODIFIER | HG00408.hp2 HG00423.hp2 HG00438.hp2 others(128): Show |
a0002a0005a0009others(1): Show | a0002c0002a0002c0004a0005c0008others(2): Show | a0002c0002t0002a0002c0002t0005a0002c0002t0006others(9): Show | a0002c0002t0002g0001a0002c0002t0002g0003a0002c0002t0002g0009others(120): Show | 131 | 376 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 13/13 | c.*37C>T | 37 | |||||
|
chr14:50904432
|
C | T | 0.3484 | 3_prime_UTR_variant | MODIFIER | HG00408.hp2 HG00423.hp2 HG00438.hp2 others(128): Show |
a0002a0005a0009others(1): Show | a0002c0002a0002c0004a0005c0008others(2): Show | a0002c0002t0002a0002c0002t0005a0002c0002t0006others(9): Show | a0002c0002t0002g0001a0002c0002t0002g0003a0002c0002t0002g0009others(120): Show | 131 | 376 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 13/13 | c.*66C>T | 66 | |||||
|
chr14:50904687
|
T | C | 0.0160 | 3_prime_UTR_variant | MODIFIER | HG02145.hp1 HG02280.hp2 HG02886.hp2 others(3): Show |
a0002a0009 | a0002c0002a0002c0004a0009c0017 | a0002c0002t0006a0002c0004t0006a0002c0004t0010others(1): Show | a0002c0002t0006g0317a0002c0004t0006g0023a0002c0004t0006g0169others(3): Show | 6 | 376 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 13/13 | c.*321T>C | 321 | |||||
|
chr14:50904729
|
C | T | 0.0452 | 3_prime_UTR_variant | MODIFIER | HG01261.hp2 HG01884.hp1 HG02145.hp1 others(14): Show |
a0002a0009 | a0002c0002a0002c0004a0009c0017 | a0002c0002t0005a0002c0002t0006a0002c0002t0011others(4): Show | a0002c0002t0005g0022a0002c0002t0005g0024a0002c0002t0005g0153others(14): Show | 17 | 376 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 13/13 | c.*363C>T | 363 |
| chr:pos | ref | alt | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | af | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr14:50873370
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(341): Show |
a0001a0002a0003others(6): Show | a0001c0001a0001c0005a0001c0006others(13): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(32): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(321): Show | 344 | 376 | 0.9149 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 1/12 | c.104+1092T>C | ||||||
|
chr14:50874609
|
T | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(355): Show |
a0001a0002a0003others(5): Show | a0001c0001a0001c0005a0001c0006others(12): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(31): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(335): Show | 358 | 376 | 0.9521 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 1/12 | c.104+2331T>A | ||||||
|
chr14:50875135
|
C | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(371): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0005a0001c0006others(14): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(35): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(350): Show | 374 | 376 | 0.9947 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 1/12 | c.105-2817C>G | ||||||
|
chr14:50875758
|
T | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(198): Show |
a0001a0002a0003others(5): Show | a0001c0001a0001c0005a0001c0006others(12): Show | a0001c0001t0001a0001c0001t0003a0001c0005t0004others(23): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(186): Show | 201 | 376 | 0.5346 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 1/12 | c.105-2194T>G | ||||||
|
chr14:50877759
|
T | A | intron_variant | MODIFIER | HG02280.hp2 HG02622.hp1 HG02886.hp2 others(1): Show |
a0001a0002 | a0001c0006a0002c0002a0002c0004 | a0001c0006t0001a0002c0002t0006a0002c0004t0006others(1): Show | a0001c0006t0001g0295a0002c0002t0006g0317a0002c0004t0006g0169others(1): Show | 4 | 376 | 0.0106 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 1/12 | c.105-193T>A | ||||||
|
chr14:50878956
|
A | G | intron_variant | MODIFIER | HG02280.hp2 HG02622.hp1 HG02886.hp2 others(1): Show |
a0001a0002 | a0001c0006a0002c0002a0002c0004 | a0001c0006t0001a0002c0002t0006a0002c0004t0006others(1): Show | a0001c0006t0001g0295a0002c0002t0006g0317a0002c0004t0006g0169others(1): Show | 4 | 376 | 0.0106 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 3/12 | c.335+109A>G | ||||||
|
chr14:50879011
|
C | G | intron_variant | MODIFIER | HG00280.hp2 HG00408.hp2 HG01167.hp2 others(35): Show |
a0001a0002a0003others(4): Show | a0001c0001a0001c0005a0001c0006others(7): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0032a0001c0001t0001g0162a0001c0001t0001g0296others(33): Show | 38 | 376 | 0.1011 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 3/12 | c.335+164C>G | ||||||
|
chr14:50879368
|
A | C | intron_variant | MODIFIER | HG02280.hp2 HG02622.hp1 HG02886.hp2 others(1): Show |
a0001a0002 | a0001c0006a0002c0002a0002c0004 | a0001c0006t0001a0002c0002t0006a0002c0004t0006others(1): Show | a0001c0006t0001g0295a0002c0002t0006g0317a0002c0004t0006g0169others(1): Show | 4 | 376 | 0.0106 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 3/12 | c.335+521A>C | ||||||
|
chr14:50879692
|
T | G | intron_variant | MODIFIER | HG02280.hp2 HG02622.hp1 HG02886.hp2 others(1): Show |
a0001a0002 | a0001c0006a0002c0002a0002c0004 | a0001c0006t0001a0002c0002t0006a0002c0004t0006others(1): Show | a0001c0006t0001g0295a0002c0002t0006g0317a0002c0004t0006g0169others(1): Show | 4 | 376 | 0.0106 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 3/12 | c.336-760T>G | ||||||
|
chr14:50881563
|
CT | C | intron_variant | MODIFIER | HG01884.hp1 HG02145.hp1 HG02280.hp2 others(12): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0006a0002c0002others(3): Show | a0001c0001t0001a0001c0006t0001a0002c0002t0005others(5): Show | a0001c0001t0001g0032a0001c0006t0001g0295a0002c0002t0005g0022others(12): Show | 15 | 376 | 0.0399 | -1 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 4/12 | c.456-16delT | INFO_REALIGN_3_PRIME | |||||
|
chr14:50882189
|
G | A | intron_variant | MODIFIER | HG02280.hp2 HG02622.hp1 HG02886.hp2 others(1): Show |
a0001a0002 | a0001c0006a0002c0002a0002c0004 | a0001c0006t0001a0002c0002t0006a0002c0004t0006others(1): Show | a0001c0006t0001g0295a0002c0002t0006g0317a0002c0004t0006g0169others(1): Show | 4 | 376 | 0.0106 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 5/12 | c.486+563G>A | ||||||
|
chr14:50883957
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(370): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0005a0001c0006others(14): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(35): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(349): Show | 373 | 376 | 0.9920 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 5/12 | c.487-1657T>C | ||||||
|
chr14:50884558
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(334): Show |
a0001a0002a0003others(6): Show | a0001c0001a0001c0005a0001c0006others(12): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(30): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(315): Show | 337 | 376 | 0.8963 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 5/12 | c.487-1056A>G | ||||||
|
chr14:50884684
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(358): Show |
a0001a0002a0003others(6): Show | a0001c0001a0001c0005a0001c0006others(13): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(33): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(337): Show | 361 | 376 | 0.9601 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 5/12 | c.487-930T>C | ||||||
|
chr14:50884702
|
CTTTTTTT | C | intron_variant | MODIFIER | HG00408.hp1 HG00423.hp1 HG00423.hp2 others(42): Show |
a0001a0002 | a0001c0001a0001c0005a0001c0006others(3): Show | a0001c0001t0001a0001c0001t0003a0001c0005t0004others(8): Show | a0001c0001t0001g0181a0001c0001t0001g0189a0001c0001t0001g0256others(40): Show | 45 | 376 | 0.1197 | -7 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 5/12 | c.487-886_487-880delTTTTTTT | INFO_REALIGN_3_PRIME | |||||
|
chr14:50884712
|
T | C | intron_variant | MODIFIER | HG00408.hp1 HG00423.hp1 HG00423.hp2 others(42): Show |
a0001a0002 | a0001c0001a0001c0005a0001c0006others(3): Show | a0001c0001t0001a0001c0001t0003a0001c0005t0004others(8): Show | a0001c0001t0001g0181a0001c0001t0001g0189a0001c0001t0001g0256others(40): Show | 45 | 376 | 0.1197 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 5/12 | c.487-902T>C | ||||||
|
chr14:50884715
|
T | C | intron_variant | MODIFIER | HG00408.hp1 HG00423.hp1 HG00423.hp2 others(42): Show |
a0001a0002 | a0001c0001a0001c0005a0001c0006others(3): Show | a0001c0001t0001a0001c0001t0003a0001c0005t0004others(8): Show | a0001c0001t0001g0181a0001c0001t0001g0189a0001c0001t0001g0256others(40): Show | 45 | 376 | 0.1197 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 5/12 | c.487-899T>C | ||||||
|
chr14:50884740
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(358): Show |
a0001a0002a0003others(6): Show | a0001c0001a0001c0005a0001c0006others(13): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(33): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(337): Show | 361 | 376 | 0.9601 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 5/12 | c.487-874A>G | ||||||
|
chr14:50885010
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(356): Show |
a0001a0002a0003others(6): Show | a0001c0001a0001c0005a0001c0006others(13): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(33): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(335): Show | 359 | 376 | 0.9548 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 5/12 | c.487-604G>A | ||||||
|
chr14:50885233
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(357): Show |
a0001a0002a0003others(6): Show | a0001c0001a0001c0005a0001c0006others(13): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(33): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(336): Show | 360 | 376 | 0.9575 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 5/12 | c.487-381A>G | ||||||
|
chr14:50885256
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(357): Show |
a0001a0002a0003others(6): Show | a0001c0001a0001c0005a0001c0006others(13): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(33): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(336): Show | 360 | 376 | 0.9575 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 5/12 | c.487-358G>A | ||||||
|
chr14:50885441
|
C | T | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(357): Show |
a0001a0002a0003others(6): Show | a0001c0001a0001c0005a0001c0006others(13): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(33): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(336): Show | 360 | 376 | 0.9575 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 5/12 | c.487-173C>T | ||||||
|
chr14:50886775
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(358): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0005a0001c0006others(14): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(34): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(337): Show | 361 | 376 | 0.9601 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 8/12 | c.700+91T>C | ||||||
|
chr14:50886938
|
C | T | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(358): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0005a0001c0006others(14): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(34): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(337): Show | 361 | 376 | 0.9601 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 8/12 | c.700+254C>T | ||||||
|
chr14:50886981
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(358): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0005a0001c0006others(14): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(34): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(337): Show | 361 | 376 | 0.9601 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 8/12 | c.700+297T>C | ||||||
|
chr14:50886986
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(358): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0005a0001c0006others(14): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(34): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(337): Show | 361 | 376 | 0.9601 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 8/12 | c.700+302T>C | ||||||
|
chr14:50887211
|
C | CAAAAAAA others(5): Show |
intron_variant | MODIFIER | HG00280.hp2 HG00408.hp2 HG01884.hp1 others(14): Show |
a0001a0002a0005others(1): Show | a0001c0001a0001c0006a0002c0002others(3): Show | a0001c0001t0001a0001c0001t0004a0001c0006t0001others(5): Show | a0001c0001t0001g0032a0001c0001t0004g0318a0001c0006t0001g0295others(14): Show | 17 | 376 | 0.0452 | 12 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 8/12 | c.700+534_700+545dupAAAAAAAAAAAA | INFO_REALIGN_3_PRIME | |||||
|
chr14:50887599
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(358): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0005a0001c0006others(14): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(34): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(337): Show | 361 | 376 | 0.9601 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 8/12 | c.700+915A>G | ||||||
|
chr14:50887603
|
C | T | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(370): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0005a0001c0006others(14): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(35): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(349): Show | 373 | 376 | 0.9920 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 8/12 | c.700+919C>T | ||||||
|
chr14:50887798
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(352): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0005a0001c0006others(14): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0014others(33): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(331): Show | 355 | 376 | 0.9442 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 8/12 | c.701-1026G>A | ||||||
|
chr14:50888313
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(353): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0005a0001c0006others(14): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0014others(33): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(332): Show | 356 | 376 | 0.9468 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 8/12 | c.701-511T>C | ||||||
|
chr14:50888328
|
C | T | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(353): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0005a0001c0006others(14): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0014others(33): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(332): Show | 356 | 376 | 0.9468 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 8/12 | c.701-496C>T | ||||||
|
chr14:50888452
|
G | T | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(370): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0005a0001c0006others(14): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(35): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(349): Show | 373 | 376 | 0.9920 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 8/12 | c.701-372G>T | ||||||
|
chr14:50889405
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(353): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0005a0001c0006others(14): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0014others(33): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(332): Show | 356 | 376 | 0.9468 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+502T>C | ||||||
|
chr14:50889503
|
C | T | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(370): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0005a0001c0006others(14): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(35): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(349): Show | 373 | 376 | 0.9920 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+600C>T | ||||||
|
chr14:50889516
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(353): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0005a0001c0006others(14): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0014others(33): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(332): Show | 356 | 376 | 0.9468 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+613T>C | ||||||
|
chr14:50889586
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(370): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0005a0001c0006others(14): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(35): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(349): Show | 373 | 376 | 0.9920 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+683T>C | ||||||
|
chr14:50890668
|
T | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(353): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0005a0001c0006others(14): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0014others(33): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(332): Show | 356 | 376 | 0.9468 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+1765T>G | ||||||
|
chr14:50890683
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(353): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0005a0001c0006others(14): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0014others(33): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(332): Show | 356 | 376 | 0.9468 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+1780A>G | ||||||
|
chr14:50890875
|
C | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(354): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0005a0001c0006others(14): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0014others(34): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(333): Show | 357 | 376 | 0.9495 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+1972C>A | ||||||
|
chr14:50890977
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(354): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0005a0001c0006others(14): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0014others(34): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(333): Show | 357 | 376 | 0.9495 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+2074A>G | ||||||
|
chr14:50891237
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(353): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0005a0001c0006others(14): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0014others(33): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(332): Show | 356 | 376 | 0.9468 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+2334T>C | ||||||
|
chr14:50891250
|
CT | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(367): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0005a0001c0006others(14): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(34): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(346): Show | 370 | 376 | 0.9840 | -1 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+2357delT | INFO_REALIGN_3_PRIME | |||||
|
chr14:50891336
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(367): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0005a0001c0006others(14): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(33): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(346): Show | 370 | 376 | 0.9840 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+2433G>A | ||||||
|
chr14:50891469
|
T | A | intron_variant | MODIFIER | HG00280.hp2 HG00408.hp2 HG00423.hp1 others(87): Show |
a0001a0002a0004others(5): Show | a0001c0001a0001c0006a0001c0011others(10): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0014others(19): Show | a0001c0001t0001g0025a0001c0001t0001g0102a0001c0001t0001g0119others(81): Show | 90 | 376 | 0.2394 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+2566T>A | ||||||
|
chr14:50892076
|
C | T | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(207): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0005a0001c0006others(8): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(23): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(196): Show | 210 | 376 | 0.5585 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+3173C>T | ||||||
|
chr14:50892113
|
A | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(363): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0005a0001c0006others(14): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(35): Show | a0001c0001t0001g0004a0001c0001t0001g0006a0001c0001t0001g0007others(342): Show | 366 | 376 | 0.9734 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+3210A>C | ||||||
|
chr14:50892505
|
C | T | intron_variant | MODIFIER | HG00408.hp2 HG00423.hp2 HG00438.hp2 others(116): Show |
a0001a0002a0003others(4): Show | a0001c0001a0001c0005a0001c0006others(8): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(17): Show | a0001c0001t0001g0031a0001c0001t0001g0105a0001c0001t0001g0207others(109): Show | 119 | 376 | 0.3165 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+3602C>T | ||||||
|
chr14:50893044
|
C | T | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+4141C>T | ||||||
|
chr14:50893128
|
C | T | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+4225C>T | ||||||
|
chr14:50893133
|
G | A | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+4230G>A | ||||||
|
chr14:50893217
|
C | A | intron_variant | MODIFIER | HG00280.hp2 HG00408.hp1 HG00408.hp2 others(204): Show |
a0001a0002a0003others(5): Show | a0001c0001a0001c0005a0001c0006others(12): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(29): Show | a0001c0001t0001g0018a0001c0001t0001g0031a0001c0001t0001g0034others(191): Show | 207 | 376 | 0.5505 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+4314C>A | ||||||
|
chr14:50893520
|
C | T | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+4617C>T | ||||||
|
chr14:50893603
|
G | A | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+4700G>A | ||||||
|
chr14:50893638
|
G | C | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+4735G>C | ||||||
|
chr14:50893640
|
C | T | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+4737C>T | ||||||
|
chr14:50893826
|
A | G | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+4923A>G | ||||||
|
chr14:50893985
|
A | G | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+5082A>G | ||||||
|
chr14:50894147
|
GAGGGGCA others(57): Show |
G | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(24): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(24): Show | 27 | 376 | 0.0718 | -64 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+5278_780+5341delTCCTTAGTGGCAAGTCCCGCTTTCCTGGGGCAGGGGCAAGTACCCCTCAACCCCTTCTCCTTCA | INFO_REALIGN_3_PRIME | |||||
|
chr14:50894302
|
T | C | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(20): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0004a0001c0006t0013others(9): Show | a0001c0001t0001g0182a0001c0001t0004g0318a0001c0006t0013g0028others(20): Show | 23 | 376 | 0.0612 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+5399T>C | ||||||
|
chr14:50894394
|
C | G | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+5491C>G | ||||||
|
chr14:50894533
|
T | C | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+5630T>C | ||||||
|
chr14:50894732
|
C | A | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+5829C>A | ||||||
|
chr14:50894782
|
C | T | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+5879C>T | ||||||
|
chr14:50894800
|
G | A | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+5897G>A | ||||||
|
chr14:50894838
|
G | A | intron_variant | MODIFIER | HG00280.hp2 HG00408.hp1 HG00408.hp2 others(207): Show |
a0001a0002a0003others(5): Show | a0001c0001a0001c0005a0001c0006others(12): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(29): Show | a0001c0001t0001g0018a0001c0001t0001g0031a0001c0001t0001g0034others(194): Show | 210 | 376 | 0.5585 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+5935G>A | ||||||
|
chr14:50894851
|
C | CTTCCTCC others(8): Show |
intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 15 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+5948_780+5949insTTCCTCCCCAGGTTG | ||||||
|
chr14:50894852
|
C | T | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+5949C>T | ||||||
|
chr14:50894874
|
C | T | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+5971C>T | ||||||
|
chr14:50894876
|
T | C | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+5973T>C | ||||||
|
chr14:50894895
|
T | C | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+5992T>C | ||||||
|
chr14:50894923
|
G | A | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+6020G>A | ||||||
|
chr14:50894947
|
T | C | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(25): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(25): Show | 28 | 376 | 0.0745 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+6044T>C | ||||||
|
chr14:50895021
|
T | C | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+6118T>C | ||||||
|
chr14:50895029
|
T | C | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+6126T>C | ||||||
|
chr14:50895067
|
A | G | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+6164A>G | ||||||
|
chr14:50895074
|
A | G | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+6171A>G | ||||||
|
chr14:50895132
|
G | A | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+6229G>A | ||||||
|
chr14:50895180
|
C | T | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(25): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(10): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(25): Show | 28 | 376 | 0.0745 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+6277C>T | ||||||
|
chr14:50895181
|
A | G | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+6278A>G | ||||||
|
chr14:50895208
|
G | C | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+6305G>C | ||||||
|
chr14:50895219
|
C | T | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+6316C>T | ||||||
|
chr14:50895248
|
G | A | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+6345G>A | ||||||
|
chr14:50895252
|
C | T | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+6349C>T | ||||||
|
chr14:50895305
|
A | C | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.780+6402A>C | ||||||
|
chr14:50895490
|
C | T | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.781-6339C>T | ||||||
|
chr14:50895592
|
C | T | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.781-6237C>T | ||||||
|
chr14:50895636
|
C | T | intron_variant | MODIFIER | HG01261.hp2 HG01361.hp2 HG01884.hp1 others(26): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0006a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(11): Show | a0001c0001t0001g0031a0001c0001t0001g0182a0001c0001t0001g0207others(26): Show | 29 | 376 | 0.0771 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.781-6193C>T | ||||||
|
chr14:50896782
|
T | A | intron_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00408.hp1 others(100): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0005a0001c0006others(9): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(23): Show | a0001c0001t0001g0018a0001c0001t0001g0031a0001c0001t0001g0034others(95): Show | 103 | 376 | 0.2739 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.781-5047T>A | ||||||
|
chr14:50896789
|
G | T | intron_variant | MODIFIER | HG00280.hp2 HG00408.hp1 HG00408.hp2 others(209): Show |
a0001a0002a0003others(5): Show | a0001c0001a0001c0005a0001c0006others(12): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(29): Show | a0001c0001t0001g0018a0001c0001t0001g0031a0001c0001t0001g0034others(196): Show | 212 | 376 | 0.5638 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.781-5040G>T | ||||||
|
chr14:50896864
|
C | A | intron_variant | MODIFIER | HG01261.hp2 HG01884.hp1 HG02145.hp1 others(17): Show |
a0002a0003a0004others(1): Show | a0002c0002a0002c0004a0003c0003others(2): Show | a0002c0002t0005a0002c0002t0006a0002c0002t0011others(6): Show | a0002c0002t0005g0022a0002c0002t0005g0024a0002c0002t0005g0153others(17): Show | 20 | 376 | 0.0532 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.781-4965C>A | ||||||
|
chr14:50897071
|
GTT | G | intron_variant | MODIFIER | HG00280.hp2 HG00408.hp1 HG00408.hp2 others(210): Show |
a0001a0002a0003others(5): Show | a0001c0001a0001c0005a0001c0006others(12): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(29): Show | a0001c0001t0001g0018a0001c0001t0001g0031a0001c0001t0001g0034others(197): Show | 213 | 376 | 0.5665 | -2 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.781-4741_781-4740delTT | INFO_REALIGN_3_PRIME | |||||
|
chr14:50897112
|
A | G | intron_variant | MODIFIER | HG00280.hp2 HG00408.hp1 HG00423.hp1 others(105): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0005a0001c0006others(9): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(23): Show | a0001c0001t0001g0018a0001c0001t0001g0025a0001c0001t0001g0031others(100): Show | 108 | 376 | 0.2872 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.781-4717A>G | ||||||
|
chr14:50897640
|
T | C | intron_variant | MODIFIER | HG01261.hp2 HG01884.hp1 HG02145.hp1 others(16): Show |
a0002a0004a0009 | a0002c0002a0002c0004a0004c0007others(1): Show | a0002c0002t0005a0002c0002t0006a0002c0002t0011others(5): Show | a0002c0002t0005g0022a0002c0002t0005g0024a0002c0002t0005g0153others(16): Show | 19 | 376 | 0.0505 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.781-4189T>C | ||||||
|
chr14:50897764
|
G | A | intron_variant | MODIFIER | HG01261.hp2 HG01884.hp1 HG02145.hp1 others(16): Show |
a0002a0004a0009 | a0002c0002a0002c0004a0004c0007others(1): Show | a0002c0002t0005a0002c0002t0006a0002c0002t0011others(5): Show | a0002c0002t0005g0022a0002c0002t0005g0024a0002c0002t0005g0153others(16): Show | 19 | 376 | 0.0505 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.781-4065G>A | ||||||
|
chr14:50897801
|
T | A | intron_variant | MODIFIER | HG02886.hp2 HG03139.hp1 NA19240.hp2 others(1): Show |
a0002a0004 | a0002c0004a0004c0007 | a0002c0004t0006a0002c0004t0010a0004c0007t0001 | a0002c0004t0006g0169a0002c0004t0010g0205a0004c0007t0001g0167others(1): Show | 4 | 376 | 0.0106 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.781-4028T>A | ||||||
|
chr14:50898630
|
C | T | intron_variant | MODIFIER | HG00408.hp2 HG00423.hp2 HG00438.hp2 others(125): Show |
a0001a0002a0003others(4): Show | a0001c0001a0002c0002a0002c0004others(5): Show | a0001c0001t0001a0002c0002t0002a0002c0002t0005others(12): Show | a0001c0001t0001g0105a0002c0002t0002g0001a0002c0002t0002g0003others(117): Show | 128 | 376 | 0.3404 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.781-3199C>T | ||||||
|
chr14:50899013
|
C | T | intron_variant | MODIFIER | HG00408.hp2 HG00423.hp2 HG00438.hp2 others(125): Show |
a0001a0002a0003others(4): Show | a0001c0001a0002c0002a0002c0004others(5): Show | a0001c0001t0001a0002c0002t0002a0002c0002t0005others(12): Show | a0001c0001t0001g0105a0002c0002t0002g0001a0002c0002t0002g0003others(117): Show | 128 | 376 | 0.3404 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.781-2816C>T | ||||||
|
chr14:50899031
|
A | G | intron_variant | MODIFIER | HG00408.hp2 HG00423.hp2 HG00438.hp2 others(125): Show |
a0001a0002a0003others(4): Show | a0001c0001a0002c0002a0002c0004others(5): Show | a0001c0001t0001a0002c0002t0002a0002c0002t0005others(12): Show | a0001c0001t0001g0105a0002c0002t0002g0001a0002c0002t0002g0003others(117): Show | 128 | 376 | 0.3404 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.781-2798A>G | ||||||
|
chr14:50899140
|
C | T | intron_variant | MODIFIER | HG00408.hp2 HG00423.hp2 HG00438.hp2 others(125): Show |
a0001a0002a0003others(4): Show | a0001c0001a0002c0002a0002c0004others(5): Show | a0001c0001t0001a0002c0002t0002a0002c0002t0005others(12): Show | a0001c0001t0001g0105a0002c0002t0002g0001a0002c0002t0002g0003others(117): Show | 128 | 376 | 0.3404 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.781-2689C>T | ||||||
|
chr14:50899242
|
A | C | intron_variant | MODIFIER | HG02886.hp2 HG03139.hp1 NA19240.hp2 others(1): Show |
a0002a0004 | a0002c0004a0004c0007 | a0002c0004t0006a0002c0004t0010a0004c0007t0001 | a0002c0004t0006g0169a0002c0004t0010g0205a0004c0007t0001g0167others(1): Show | 4 | 376 | 0.0106 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.781-2587A>C | ||||||
|
chr14:50899857
|
C | T | intron_variant | MODIFIER | HG00408.hp2 HG00423.hp2 HG00438.hp2 others(124): Show |
a0002a0005a0009others(1): Show | a0002c0002a0002c0004a0005c0008others(2): Show | a0002c0002t0002a0002c0002t0005a0002c0002t0006others(9): Show | a0002c0002t0002g0001a0002c0002t0002g0003a0002c0002t0002g0009others(116): Show | 127 | 376 | 0.3378 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.781-1972C>T | ||||||
|
chr14:50899901
|
A | G | intron_variant | MODIFIER | HG00408.hp2 HG00423.hp2 HG00438.hp2 others(130): Show |
a0001a0002a0003others(4): Show | a0001c0001a0002c0002a0002c0004others(5): Show | a0001c0001t0001a0002c0002t0002a0002c0002t0005others(12): Show | a0001c0001t0001g0025a0001c0001t0001g0182a0002c0002t0002g0001others(122): Show | 133 | 376 | 0.3537 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.781-1928A>G | ||||||
|
chr14:50900145
|
C | T | intron_variant | MODIFIER | HG00408.hp2 HG00423.hp2 HG00438.hp2 others(126): Show |
a0002a0005a0009others(1): Show | a0002c0002a0002c0004a0005c0008others(2): Show | a0002c0002t0002a0002c0002t0005a0002c0002t0006others(9): Show | a0002c0002t0002g0001a0002c0002t0002g0003a0002c0002t0002g0009others(118): Show | 129 | 376 | 0.3431 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.781-1684C>T | ||||||
|
chr14:50901511
|
A | AT | intron_variant | MODIFIER | HG00408.hp2 HG00423.hp2 HG00438.hp2 others(128): Show |
a0002a0005a0009others(1): Show | a0002c0002a0002c0004a0005c0008others(2): Show | a0002c0002t0002a0002c0002t0005a0002c0002t0006others(9): Show | a0002c0002t0002g0001a0002c0002t0002g0003a0002c0002t0002g0009others(120): Show | 131 | 376 | 0.3484 | 1 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.781-314dupT | INFO_REALIGN_3_PRIME | |||||
|
chr14:50901777
|
G | A | intron_variant | MODIFIER | HG00408.hp2 HG00423.hp2 HG00438.hp2 others(128): Show |
a0002a0005a0009others(1): Show | a0002c0002a0002c0004a0005c0008others(2): Show | a0002c0002t0002a0002c0002t0005a0002c0002t0006others(9): Show | a0002c0002t0002g0001a0002c0002t0002g0003a0002c0002t0002g0009others(120): Show | 131 | 376 | 0.3484 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 9/12 | c.781-52G>A | ||||||
|
chr14:50902038
|
T | A | intron_variant | MODIFIER | HG00408.hp2 HG00423.hp2 HG00438.hp2 others(128): Show |
a0002a0005a0009others(1): Show | a0002c0002a0002c0004a0005c0008others(2): Show | a0002c0002t0002a0002c0002t0005a0002c0002t0006others(9): Show | a0002c0002t0002g0001a0002c0002t0002g0003a0002c0002t0002g0009others(120): Show | 131 | 376 | 0.3484 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 10/12 | c.863+127T>A | ||||||
|
chr14:50902202
|
CT | C | intron_variant | MODIFIER | HG00280.hp2 HG00408.hp1 HG00408.hp2 others(215): Show |
a0001a0002a0004others(4): Show | a0001c0001a0001c0005a0001c0006others(10): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(27): Show | a0001c0001t0001g0018a0001c0001t0001g0031a0001c0001t0001g0034others(202): Show | 218 | 376 | 0.5798 | -1 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 10/12 | c.863+293delT | INFO_REALIGN_3_PRIME | |||||
|
chr14:50902294
|
G | A | intron_variant | MODIFIER | HG01261.hp2 HG01884.hp1 HG02145.hp1 others(14): Show |
a0002a0009 | a0002c0002a0002c0004a0009c0017 | a0002c0002t0005a0002c0002t0006a0002c0002t0011others(4): Show | a0002c0002t0005g0022a0002c0002t0005g0024a0002c0002t0005g0153others(14): Show | 17 | 376 | 0.0452 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 10/12 | c.863+383G>A | ||||||
|
chr14:50902322
|
A | T | intron_variant | MODIFIER | HG01261.hp2 HG01884.hp1 HG02145.hp1 others(14): Show |
a0002a0009 | a0002c0002a0002c0004a0009c0017 | a0002c0002t0005a0002c0002t0006a0002c0002t0011others(4): Show | a0002c0002t0005g0022a0002c0002t0005g0024a0002c0002t0005g0153others(14): Show | 17 | 376 | 0.0452 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 10/12 | c.863+411A>T | ||||||
|
chr14:50902433
|
G | A | intron_variant | MODIFIER | HG00408.hp2 HG00423.hp2 HG00438.hp2 others(128): Show |
a0002a0005a0009others(1): Show | a0002c0002a0002c0004a0005c0008others(2): Show | a0002c0002t0002a0002c0002t0005a0002c0002t0006others(9): Show | a0002c0002t0002g0001a0002c0002t0002g0003a0002c0002t0002g0009others(120): Show | 131 | 376 | 0.3484 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 10/12 | c.863+522G>A | ||||||
|
chr14:50902908
|
C | T | intron_variant | MODIFIER | HG02886.hp2 NA20129.hp1 |
a0002 | a0002c0004 | a0002c0004t0006a0002c0004t0010 | a0002c0004t0006g0169a0002c0004t0010g0205 | 2 | 376 | 0.0053 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 10/12 | c.864-481C>T | ||||||
|
chr14:50903110
|
GTTTTTT | G | intron_variant | MODIFIER | HG00408.hp2 HG00423.hp2 HG00438.hp2 others(128): Show |
a0002a0005a0009others(1): Show | a0002c0002a0002c0004a0005c0008others(2): Show | a0002c0002t0002a0002c0002t0005a0002c0002t0006others(9): Show | a0002c0002t0002g0001a0002c0002t0002g0003a0002c0002t0002g0009others(120): Show | 131 | 376 | 0.3484 | -6 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 10/12 | c.864-272_864-267delTTTTTT | INFO_REALIGN_3_PRIME | |||||
|
chr14:50903821
|
A | G | intron_variant | MODIFIER | HG00408.hp2 HG00423.hp2 HG00438.hp2 others(128): Show |
a0002a0005a0009others(1): Show | a0002c0002a0002c0004a0005c0008others(2): Show | a0002c0002t0002a0002c0002t0005a0002c0002t0006others(9): Show | a0002c0002t0002g0001a0002c0002t0002g0003a0002c0002t0002g0009others(120): Show | 131 | 376 | 0.3484 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 11/12 | c.943-253A>G | ||||||
|
chr14:50904066
|
G | C | splice_region_variant others(1): Show |
LOW | HG00408.hp2 HG00423.hp2 HG00438.hp2 others(128): Show |
a0002a0005a0009others(1): Show | a0002c0002a0002c0004a0005c0008others(2): Show | a0002c0002t0002a0002c0002t0005a0002c0002t0006others(9): Show | a0002c0002t0002g0001a0002c0002t0002g0003a0002c0002t0002g0009others(120): Show | 131 | 376 | 0.3484 | 0 | ABHD12B | ENSG00000131969.15 | transcript | ENST00000337334.7 | protein_coding | 11/12 | c.943-8G>C |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
ahapid | alen | total | AFR | AMR | EAS | EUR | SAS | aseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABHD12B | 0/0 | a0002 | 362 | 116 | 19 | 14 | 71 | 3 | 9 | subcellular location copy fasta | chr14 | 50867053 | 50909970 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
chapid | clen | total | AFR | AMR | EAS | EUR | SAS | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABHD12B | 0/0 | c0004 | 1089 | 27 | 6 | 3 | 18 | 0 | 0 | copy fasta | chr14 | 50867053 | 50909970 |
| genename | grch38/chm13v2 | thapid | tlen | total | AFR | AMR | EAS | EUR | SAS | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABHD12B | 0/0 | t0006 | 727 | 5 | 5 | 0 | 0 | 0 | 0 | copy fasta | chr14 | 50867053 | 50909970 |
| genename | grch38/chm13v2 | ghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| ABHD12B | 0/0 | g0169 | 1 | 1 | 0 | 0 | 0 | 0 | chr14 | 50867053 | 50909970 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
achapid | total | AFR | AMR | EAS | EUR | SAS | clen | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABHD12B | 0/0 | a0002c0004 |