| geneid | 29 |
|---|---|
| ensemblid | ENSG00000159842.16 |
| hgncid | 81 |
| symbol | ABR |
| name | ABR activator of RhoGEF and GTPase |
| refseq_nuc | NM_021962.5 |
| refseq_prot | NP_068781.2 |
| ensembl_nuc | ENST00000302538.10 |
| ensembl_prot | ENSP00000303909.5 |
| mane_status | MANE Select |
| chr | chr17 |
| start | 1003519 |
| end | 1179981 |
| strand | - |
| ver | v1.2 |
| region | chr17:1003519-1179981 |
| region5000 | chr17:998519-1184981 |
| regionname0 | ABR_chr17_1003519_1179981 |
| regionname5000 | ABR_chr17_998519_1184981 |
| chr:pos | ref | alt | af | annotation | impact | samples | AHAPIDS | ACHAPIDS | ACTHAPIDS | ACTGHAPIDS | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr17:1004075
|
C | T | 0.5875 | 3_prime_UTR_variant | MODIFIER | HG00140.hp2 HG00323.hp2 HG00544.hp1 others(195): Show |
a0001a0002a0004others(1): Show | a0001c0001a0001c0002a0001c0003others(7): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0005others(56): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0056others(194): Show | 198 | 337 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 23/23 | c.*2005G>A | 2005 | |||||
|
chr17:1004989
|
G | A | 0.1602 | 3_prime_UTR_variant | MODIFIER | HG00544.hp1 HG00597.hp1 HG00733.hp1 others(51): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(2): Show | a0001c0001t0003a0001c0001t0007a0001c0001t0008others(8): Show | a0001c0001t0003g0059a0001c0001t0003g0060a0001c0001t0003g0062others(51): Show | 54 | 337 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 23/23 | c.*1091C>T | 1091 | |||||
|
chr17:1005147
|
G | GCCT | 0.0148 | 3_prime_UTR_variant | MODIFIER | HG02572.hp1 HG02622.hp2 HG02896.hp2 others(2): Show |
a0001 | a0001c0002a0001c0003 | a0001c0002t0038a0001c0003t0016a0001c0003t0080 | a0001c0002t0038g0013a0001c0003t0016g0163a0001c0003t0016g0218others(2): Show | 5 | 337 | 3 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 23/23 | c.*930_*932dupAGG | 932 | |||||
|
chr17:1005262
|
A | G | 0.3175 | 3_prime_UTR_variant | MODIFIER | HG00544.hp1 HG00597.hp1 HG00733.hp1 others(104): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(3): Show | a0001c0001t0003a0001c0001t0007a0001c0001t0008others(42): Show | a0001c0001t0003g0059a0001c0001t0003g0060a0001c0001t0003g0062others(104): Show | 107 | 337 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 23/23 | c.*818T>C | 818 | |||||
|
chr17:1005289
|
A | G | 0.8279 | 3_prime_UTR_variant | MODIFIER | HG00140.hp2 HG00280.hp2 HG00323.hp1 others(276): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(11): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0005others(98): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0056others(275): Show | 279 | 337 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 23/23 | c.*791T>C | 791 | |||||
|
chr17:1005523
|
C | T | 0.2344 | 3_prime_UTR_variant | MODIFIER | HG00408.hp1 HG00544.hp1 HG00597.hp1 others(76): Show |
a0001a0003 | a0001c0001a0001c0002a0001c0007others(1): Show | a0001c0001t0003a0001c0001t0007a0001c0001t0008others(22): Show | a0001c0001t0003g0059a0001c0001t0003g0060a0001c0001t0003g0062others(76): Show | 79 | 337 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 23/23 | c.*557G>A | 557 | |||||
|
chr17:1005555
|
G | A | 0.2255 | 3_prime_UTR_variant | MODIFIER | HG00408.hp1 HG00544.hp1 HG00597.hp1 others(73): Show |
a0001a0003 | a0001c0001a0001c0002a0001c0007others(1): Show | a0001c0001t0003a0001c0001t0007a0001c0001t0008others(19): Show | a0001c0001t0003g0059a0001c0001t0003g0060a0001c0001t0003g0062others(73): Show | 76 | 337 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 23/23 | c.*525C>T | 525 | |||||
|
chr17:1179789
|
A | G | 0.7389 | 5_prime_UTR_variant | MODIFIER | HG00140.hp1 HG00280.hp2 HG00323.hp1 others(246): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(11): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(83): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0056others(245): Show | 249 | 337 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 1/23 | c.-62T>C | 62 | |||||
|
chr17:1179904
|
A | C | 0.1454 | 5_prime_UTR_variant | MODIFIER | HG00544.hp1 HG00639.hp2 HG00741.hp2 others(46): Show |
a0001a0004 | a0001c0001a0001c0002a0001c0003others(2): Show | a0001c0001t0008a0001c0001t0009a0001c0001t0013others(21): Show | a0001c0001t0008g0007a0001c0001t0008g0011a0001c0001t0008g0012others(46): Show | 49 | 337 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 1/23 | c.-177T>G | 177 |
| chr:pos | ref | alt | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | af | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr17:1006211
|
A | T | intron_variant | MODIFIER | HG00140.hp2 HG00323.hp2 HG00609.hp2 others(125): Show |
a0001a0002a0004others(1): Show | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0001a0001c0001t0005a0001c0001t0007others(41): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0056others(124): Show | 128 | 337 | 0.3798 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 22/22 | c.2491-42T>A | ||||||
|
chr17:1006413
|
C | T | intron_variant | MODIFIER | HG00408.hp1 HG00544.hp1 HG00597.hp1 others(123): Show |
a0001a0003 | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0003a0001c0001t0007a0001c0001t0008others(57): Show | a0001c0001t0003g0059a0001c0001t0003g0060a0001c0001t0003g0062others(123): Show | 126 | 337 | 0.3739 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 22/22 | c.2491-244G>A | ||||||
|
chr17:1006627
|
A | G | intron_variant | MODIFIER | HG00140.hp2 HG00280.hp2 HG00323.hp1 others(273): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(11): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(97): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0056others(272): Show | 276 | 337 | 0.8190 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 22/22 | c.2491-458T>C | ||||||
|
chr17:1006907
|
GCGCCATG others(58): Show |
G | intron_variant | MODIFIER | HG00140.hp2 HG00280.hp2 HG00323.hp1 others(189): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0006others(6): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0005others(56): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0056others(188): Show | 192 | 337 | 0.5697 | -65 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 22/22 | c.2490+193_2490+257delTAGGTACCCTGGCACCGCCCGGGCCCGTGGCTGGCGGAGGGTGACGGTCCCATGACGTCATGGCG | ||||||
|
chr17:1007003
|
G | A | intron_variant | MODIFIER | HG00408.hp1 HG00544.hp1 HG00597.hp1 others(73): Show |
a0001a0003 | a0001c0001a0001c0002a0001c0006others(2): Show | a0001c0001t0003a0001c0001t0007a0001c0001t0008others(24): Show | a0001c0001t0003g0059a0001c0001t0003g0060a0001c0001t0003g0062others(73): Show | 76 | 337 | 0.2255 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 22/22 | c.2490+162C>T | ||||||
|
chr17:1007396
|
A | G | intron_variant | MODIFIER | HG00140.hp2 HG00323.hp2 HG00408.hp1 others(233): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(10): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0005others(85): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0056others(232): Show | 236 | 337 | 0.7003 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 21/22 | c.2343-84T>C | ||||||
|
chr17:1007695
|
G | A | intron_variant | MODIFIER | HG02622.hp2 | a0001 | a0001c0002 | a0001c0002t0038 | a0001c0002t0038g0013 | 1 | 337 | 0.0030 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 21/22 | c.2343-383C>T | ||||||
|
chr17:1011383
|
C | A | intron_variant | MODIFIER | HG00408.hp1 HG00408.hp2 HG00544.hp1 others(78): Show |
a0001a0002a0003 | a0001c0001a0001c0002a0001c0004others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0006others(26): Show | a0001c0001t0001g0101a0001c0001t0001g0146a0001c0001t0001g0159others(78): Show | 81 | 337 | 0.2404 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 19/22 | c.2101+463G>T | ||||||
|
chr17:1012128
|
A | G | intron_variant | MODIFIER | HG00140.hp2 HG00280.hp2 HG00323.hp1 others(282): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(10): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(94): Show | a0001c0001t0001g0001a0001c0001t0001g0056a0001c0001t0001g0058others(281): Show | 285 | 337 | 0.8457 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 18/22 | c.1962-143T>C | ||||||
|
chr17:1012946
|
C | T | intron_variant | MODIFIER | HG00639.hp1 HG00642.hp1 HG00733.hp1 others(66): Show |
a0001a0002a0005 | a0001c0001a0001c0002a0001c0007others(3): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(32): Show | a0001c0001t0001g0058a0001c0001t0001g0065a0001c0001t0001g0146others(66): Show | 69 | 337 | 0.2048 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 17/22 | c.1852-149G>A | ||||||
|
chr17:1013906
|
T | G | intron_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp1 others(158): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0003others(7): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(61): Show | a0001c0001t0001g0058a0001c0001t0001g0065a0001c0001t0001g0098others(158): Show | 161 | 337 | 0.4777 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-742A>C | ||||||
|
chr17:1013974
|
C | T | intron_variant | MODIFIER | HG02622.hp2 HG02723.hp1 HG02896.hp1 others(1): Show |
a0001 | a0001c0001a0001c0002a0001c0003 | a0001c0001t0003a0001c0001t0011a0001c0002t0038others(1): Show | a0001c0001t0003g0112a0001c0001t0011g0232a0001c0002t0038g0013others(1): Show | 4 | 337 | 0.0119 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-810G>A | ||||||
|
chr17:1014333
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(213): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(75): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0065others(213): Show | 216 | 337 | 0.6410 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-1169A>G | ||||||
|
chr17:1014355
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(214): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(76): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0065others(214): Show | 217 | 337 | 0.6439 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-1191T>C | ||||||
|
chr17:1014373
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(214): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(76): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0065others(214): Show | 217 | 337 | 0.6439 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-1209T>C | ||||||
|
chr17:1014996
|
T | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(229): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(84): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0065others(229): Show | 232 | 337 | 0.6884 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-1832A>C | ||||||
|
chr17:1015211
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(251): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0003others(10): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(91): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0063others(251): Show | 254 | 337 | 0.7537 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-2047T>C | ||||||
|
chr17:1015245
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(251): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0003others(10): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(91): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0063others(251): Show | 254 | 337 | 0.7537 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-2081A>G | ||||||
|
chr17:1015420
|
G | GA | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp2 others(202): Show |
a0001a0002a0003 | a0001c0001a0001c0002a0001c0003others(7): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(79): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0063others(202): Show | 205 | 337 | 0.6083 | 1 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-2257dupT | ||||||
|
chr17:1016521
|
G | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00544.hp2 others(84): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(2): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(44): Show | a0001c0001t0001g0061a0001c0001t0001g0089a0001c0001t0001g0173others(84): Show | 87 | 337 | 0.2582 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-3357C>G | ||||||
|
chr17:1016686
|
G | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(252): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0003others(10): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(92): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0063others(252): Show | 255 | 337 | 0.7567 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-3522C>G | ||||||
|
chr17:1017464
|
CT | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(185): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0003others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(73): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0065others(185): Show | 188 | 337 | 0.5579 | -1 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-4301delA | ||||||
|
chr17:1017621
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(229): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0003others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(87): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0063others(229): Show | 232 | 337 | 0.6884 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-4457A>G | ||||||
|
chr17:1017831
|
G | A | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(196): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0003others(7): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(71): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0065others(196): Show | 199 | 337 | 0.5905 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-4667C>T | ||||||
|
chr17:1017979
|
C | T | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00438.hp1 others(113): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(3): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(51): Show | a0001c0001t0001g0061a0001c0001t0001g0089a0001c0001t0001g0124others(113): Show | 116 | 337 | 0.3442 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-4815G>A | ||||||
|
chr17:1018263
|
T | C | intron_variant | MODIFIER | HG00408.hp1 HG01081.hp2 HG01106.hp2 others(47): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(1): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(29): Show | a0001c0001t0001g0101a0001c0001t0001g0148a0001c0001t0001g0194others(47): Show | 50 | 337 | 0.1484 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-5099A>G | ||||||
|
chr17:1018278
|
G | A | intron_variant | MODIFIER | HG01123.hp1 HG01943.hp2 HG02622.hp2 others(3): Show |
a0001 | a0001c0001a0001c0002a0001c0003 | a0001c0001t0003a0001c0001t0007a0001c0001t0011others(2): Show | a0001c0001t0003g0112a0001c0001t0003g0129a0001c0001t0007g0317others(3): Show | 6 | 337 | 0.0178 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-5114C>T | ||||||
|
chr17:1018283
|
T | C | intron_variant | MODIFIER | HG02055.hp1 HG02145.hp2 HG02622.hp2 others(12): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(2): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0005others(10): Show | a0001c0001t0001g0188a0001c0001t0001g0203a0001c0001t0001g0224others(12): Show | 15 | 337 | 0.0445 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-5119A>G | ||||||
|
chr17:1018285
|
G | A | intron_variant | MODIFIER | HG02622.hp2 HG02723.hp1 HG02896.hp1 others(1): Show |
a0001 | a0001c0001a0001c0002a0001c0003 | a0001c0001t0003a0001c0001t0011a0001c0002t0038others(1): Show | a0001c0001t0003g0112a0001c0001t0011g0232a0001c0002t0038g0013others(1): Show | 4 | 337 | 0.0119 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-5121C>T | ||||||
|
chr17:1018293
|
C | T | intron_variant | MODIFIER | HG02622.hp2 HG02723.hp1 HG02896.hp1 others(3): Show |
a0001 | a0001c0001a0001c0002a0001c0003 | a0001c0001t0001a0001c0001t0003a0001c0001t0011others(3): Show | a0001c0001t0001g0188a0001c0001t0003g0112a0001c0001t0011g0232others(3): Show | 6 | 337 | 0.0178 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-5129G>A | ||||||
|
chr17:1018318
|
G | A | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00438.hp1 others(85): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(3): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(38): Show | a0001c0001t0001g0061a0001c0001t0001g0089a0001c0001t0001g0148others(85): Show | 88 | 337 | 0.2611 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-5154C>T | ||||||
|
chr17:1018606
|
C | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(230): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(85): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0063others(230): Show | 233 | 337 | 0.6914 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-5442G>C | ||||||
|
chr17:1018988
|
G | C | intron_variant | MODIFIER | HG01167.hp2 HG01952.hp1 HG02145.hp1 others(16): Show |
a0001 | a0001c0001a0001c0002a0001c0009 | a0001c0001t0003a0001c0001t0008a0001c0001t0011others(11): Show | a0001c0001t0003g0112a0001c0001t0003g0121a0001c0001t0008g0007others(16): Show | 19 | 337 | 0.0564 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-5824C>G | ||||||
|
chr17:1019520
|
C | T | intron_variant | MODIFIER | HG01167.hp2 HG01952.hp1 HG02145.hp1 others(18): Show |
a0001 | a0001c0001a0001c0002a0001c0009 | a0001c0001t0001a0001c0001t0003a0001c0001t0007others(13): Show | a0001c0001t0001g0133a0001c0001t0003g0112a0001c0001t0003g0121others(18): Show | 21 | 337 | 0.0623 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-6356G>A | ||||||
|
chr17:1020029
|
G | A | intron_variant | MODIFIER | HG01167.hp2 HG01952.hp1 HG02145.hp1 others(18): Show |
a0001 | a0001c0001a0001c0002a0001c0009 | a0001c0001t0001a0001c0001t0003a0001c0001t0007others(13): Show | a0001c0001t0001g0133a0001c0001t0003g0112a0001c0001t0003g0121others(18): Show | 21 | 337 | 0.0623 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-6865C>T | ||||||
|
chr17:1020091
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00438.hp1 others(152): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(68): Show | a0001c0001t0001g0061a0001c0001t0001g0063a0001c0001t0001g0089others(152): Show | 155 | 337 | 0.4599 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-6927A>G | ||||||
|
chr17:1020372
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(262): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0003others(10): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(95): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0063others(262): Show | 265 | 337 | 0.7864 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-7208A>G | ||||||
|
chr17:1021656
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp2 others(152): Show |
a0001a0002a0004 | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(54): Show | a0001c0001t0001g0054a0001c0001t0001g0061a0001c0001t0001g0064others(152): Show | 155 | 337 | 0.4599 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-8492A>G | ||||||
|
chr17:1021766
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp2 others(192): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(7): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(79): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0063others(192): Show | 195 | 337 | 0.5786 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-8602A>G | ||||||
|
chr17:1022064
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp2 others(162): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(66): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0063others(162): Show | 165 | 337 | 0.4896 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-8900T>C | ||||||
|
chr17:1022120
|
A | AAAAAAAA others(7): Show |
intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp2 others(38): Show |
a0001 | a0001c0001a0001c0002a0001c0012 | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(20): Show | a0001c0001t0001g0089a0001c0001t0001g0173a0001c0001t0001g0199others(38): Show | 41 | 337 | 0.1217 | 14 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-8957_1792-8956insGTTTTTTTTTTTTT | ||||||
|
chr17:1022430
|
G | A | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp2 others(70): Show |
a0001 | a0001c0001a0001c0002a0001c0012 | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(26): Show | a0001c0001t0001g0061a0001c0001t0001g0089a0001c0001t0001g0169others(70): Show | 73 | 337 | 0.2166 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-9266C>T | ||||||
|
chr17:1022524
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp2 others(168): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(72): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0063others(168): Show | 171 | 337 | 0.5074 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-9360T>C | ||||||
|
chr17:1022881
|
G | A | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp2 others(167): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(72): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0063others(167): Show | 170 | 337 | 0.5045 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-9717C>T | ||||||
|
chr17:1023098
|
T | TCTGCCGG others(22): Show |
intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp2 others(102): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(3): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(43): Show | a0001c0001t0001g0061a0001c0001t0001g0089a0001c0001t0001g0124others(102): Show | 105 | 337 | 0.3116 | 29 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-9935_1792-9934insTGGCTCTGCAGTGGACGTGGGGCCGGCAG | ||||||
|
chr17:1023119
|
A | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp2 others(129): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(52): Show | a0001c0001t0001g0061a0001c0001t0001g0089a0001c0001t0001g0124others(129): Show | 132 | 337 | 0.3917 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-9955T>G | ||||||
|
chr17:1023500
|
G | A | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp2 others(167): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(70): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0063others(167): Show | 170 | 337 | 0.5045 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-10336C>T | ||||||
|
chr17:1023541
|
AGGCCAG | A | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp2 others(107): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(3): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(46): Show | a0001c0001t0001g0061a0001c0001t0001g0089a0001c0001t0001g0124others(107): Show | 110 | 337 | 0.3264 | -6 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-10383_1792-10378delCTGGCC | ||||||
|
chr17:1024024
|
C | CAAAAA | intron_variant | MODIFIER | HG01099.hp1 HG01175.hp1 HG01192.hp1 others(14): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(2): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004others(8): Show | a0001c0001t0001g0061a0001c0001t0001g0089a0001c0001t0002g0081others(14): Show | 17 | 337 | 0.0505 | 5 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-10865_1792-10861dupTTTTT | ||||||
|
chr17:1024276
|
A | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp2 others(155): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(64): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0063others(155): Show | 158 | 337 | 0.4688 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-11112T>G | ||||||
|
chr17:1024424
|
G | A | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp2 others(78): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(2): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(29): Show | a0001c0001t0001g0061a0001c0001t0001g0089a0001c0001t0001g0157others(78): Show | 81 | 337 | 0.2404 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-11260C>T | ||||||
|
chr17:1024462
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(243): Show |
a0001a0002a0005 | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(89): Show | a0001c0001t0001g0001a0001c0001t0001g0056a0001c0001t0001g0058others(242): Show | 246 | 337 | 0.7300 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-11298T>C | ||||||
|
chr17:1024466
|
A | T | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp2 others(78): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(2): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(29): Show | a0001c0001t0001g0061a0001c0001t0001g0089a0001c0001t0001g0157others(78): Show | 81 | 337 | 0.2404 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-11302T>A | ||||||
|
chr17:1024783
|
CAA | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp2 others(81): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(2): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(32): Show | a0001c0001t0001g0056a0001c0001t0001g0089a0001c0001t0001g0157others(81): Show | 84 | 337 | 0.2493 | -2 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-11621_1792-11620delTT | ||||||
|
chr17:1024838
|
G | A | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp2 others(121): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(3): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(52): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0063others(121): Show | 124 | 337 | 0.3680 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-11674C>T | ||||||
|
chr17:1024977
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(247): Show |
a0001a0002a0005 | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(90): Show | a0001c0001t0001g0001a0001c0001t0001g0056a0001c0001t0001g0058others(246): Show | 250 | 337 | 0.7418 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-11813A>G | ||||||
|
chr17:1025071
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(246): Show |
a0001a0002a0005 | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(90): Show | a0001c0001t0001g0001a0001c0001t0001g0056a0001c0001t0001g0058others(245): Show | 249 | 337 | 0.7389 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-11907T>C | ||||||
|
chr17:1025119
|
C | CAAAAAAA others(1): Show |
intron_variant | MODIFIER | HG02615.hp1 HG02622.hp2 HG02922.hp2 others(4): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(1): Show | a0001c0001t0023a0001c0001t0040a0001c0001t0075others(4): Show | a0001c0001t0023g0035a0001c0001t0040g0002a0001c0001t0075g0156others(4): Show | 7 | 337 | 0.0208 | 8 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-11963_1792-11956dupTTTTTTTT | ||||||
|
chr17:1025477
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(247): Show |
a0001a0002a0005 | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(90): Show | a0001c0001t0001g0001a0001c0001t0001g0056a0001c0001t0001g0058others(246): Show | 250 | 337 | 0.7418 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-12313A>G | ||||||
|
chr17:1025936
|
C | T | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(152): Show |
a0001a0002a0005 | a0001c0001a0001c0002a0001c0003others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(47): Show | a0001c0001t0001g0001a0001c0001t0001g0056a0001c0001t0001g0061others(151): Show | 155 | 337 | 0.4599 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-12772G>A | ||||||
|
chr17:1025971
|
C | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(223): Show |
a0001a0002a0005 | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(82): Show | a0001c0001t0001g0001a0001c0001t0001g0056a0001c0001t0001g0058others(222): Show | 226 | 337 | 0.6706 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-12807G>C | ||||||
|
chr17:1026384
|
C | T | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp2 others(71): Show |
a0001 | a0001c0001a0001c0002a0001c0012 | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(25): Show | a0001c0001t0001g0061a0001c0001t0001g0089a0001c0001t0001g0169others(71): Show | 74 | 337 | 0.2196 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-13220G>A | ||||||
|
chr17:1026501
|
A | T | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp2 others(71): Show |
a0001 | a0001c0001a0001c0002a0001c0012 | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(25): Show | a0001c0001t0001g0061a0001c0001t0001g0089a0001c0001t0001g0169others(71): Show | 74 | 337 | 0.2196 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-13337T>A | ||||||
|
chr17:1026924
|
C | T | intron_variant | MODIFIER | HG02622.hp2 HG02723.hp1 HG02896.hp1 others(4): Show |
a0001 | a0001c0001a0001c0002a0001c0003 | a0001c0001t0007a0001c0001t0011a0001c0001t0023others(4): Show | a0001c0001t0007g0281a0001c0001t0011g0232a0001c0001t0023g0035others(4): Show | 7 | 337 | 0.0208 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-13760G>A | ||||||
|
chr17:1027021
|
T | C | intron_variant | MODIFIER | HG02622.hp2 HG02723.hp1 HG02896.hp1 others(3): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(1): Show | a0001c0001t0007a0001c0001t0011a0001c0001t0031others(3): Show | a0001c0001t0007g0281a0001c0001t0011g0232a0001c0001t0031g0241others(3): Show | 6 | 337 | 0.0178 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-13857A>G | ||||||
|
chr17:1027976
|
T | G | intron_variant | MODIFIER | HG00438.hp1 HG00544.hp1 HG00597.hp2 others(60): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(3): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(39): Show | a0001c0001t0001g0124a0001c0001t0001g0133a0001c0001t0001g0135others(60): Show | 63 | 337 | 0.1869 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-14812A>C | ||||||
|
chr17:1028697
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(330): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(12): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(108): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0056others(329): Show | 333 | 337 | 0.9881 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-15533T>C | ||||||
|
chr17:1029102
|
CA | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp2 others(219): Show |
a0001a0002a0004others(1): Show | a0001c0001a0001c0002a0001c0003others(10): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(88): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0058others(218): Show | 222 | 337 | 0.6588 | -1 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-15939delT | ||||||
|
chr17:1029909
|
T | TCCCTCCG others(54): Show |
intron_variant | MODIFIER | HG01167.hp2 HG01192.hp2 HG01261.hp2 others(42): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(3): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0006others(33): Show | a0001c0001t0001g0135a0001c0001t0001g0226a0001c0001t0003g0112others(42): Show | 45 | 337 | 0.1335 | 61 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-16746_1792-16745insTCGTCTGCCACAGTGTGTCCGTGTCATGGACGCAGGGGTCAGCGCTGTGGTGGACGGAGGG | ||||||
|
chr17:1029920
|
G | A | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(308): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(12): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(104): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0058others(307): Show | 311 | 337 | 0.9229 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-16756C>T | ||||||
|
chr17:1029967
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(260): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(12): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(94): Show | a0001c0001t0001g0001a0001c0001t0001g0058a0001c0001t0001g0061others(259): Show | 263 | 337 | 0.7804 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-16803T>C | ||||||
|
chr17:1030916
|
G | A | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(313): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(12): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(105): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0058others(312): Show | 316 | 337 | 0.9377 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-17752C>T | ||||||
|
chr17:1031969
|
T | G | intron_variant | MODIFIER | HG01943.hp2 HG02015.hp1 HG02055.hp2 others(34): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(1): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(23): Show | a0001c0001t0001g0148a0001c0001t0001g0157a0001c0001t0001g0176others(34): Show | 37 | 337 | 0.1098 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+18081A>C | ||||||
|
chr17:1032233
|
T | C | intron_variant | MODIFIER | HG00140.hp2 HG00639.hp2 HG00642.hp1 others(80): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(3): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(37): Show | a0001c0001t0001g0056a0001c0001t0001g0058a0001c0001t0001g0071others(80): Show | 83 | 337 | 0.2463 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+17817A>G | ||||||
|
chr17:1032494
|
A | G | intron_variant | MODIFIER | HG00140.hp2 HG00323.hp2 HG00639.hp2 others(116): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(56): Show | a0001c0001t0001g0056a0001c0001t0001g0071a0001c0001t0001g0074others(116): Show | 119 | 337 | 0.3531 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+17556T>C | ||||||
|
chr17:1032564
|
CGTCCGTG others(75): Show |
C | intron_variant | MODIFIER | HG01261.hp2 HG01943.hp2 HG02015.hp1 others(31): Show |
a0001 | a0001c0001a0001c0002a0001c0009 | a0001c0001t0001a0001c0001t0002a0001c0001t0004others(17): Show | a0001c0001t0001g0135a0001c0001t0001g0148a0001c0001t0001g0157others(31): Show | 34 | 337 | 0.1009 | -82 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+17404_1791+17485delACGGGTGGTTGCCCGTGGCGTCCTCTGCGCCCAGCACGGACGCGGGTGGTTGCCCGTGGCGTCCTCTGCGCCCAGCACGGAC | ||||||
|
chr17:1033577
|
T | C | intron_variant | MODIFIER | HG01261.hp2 HG01891.hp1 HG01943.hp2 others(33): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(1): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004others(20): Show | a0001c0001t0001g0135a0001c0001t0001g0148a0001c0001t0001g0157others(33): Show | 36 | 337 | 0.1068 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+16473A>G | ||||||
|
chr17:1033611
|
A | G | intron_variant | MODIFIER | HG00140.hp2 HG00323.hp2 HG00639.hp1 others(165): Show |
a0001a0002 | a0001c0001a0001c0002a0001c0003others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(71): Show | a0001c0001t0001g0054a0001c0001t0001g0056a0001c0001t0001g0058others(165): Show | 168 | 337 | 0.4985 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+16439T>C | ||||||
|
chr17:1033676
|
G | A | intron_variant | MODIFIER | HG01261.hp2 HG01891.hp1 HG01943.hp2 others(32): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(1): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004others(19): Show | a0001c0001t0001g0135a0001c0001t0001g0148a0001c0001t0001g0157others(32): Show | 35 | 337 | 0.1039 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+16374C>T | ||||||
|
chr17:1033969
|
ATT | A | intron_variant | MODIFIER | HG00140.hp2 HG00735.hp2 HG00741.hp1 others(49): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(2): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(26): Show | a0001c0001t0001g0135a0001c0001t0001g0148a0001c0001t0001g0176others(49): Show | 52 | 337 | 0.1543 | -2 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+16079_1791+16080delAA | ||||||
|
chr17:1034631
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(332): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(12): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(109): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0056others(331): Show | 335 | 337 | 0.9941 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+15419T>C | ||||||
|
chr17:1035495
|
C | CCCCCCAC others(1317): Show |
intron_variant | MODIFIER | HG02622.hp2 | a0001 | a0001c0002 | a0001c0002t0038 | a0001c0002t0038g0013 | 1 | 337 | 0.0030 | 1324 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+14554_1791+14555insAGCAGCTGTGGGGGATGGAAGGAGTGGGGGGGAGCAGGTGTGGGTGATGGAAGGGGTGGGGGGAGCAGGTGTAGGGGGATGGAAGGGGTAGAGGGGAATAGGTGTGGGGGATGGAAGGGGTAGGGGGAGCAGGTGTGGGGGATGGAAGGGGTAGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGAGCAGGTGTGGGGGATGGAAGGGGTAGGGGGGAACAGGTGTGGGGGATGGAAGGGGTAGGGGGAGCACGTGTGGGGGATGGAAGGGGTGGGGGAGCAGGTGTGGGGGATGGAAGGGGAGGGGGAGCAGGTGTAGGGGGATGGAAGGGGTGGGGGGAGCAGGTGTGGGAGATGGAAGGGGTGGGGGGAGCAGGTGGGGGTAGAAAGGGTGGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGAGAAGGTGTAGGGGATGGAAGGGGTGGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGGAGCAGGTGTAGGGGGATGGAAGGGGTAGGGGGGAACAGGTGTGGGGGATGGAAGGGGTAGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGGAGCAGGTGTAGGGGGATGGAAGGGGTAGGGGGGAACAGGTGTGGGGGATGGAAGGGGTAGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGAGCAGGTGTGGGGGATGGAAGGGGTAGGGGGGAACAGGTGTAGCGGGATGGAAGGGGTGGGGGAGAAGGTGTAGGGGATGGAAGGGGTGGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGAGCAGGTGTGGGGGATGAAGGTGGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGAGCAGGTGTAGGGGGATGGAAGGGGTGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGGAGCAGGTGTGGGGGATGGAAGGGTGGGGGAACAGGTGTGGGGGATGGAAGGGGTGGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGAACAGGTGTGGGGGATGGAAGGGGTGGGGG | ||||||
|
chr17:1036804
|
G | A | intron_variant | MODIFIER | HG02622.hp2 HG02895.hp1 HG03098.hp1 |
a0001 | a0001c0001a0001c0002 | a0001c0001t0001a0001c0001t0023a0001c0002t0038 | a0001c0001t0001g0124a0001c0001t0023g0035a0001c0002t0038g0013 | 3 | 337 | 0.0089 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+13246C>T | ||||||
|
chr17:1037830
|
T | C | intron_variant | MODIFIER | HG00140.hp2 HG00280.hp2 HG00323.hp1 others(199): Show |
a0001a0002a0005 | a0001c0001a0001c0002a0001c0003others(7): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(82): Show | a0001c0001t0001g0054a0001c0001t0001g0058a0001c0001t0001g0065others(199): Show | 202 | 337 | 0.5994 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+12220A>G | ||||||
|
chr17:1037974
|
C | T | intron_variant | MODIFIER | HG00140.hp2 HG00323.hp2 HG00738.hp1 others(30): Show |
a0001 | a0001c0001a0001c0002a0001c0012others(1): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(15): Show | a0001c0001t0001g0071a0001c0001t0001g0074a0001c0001t0001g0124others(30): Show | 33 | 337 | 0.0979 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+12076G>A | ||||||
|
chr17:1038952
|
A | C | intron_variant | MODIFIER | HG00140.hp2 HG00323.hp2 HG00408.hp1 others(143): Show |
a0001a0003a0004others(1): Show | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(68): Show | a0001c0001t0001g0054a0001c0001t0001g0063a0001c0001t0001g0065others(143): Show | 146 | 337 | 0.4332 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+11098T>G | ||||||
|
chr17:1039494
|
T | G | intron_variant | MODIFIER | HG00140.hp2 HG00323.hp2 HG00408.hp1 others(139): Show |
a0001a0003a0004others(1): Show | a0001c0001a0001c0002a0001c0003others(7): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(69): Show | a0001c0001t0001g0054a0001c0001t0001g0063a0001c0001t0001g0065others(139): Show | 142 | 337 | 0.4214 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+10556A>C | ||||||
|
chr17:1040135
|
T | C | intron_variant | MODIFIER | HG00140.hp2 HG00323.hp2 HG00408.hp1 others(135): Show |
a0001a0003a0004others(1): Show | a0001c0001a0001c0002a0001c0003others(7): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(69): Show | a0001c0001t0001g0054a0001c0001t0001g0063a0001c0001t0001g0065others(135): Show | 138 | 337 | 0.4095 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+9915A>G | ||||||
|
chr17:1040894
|
C | T | intron_variant | MODIFIER | HG01109.hp2 HG02622.hp2 |
a0001 | a0001c0002a0001c0003 | a0001c0002t0038a0001c0003t0083 | a0001c0002t0038g0013a0001c0003t0083g0285 | 2 | 337 | 0.0059 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+9156G>A | ||||||
|
chr17:1042290
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(262): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(11): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(90): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0063others(261): Show | 265 | 337 | 0.7864 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+7760A>G | ||||||
|
chr17:1042324
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(316): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(12): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(104): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0061others(315): Show | 319 | 337 | 0.9466 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+7726T>C | ||||||
|
chr17:1043819
|
T | C | intron_variant | MODIFIER | HG01109.hp2 HG02622.hp2 |
a0001 | a0001c0002a0001c0003 | a0001c0002t0038a0001c0003t0083 | a0001c0002t0038g0013a0001c0003t0083g0285 | 2 | 337 | 0.0059 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+6231A>G | ||||||
|
chr17:1043993
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00280.hp1 HG00280.hp2 others(218): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(73): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0063others(217): Show | 221 | 337 | 0.6558 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+6057T>C | ||||||
|
chr17:1044199
|
A | AG | intron_variant | MODIFIER | HG00140.hp1 HG00280.hp1 HG00280.hp2 others(214): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(72): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0063others(213): Show | 217 | 337 | 0.6439 | 1 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+5850dupC | ||||||
|
chr17:1044387
|
G | C | intron_variant | MODIFIER | HG00140.hp1 HG00280.hp1 HG00280.hp2 others(218): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(73): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0063others(217): Show | 221 | 337 | 0.6558 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+5663C>G | ||||||
|
chr17:1044423
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00280.hp1 HG00280.hp2 others(218): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(73): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0063others(217): Show | 221 | 337 | 0.6558 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+5627T>C | ||||||
|
chr17:1044600
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(258): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(11): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(88): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0063others(257): Show | 261 | 337 | 0.7745 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+5450T>C | ||||||
|
chr17:1044616
|
A | C | intron_variant | MODIFIER | HG00140.hp1 HG00280.hp1 HG00280.hp2 others(218): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(73): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0063others(217): Show | 221 | 337 | 0.6558 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+5434T>G | ||||||
|
chr17:1044650
|
CAA | C | intron_variant | MODIFIER | HG01109.hp2 HG02622.hp2 HG03209.hp1 others(4): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(1): Show | a0001c0001t0001a0001c0002t0038a0001c0002t0053others(4): Show | a0001c0001t0001g0133a0001c0002t0038g0013a0001c0002t0053g0070others(4): Show | 7 | 337 | 0.0208 | -2 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+5398_1791+5399delTT | ||||||
|
chr17:1044819
|
C | T | intron_variant | MODIFIER | HG00408.hp1 HG00408.hp2 HG00544.hp2 others(62): Show |
a0001a0003a0004others(1): Show | a0001c0001a0001c0002a0001c0003others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(34): Show | a0001c0001t0001g0054a0001c0001t0001g0063a0001c0001t0001g0065others(62): Show | 65 | 337 | 0.1929 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+5231G>A | ||||||
|
chr17:1044820
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00280.hp1 HG00280.hp2 others(218): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(73): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0063others(217): Show | 221 | 337 | 0.6558 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+5230T>C | ||||||
|
chr17:1045331
|
C | A | intron_variant | MODIFIER | HG00140.hp2 HG00408.hp1 HG00408.hp2 others(85): Show |
a0001a0003a0004others(1): Show | a0001c0001a0001c0002a0001c0003others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(41): Show | a0001c0001t0001g0054a0001c0001t0001g0063a0001c0001t0001g0065others(85): Show | 88 | 337 | 0.2611 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+4719G>T | ||||||
|
chr17:1045352
|
ATCTTCTT others(19): Show |
A | intron_variant | MODIFIER | HG00140.hp1 HG00280.hp1 HG00280.hp2 others(279): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(10): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(90): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0056others(278): Show | 282 | 337 | 0.8368 | -26 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+4672_1791+4697delCGGAAGATTGTCCTGCTGTAAGAAGA | ||||||
|
chr17:1045572
|
T | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(263): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(11): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(89): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0058others(262): Show | 266 | 337 | 0.7893 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+4478A>C | ||||||
|
chr17:1045714
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00280.hp1 HG00280.hp2 others(161): Show |
a0001a0002 | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(58): Show |