| geneid | 29 |
|---|---|
| ensemblid | ENSG00000159842.16 |
| hgncid | 81 |
| symbol | ABR |
| name | ABR activator of RhoGEF and GTPase |
| refseq_nuc | NM_021962.5 |
| refseq_prot | NP_068781.2 |
| ensembl_nuc | ENST00000302538.10 |
| ensembl_prot | ENSP00000303909.5 |
| mane_status | MANE Select |
| chr | chr17 |
| start | 1003519 |
| end | 1179981 |
| strand | - |
| ver | v1.2 |
| region | chr17:1003519-1179981 |
| region5000 | chr17:998519-1184981 |
| regionname0 | ABR_chr17_1003519_1179981 |
| regionname5000 | ABR_chr17_998519_1184981 |
| chr:pos | ref | alt | af | annotation | impact | samples | AHAPIDS | ACHAPIDS | ACTHAPIDS | ACTGHAPIDS | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr17:1007306
|
G | A | 0.0564 | synonymous_variant | LOW | HG01109.hp2 HG01884.hp2 HG01891.hp1 others(16): Show |
a0001 | a0001c0003a0001c0004 | a0001c0003t0012a0001c0003t0016a0001c0003t0017others(12): Show | a0001c0003t0012g0105a0001c0003t0012g0119a0001c0003t0016g0163others(16): Show | 19 | 337 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 22/23 | c.2349C>T | p.Ala783Ala | 2603/5395 | 2349/2580 | 783/859 |
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr17:1004367
|
G | A | 0.0059 | 3_prime_UTR_variant | MODIFIER | HG01109.hp2 HG06807.hp1 |
a0001 | a0001c0003a0001c0004 | a0001c0003t0083a0001c0004t0037 | a0001c0003t0083g0285a0001c0004t0037g0017 | 2 | 337 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 23/23 | c.*1713C>T | 1713 | |||||
|
chr17:1004385
|
A | T | 0.2048 | 3_prime_UTR_variant | MODIFIER | HG00140.hp1 HG00280.hp2 HG00323.hp1 others(66): Show |
a0001a0003 | a0001c0001a0001c0002a0001c0003others(3): Show | a0001c0001t0006a0001c0001t0010a0001c0001t0013others(29): Show | a0001c0001t0006g0055a0001c0001t0006g0075a0001c0001t0006g0077others(66): Show | 69 | 337 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 23/23 | c.*1695T>A | 1695 | |||||
|
chr17:1005289
|
A | G | 0.8279 | 3_prime_UTR_variant | MODIFIER | HG00140.hp2 HG00280.hp2 HG00323.hp1 others(276): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(11): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0005others(98): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0056others(275): Show | 279 | 337 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 23/23 | c.*791T>C | 791 | |||||
|
chr17:1179789
|
A | G | 0.7389 | 5_prime_UTR_variant | MODIFIER | HG00140.hp1 HG00280.hp2 HG00323.hp1 others(246): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(11): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(83): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0056others(245): Show | 249 | 337 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 1/23 | c.-62T>C | 62 | |||||
|
chr17:1179904
|
A | C | 0.1454 | 5_prime_UTR_variant | MODIFIER | HG00544.hp1 HG00639.hp2 HG00741.hp2 others(46): Show |
a0001a0004 | a0001c0001a0001c0002a0001c0003others(2): Show | a0001c0001t0008a0001c0001t0009a0001c0001t0013others(21): Show | a0001c0001t0008g0007a0001c0001t0008g0011a0001c0001t0008g0012others(46): Show | 49 | 337 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 1/23 | c.-177T>G | 177 |
| chr:pos | ref | alt | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | af | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr17:1006413
|
C | T | intron_variant | MODIFIER | HG00408.hp1 HG00544.hp1 HG00597.hp1 others(123): Show |
a0001a0003 | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0003a0001c0001t0007a0001c0001t0008others(57): Show | a0001c0001t0003g0059a0001c0001t0003g0060a0001c0001t0003g0062others(123): Show | 126 | 337 | 0.3739 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 22/22 | c.2491-244G>A | ||||||
|
chr17:1006627
|
A | G | intron_variant | MODIFIER | HG00140.hp2 HG00280.hp2 HG00323.hp1 others(273): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(11): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(97): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0056others(272): Show | 276 | 337 | 0.8190 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 22/22 | c.2491-458T>C | ||||||
|
chr17:1006733
|
C | CTCACCCT others(123): Show |
intron_variant | MODIFIER | HG01109.hp2 HG01884.hp2 HG01891.hp1 others(16): Show |
a0001 | a0001c0001a0001c0003a0001c0004 | a0001c0001t0007a0001c0001t0017a0001c0001t0021others(12): Show | a0001c0001t0007g0280a0001c0001t0017g0113a0001c0001t0017g0225others(16): Show | 19 | 337 | 0.0564 | 130 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 22/22 | c.2490+302_2490+431dupCGGTCCCATGACGTCATGGCGCAGGTACCCTGGCACCGCCCGGGCCCGTGGCTGGCGGAGGGTGACGGTCCCATGACGTCATGGCGCAGGTACCCTGGCACCGCCCGGGCCCGTGGCTGGCGGAGGGTGA | ||||||
|
chr17:1006972
|
A | G | intron_variant | MODIFIER | HG00408.hp1 HG00408.hp2 HG00438.hp2 others(67): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(2): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0006others(35): Show | a0001c0001t0001g0124a0001c0001t0004g0268a0001c0001t0006g0055others(67): Show | 70 | 337 | 0.2077 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 22/22 | c.2490+193T>C | ||||||
|
chr17:1007396
|
A | G | intron_variant | MODIFIER | HG00140.hp2 HG00323.hp2 HG00408.hp1 others(233): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(10): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0005others(85): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0056others(232): Show | 236 | 337 | 0.7003 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 21/22 | c.2343-84T>C | ||||||
|
chr17:1007617
|
A | G | intron_variant | MODIFIER | HG00140.hp2 HG00323.hp2 HG00609.hp2 others(142): Show |
a0001a0002a0004others(1): Show | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0001a0001c0001t0005a0001c0001t0007others(52): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0056others(141): Show | 145 | 337 | 0.4303 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 21/22 | c.2343-305T>C | ||||||
|
chr17:1008054
|
T | C | intron_variant | MODIFIER | HG00140.hp2 HG00323.hp2 HG00609.hp2 others(128): Show |
a0001a0002a0004others(1): Show | a0001c0001a0001c0002a0001c0003others(5): Show | a0001c0001t0001a0001c0001t0005a0001c0001t0007others(42): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0056others(127): Show | 131 | 337 | 0.3887 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 21/22 | c.2343-742A>G | ||||||
|
chr17:1009235
|
TCCCCACT others(10): Show |
T | intron_variant | MODIFIER | HG01109.hp2 HG02015.hp2 HG02055.hp2 others(24): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(1): Show | a0001c0001t0017a0001c0001t0019a0001c0001t0021others(17): Show | a0001c0001t0017g0113a0001c0001t0017g0225a0001c0001t0019g0057others(24): Show | 27 | 337 | 0.0801 | -17 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 21/22 | c.2342+427_2342+443delGGTGGACAGCAGTGGGG | ||||||
|
chr17:1009528
|
G | A | intron_variant | MODIFIER | HG00140.hp2 HG00323.hp2 HG00609.hp2 others(127): Show |
a0001a0002a0004others(1): Show | a0001c0001a0001c0002a0001c0003others(5): Show | a0001c0001t0001a0001c0001t0005a0001c0001t0009others(41): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0056others(126): Show | 130 | 337 | 0.3858 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 21/22 | c.2342+151C>T | ||||||
|
chr17:1011383
|
C | A | intron_variant | MODIFIER | HG00408.hp1 HG00408.hp2 HG00544.hp1 others(78): Show |
a0001a0002a0003 | a0001c0001a0001c0002a0001c0004others(4): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0006others(26): Show | a0001c0001t0001g0101a0001c0001t0001g0146a0001c0001t0001g0159others(78): Show | 81 | 337 | 0.2404 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 19/22 | c.2101+463G>T | ||||||
|
chr17:1012038
|
G | C | intron_variant | MODIFIER | HG01109.hp2 HG01891.hp1 HG02970.hp1 others(7): Show |
a0001 | a0001c0001a0001c0003a0001c0004 | a0001c0001t0011a0001c0003t0012a0001c0003t0024others(6): Show | a0001c0001t0011g0246a0001c0003t0012g0105a0001c0003t0012g0119others(7): Show | 10 | 337 | 0.0297 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 18/22 | c.1962-53C>G | ||||||
|
chr17:1012128
|
A | G | intron_variant | MODIFIER | HG00140.hp2 HG00280.hp2 HG00323.hp1 others(282): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(10): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(94): Show | a0001c0001t0001g0001a0001c0001t0001g0056a0001c0001t0001g0058others(281): Show | 285 | 337 | 0.8457 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 18/22 | c.1962-143T>C | ||||||
|
chr17:1013456
|
G | A | intron_variant | MODIFIER | HG00280.hp2 HG00323.hp1 HG00741.hp2 others(29): Show |
a0001 | a0001c0001a0001c0003a0001c0004 | a0001c0001t0001a0001c0001t0002a0001c0001t0004others(19): Show | a0001c0001t0001g0169a0001c0001t0001g0181a0001c0001t0002g0152others(29): Show | 32 | 337 | 0.0950 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-292C>T | ||||||
|
chr17:1013906
|
T | G | intron_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp1 others(158): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0003others(7): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(61): Show | a0001c0001t0001g0058a0001c0001t0001g0065a0001c0001t0001g0098others(158): Show | 161 | 337 | 0.4777 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-742A>C | ||||||
|
chr17:1014333
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(213): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(75): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0065others(213): Show | 216 | 337 | 0.6410 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-1169A>G | ||||||
|
chr17:1014355
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(214): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(76): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0065others(214): Show | 217 | 337 | 0.6439 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-1191T>C | ||||||
|
chr17:1014373
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(214): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(76): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0065others(214): Show | 217 | 337 | 0.6439 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-1209T>C | ||||||
|
chr17:1014996
|
T | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(229): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(84): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0065others(229): Show | 232 | 337 | 0.6884 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-1832A>C | ||||||
|
chr17:1015204
|
G | A | intron_variant | MODIFIER | HG00280.hp2 HG00323.hp1 HG01081.hp2 others(20): Show |
a0001 | a0001c0001a0001c0004 | a0001c0001t0001a0001c0001t0002a0001c0001t0004others(10): Show | a0001c0001t0001g0169a0001c0001t0001g0181a0001c0001t0002g0152others(20): Show | 23 | 337 | 0.0683 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-2040C>T | ||||||
|
chr17:1015211
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(251): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0003others(10): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(91): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0063others(251): Show | 254 | 337 | 0.7537 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-2047T>C | ||||||
|
chr17:1015245
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(251): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0003others(10): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(91): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0063others(251): Show | 254 | 337 | 0.7537 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-2081A>G | ||||||
|
chr17:1015520
|
G | A | intron_variant | MODIFIER | HG03486.hp1 HG06807.hp1 |
a0001 | a0001c0001a0001c0004 | a0001c0001t0007a0001c0004t0037 | a0001c0001t0007g0281a0001c0004t0037g0017 | 2 | 337 | 0.0059 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-2356C>T | ||||||
|
chr17:1015548
|
C | T | intron_variant | MODIFIER | HG00280.hp2 HG00323.hp1 HG01081.hp2 others(20): Show |
a0001 | a0001c0001a0001c0004 | a0001c0001t0001a0001c0001t0002a0001c0001t0004others(10): Show | a0001c0001t0001g0169a0001c0001t0001g0181a0001c0001t0002g0152others(20): Show | 23 | 337 | 0.0683 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-2384G>A | ||||||
|
chr17:1016686
|
G | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(252): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0003others(10): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(92): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0063others(252): Show | 255 | 337 | 0.7567 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-3522C>G | ||||||
|
chr17:1017311
|
G | A | intron_variant | MODIFIER | HG01109.hp2 HG01243.hp2 HG02622.hp1 others(4): Show |
a0001 | a0001c0001a0001c0003a0001c0004 | a0001c0001t0029a0001c0001t0043a0001c0003t0012others(3): Show | a0001c0001t0029g0116a0001c0001t0029g0177a0001c0001t0043g0008others(4): Show | 7 | 337 | 0.0208 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-4147C>T | ||||||
|
chr17:1017464
|
CTTTTT | C | intron_variant | MODIFIER | HG01109.hp2 HG01243.hp2 HG02622.hp1 others(4): Show |
a0001 | a0001c0001a0001c0003a0001c0004 | a0001c0001t0029a0001c0001t0043a0001c0003t0012others(3): Show | a0001c0001t0029g0116a0001c0001t0029g0177a0001c0001t0043g0008others(4): Show | 7 | 337 | 0.0208 | -5 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-4305_1792-4301delAAAAA | ||||||
|
chr17:1017568
|
A | C | intron_variant | MODIFIER | HG01109.hp2 HG01192.hp2 HG01243.hp2 others(5): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(1): Show | a0001c0001t0029a0001c0001t0043a0001c0002t0085others(4): Show | a0001c0001t0029g0116a0001c0001t0029g0177a0001c0001t0043g0008others(5): Show | 8 | 337 | 0.0237 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-4404T>G | ||||||
|
chr17:1017621
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(229): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0003others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(87): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0063others(229): Show | 232 | 337 | 0.6884 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-4457A>G | ||||||
|
chr17:1017866
|
G | A | intron_variant | MODIFIER | HG01109.hp2 HG01192.hp2 HG01243.hp2 others(5): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(1): Show | a0001c0001t0029a0001c0001t0043a0001c0002t0085others(4): Show | a0001c0001t0029g0116a0001c0001t0029g0177a0001c0001t0043g0008others(5): Show | 8 | 337 | 0.0237 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-4702C>T | ||||||
|
chr17:1018144
|
G | A | intron_variant | MODIFIER | HG01109.hp2 HG01192.hp2 HG01243.hp2 others(7): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(1): Show | a0001c0001t0029a0001c0001t0043a0001c0002t0085others(6): Show | a0001c0001t0029g0116a0001c0001t0029g0177a0001c0001t0043g0008others(7): Show | 10 | 337 | 0.0297 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-4980C>T | ||||||
|
chr17:1018233
|
G | A | intron_variant | MODIFIER | HG00280.hp1 HG00408.hp1 HG00438.hp2 others(99): Show |
a0001a0003a0005 | a0001c0001a0001c0002a0001c0003others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(38): Show | a0001c0001t0001g0058a0001c0001t0001g0063a0001c0001t0001g0065others(99): Show | 102 | 337 | 0.3027 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-5069C>T | ||||||
|
chr17:1018263
|
T | C | intron_variant | MODIFIER | HG00408.hp1 HG01081.hp2 HG01106.hp2 others(47): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(1): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(29): Show | a0001c0001t0001g0101a0001c0001t0001g0148a0001c0001t0001g0194others(47): Show | 50 | 337 | 0.1484 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-5099A>G | ||||||
|
chr17:1018568
|
C | T | intron_variant | MODIFIER | HG01109.hp2 HG01192.hp2 HG01243.hp2 others(5): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(1): Show | a0001c0001t0029a0001c0001t0043a0001c0002t0085others(4): Show | a0001c0001t0029g0116a0001c0001t0029g0177a0001c0001t0043g0008others(5): Show | 8 | 337 | 0.0237 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-5404G>A | ||||||
|
chr17:1018606
|
C | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(230): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(85): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0063others(230): Show | 233 | 337 | 0.6914 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-5442G>C | ||||||
|
chr17:1019470
|
TCTGCTGC others(17): Show |
T | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(226): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0003others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(79): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0063others(226): Show | 229 | 337 | 0.6795 | -24 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-6330_1792-6307delGCACCAGGGCCACACCTGCAGCAG | ||||||
|
chr17:1019564
|
GCT | G | intron_variant | MODIFIER | HG00280.hp2 HG00323.hp1 HG01109.hp2 others(23): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(3): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0005others(17): Show | a0001c0001t0001g0181a0001c0001t0004g0252a0001c0001t0004g0329others(23): Show | 26 | 337 | 0.0772 | -2 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-6402_1792-6401delAG | ||||||
|
chr17:1020091
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00438.hp1 others(152): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(68): Show | a0001c0001t0001g0061a0001c0001t0001g0063a0001c0001t0001g0089others(152): Show | 155 | 337 | 0.4599 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-6927A>G | ||||||
|
chr17:1020372
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(262): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0003others(10): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(95): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0063others(262): Show | 265 | 337 | 0.7864 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-7208A>G | ||||||
|
chr17:1021533
|
C | T | intron_variant | MODIFIER | HG01243.hp2 HG01952.hp1 HG02809.hp2 others(1): Show |
a0001 | a0001c0001a0001c0004 | a0001c0001t0029a0001c0001t0039a0001c0001t0068others(1): Show | a0001c0001t0029g0116a0001c0001t0039g0010a0001c0001t0068g0160others(1): Show | 4 | 337 | 0.0119 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-8369G>A | ||||||
|
chr17:1022064
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp2 others(162): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(66): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0063others(162): Show | 165 | 337 | 0.4896 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-8900T>C | ||||||
|
chr17:1022120
|
A | AAAAAACA others(5): Show |
intron_variant | MODIFIER | HG06807.hp1 | a0001 | a0001c0004 | a0001c0004t0037 | a0001c0004t0037g0017 | 1 | 337 | 0.0030 | 12 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-8957_1792-8956insGTTTTTGTTTTT | ||||||
|
chr17:1022524
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp2 others(168): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(72): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0063others(168): Show | 171 | 337 | 0.5074 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-9360T>C | ||||||
|
chr17:1022881
|
G | A | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp2 others(167): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(72): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0063others(167): Show | 170 | 337 | 0.5045 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-9717C>T | ||||||
|
chr17:1023098
|
T | TCTGCCGG others(22): Show |
intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp2 others(102): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(3): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(43): Show | a0001c0001t0001g0061a0001c0001t0001g0089a0001c0001t0001g0124others(102): Show | 105 | 337 | 0.3116 | 29 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-9935_1792-9934insTGGCTCTGCAGTGGACGTGGGGCCGGCAG | ||||||
|
chr17:1023119
|
A | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp2 others(129): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(52): Show | a0001c0001t0001g0061a0001c0001t0001g0089a0001c0001t0001g0124others(129): Show | 132 | 337 | 0.3917 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-9955T>G | ||||||
|
chr17:1023123
|
C | A | intron_variant | MODIFIER | HG00639.hp2 HG00642.hp1 HG01070.hp1 others(30): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(1): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0005others(21): Show | a0001c0001t0001g0058a0001c0001t0001g0063a0001c0001t0001g0065others(30): Show | 33 | 337 | 0.0979 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-9959G>T | ||||||
|
chr17:1023500
|
G | A | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp2 others(167): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(70): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0063others(167): Show | 170 | 337 | 0.5045 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-10336C>T | ||||||
|
chr17:1024024
|
CA | C | intron_variant | MODIFIER | HG00280.hp1 HG00323.hp2 HG00408.hp1 others(93): Show |
a0001a0002a0005 | a0001c0001a0001c0002a0001c0003others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(46): Show | a0001c0001t0001g0001a0001c0001t0001g0056a0001c0001t0001g0071others(92): Show | 96 | 337 | 0.2849 | -1 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-10861delT | ||||||
|
chr17:1024253
|
G | A | intron_variant | MODIFIER | HG01891.hp1 HG06807.hp1 |
a0001 | a0001c0003a0001c0004 | a0001c0003t0012a0001c0004t0037 | a0001c0003t0012g0105a0001c0004t0037g0017 | 2 | 337 | 0.0059 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-11089C>T | ||||||
|
chr17:1024276
|
A | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp2 others(155): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(64): Show | a0001c0001t0001g0058a0001c0001t0001g0061a0001c0001t0001g0063others(155): Show | 158 | 337 | 0.4688 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-11112T>G | ||||||
|
chr17:1024315
|
G | A | intron_variant | MODIFIER | HG00597.hp1 HG01361.hp1 HG01891.hp1 others(27): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(3): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(20): Show | a0001c0001t0001g0133a0001c0001t0001g0181a0001c0001t0003g0237others(27): Show | 30 | 337 | 0.0890 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-11151C>T | ||||||
|
chr17:1024462
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(243): Show |
a0001a0002a0005 | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(89): Show | a0001c0001t0001g0001a0001c0001t0001g0056a0001c0001t0001g0058others(242): Show | 246 | 337 | 0.7300 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-11298T>C | ||||||
|
chr17:1024783
|
CAAA | C | intron_variant | MODIFIER | HG00280.hp1 HG00323.hp2 HG00408.hp1 others(118): Show |
a0001a0002a0005 | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(55): Show | a0001c0001t0001g0001a0001c0001t0001g0061a0001c0001t0001g0071others(117): Show | 121 | 337 | 0.3591 | -3 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-11622_1792-11620delTTT | ||||||
|
chr17:1024977
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(247): Show |
a0001a0002a0005 | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(90): Show | a0001c0001t0001g0001a0001c0001t0001g0056a0001c0001t0001g0058others(246): Show | 250 | 337 | 0.7418 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-11813A>G | ||||||
|
chr17:1025071
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(246): Show |
a0001a0002a0005 | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(90): Show | a0001c0001t0001g0001a0001c0001t0001g0056a0001c0001t0001g0058others(245): Show | 249 | 337 | 0.7389 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-11907T>C | ||||||
|
chr17:1025477
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(247): Show |
a0001a0002a0005 | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(90): Show | a0001c0001t0001g0001a0001c0001t0001g0056a0001c0001t0001g0058others(246): Show | 250 | 337 | 0.7418 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-12313A>G | ||||||
|
chr17:1025971
|
C | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(223): Show |
a0001a0002a0005 | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(82): Show | a0001c0001t0001g0001a0001c0001t0001g0056a0001c0001t0001g0058others(222): Show | 226 | 337 | 0.6706 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-12807G>C | ||||||
|
chr17:1027976
|
T | G | intron_variant | MODIFIER | HG00438.hp1 HG00544.hp1 HG00597.hp2 others(60): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(3): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(39): Show | a0001c0001t0001g0124a0001c0001t0001g0133a0001c0001t0001g0135others(60): Show | 63 | 337 | 0.1869 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-14812A>C | ||||||
|
chr17:1028139
|
G | A | intron_variant | MODIFIER | HG00438.hp1 HG00544.hp1 HG00597.hp2 others(28): Show |
a0001 | a0001c0001a0001c0003a0001c0004others(1): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(15): Show | a0001c0001t0001g0064a0001c0001t0001g0082a0001c0001t0001g0083others(28): Show | 31 | 337 | 0.0920 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-14975C>T | ||||||
|
chr17:1028351
|
T | A | intron_variant | MODIFIER | HG01891.hp1 HG06807.hp1 |
a0001 | a0001c0003a0001c0004 | a0001c0003t0012a0001c0004t0037 | a0001c0003t0012g0105a0001c0004t0037g0017 | 2 | 337 | 0.0059 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-15187A>T | ||||||
|
chr17:1028697
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(330): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(12): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(108): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0056others(329): Show | 333 | 337 | 0.9881 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-15533T>C | ||||||
|
chr17:1028753
|
C | G | intron_variant | MODIFIER | HG00280.hp1 HG00323.hp2 HG00408.hp2 others(229): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0003others(10): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(81): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0058others(228): Show | 232 | 337 | 0.6884 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-15589G>C | ||||||
|
chr17:1028783
|
G | A | intron_variant | MODIFIER | HG00408.hp2 HG00438.hp2 HG00597.hp1 others(153): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(62): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0063others(152): Show | 156 | 337 | 0.4629 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-15619C>T | ||||||
|
chr17:1029102
|
CA | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp2 others(219): Show |
a0001a0002a0004others(1): Show | a0001c0001a0001c0002a0001c0003others(10): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(88): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0058others(218): Show | 222 | 337 | 0.6588 | -1 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-15939delT | ||||||
|
chr17:1029283
|
C | T | intron_variant | MODIFIER | HG00323.hp2 HG00408.hp2 HG00438.hp2 others(162): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(58): Show | a0001c0001t0001g0054a0001c0001t0001g0058a0001c0001t0001g0063others(162): Show | 165 | 337 | 0.4896 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-16119G>A | ||||||
|
chr17:1029531
|
C | T | intron_variant | MODIFIER | HG06807.hp1 | a0001 | a0001c0004 | a0001c0004t0037 | a0001c0004t0037g0017 | 1 | 337 | 0.0030 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-16367G>A | ||||||
|
chr17:1029909
|
T | TCCCTCCG others(54): Show |
intron_variant | MODIFIER | HG01167.hp2 HG01192.hp2 HG01261.hp2 others(42): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(3): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0006others(33): Show | a0001c0001t0001g0135a0001c0001t0001g0226a0001c0001t0003g0112others(42): Show | 45 | 337 | 0.1335 | 61 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-16746_1792-16745insTCGTCTGCCACAGTGTGTCCGTGTCATGGACGCAGGGGTCAGCGCTGTGGTGGACGGAGGG | ||||||
|
chr17:1029920
|
G | A | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(308): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(12): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(104): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0058others(307): Show | 311 | 337 | 0.9229 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-16756C>T | ||||||
|
chr17:1029967
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(260): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(12): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(94): Show | a0001c0001t0001g0001a0001c0001t0001g0058a0001c0001t0001g0061others(259): Show | 263 | 337 | 0.7804 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-16803T>C | ||||||
|
chr17:1030838
|
A | T | intron_variant | MODIFIER | HG01192.hp2 HG01884.hp2 HG02145.hp2 others(17): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(1): Show | a0001c0001t0001a0001c0001t0007a0001c0001t0008others(16): Show | a0001c0001t0001g0124a0001c0001t0001g0226a0001c0001t0007g0280others(17): Show | 20 | 337 | 0.0594 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-17674T>A | ||||||
|
chr17:1030916
|
G | A | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(313): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(12): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(105): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0058others(312): Show | 316 | 337 | 0.9377 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-17752C>T | ||||||
|
chr17:1031513
|
TCAGCCCC others(2): Show |
T | intron_variant | MODIFIER | HG00140.hp2 HG00280.hp1 HG00280.hp2 others(154): Show |
a0001a0005 | a0001c0001a0001c0002a0001c0003others(7): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(64): Show | a0001c0001t0001g0001a0001c0001t0001g0056a0001c0001t0001g0061others(153): Show | 157 | 337 | 0.4659 | -9 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1792-18358_1792-18350delCGGGGGCTG | ||||||
|
chr17:1032233
|
T | C | intron_variant | MODIFIER | HG00140.hp2 HG00639.hp2 HG00642.hp1 others(80): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(3): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(37): Show | a0001c0001t0001g0056a0001c0001t0001g0058a0001c0001t0001g0071others(80): Show | 83 | 337 | 0.2463 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+17817A>G | ||||||
|
chr17:1033060
|
T | C | intron_variant | MODIFIER | HG00140.hp2 HG00323.hp2 HG00639.hp1 others(101): Show |
a0001a0002 | a0001c0001a0001c0002a0001c0003others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(49): Show | a0001c0001t0001g0054a0001c0001t0001g0058a0001c0001t0001g0065others(101): Show | 104 | 337 | 0.3086 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+16990A>G | ||||||
|
chr17:1033611
|
A | G | intron_variant | MODIFIER | HG00140.hp2 HG00323.hp2 HG00639.hp1 others(165): Show |
a0001a0002 | a0001c0001a0001c0002a0001c0003others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(71): Show | a0001c0001t0001g0054a0001c0001t0001g0056a0001c0001t0001g0058others(165): Show | 168 | 337 | 0.4985 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+16439T>C | ||||||
|
chr17:1034631
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(332): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(12): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(109): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0056others(331): Show | 335 | 337 | 0.9941 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+15419T>C | ||||||
|
chr17:1035495
|
C | CCCCCCAC others(1612): Show |
intron_variant | MODIFIER | HG06807.hp1 | a0001 | a0001c0004 | a0001c0004t0037 | a0001c0004t0037g0017 | 1 | 337 | 0.0030 | 1619 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+14554_1791+14555insAGCAGCTGTGGGGGATGGAAGGAGTGGGGGGGAGCAGGTGTGGGTGATGGAAGGGGTGGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGGAGCAGGTGGGGGTAGAAAGGGTGGGGGGAGCAGGTGTGGGGGATGGAAGGGGTAGGGGGAGCAGGTATGGGGGATGGAAGGGGTAGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGGAACAGGTGTGGGGGATGGAAGGGGTAGGGGGAGCACGTGTGGGGGATGGAAGGGGTGGGGGAGCAGGTGTGGGGGATGGAAGGGGAGGGGGAGCAGGTGTGGGAGATGGAAGGGGTGGGGGGAGCAGGTGGGGGTAGAAAGGGTGGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGAGCAGGTGTGGGGGATGGAAGGGGTAGGGGGGAACAGGTGTGGGGGATGGAAGGGGTAGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGGAGCAGGTGTGGGAGATGGAAGGGGTGGGGGGAGCAGGTGGGGGTAGAAAGGGTGGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGAGCAGGTGTGGGGGATGGAAGGGGTAGGGGGGAACAGGTGTGGGGGATGGAAGGGGTAGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGAGCAGGTGTGGGGGATGGAAGGGGTAGGGGGGAACAGGTGTAGCGGGATGGAAGGGGTGGGGGAGAAGGTGTAGGGGATGGAAGGGGTGGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGGAGCAGGTGTAGGGGGATGGAAGGGGTAGGGGGGAACAGGTGTGGGGGATGGAAGGGGTAGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGAGCAGGTGTGGGGGATGGAAGGGGTAGGGGGGAACAGGTGTAGCGGGATGGAAGGGGTGGGGGAGAAGGTGTAGGGGATGGAAGGGGTGGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGAGCAGGTGTGGGGGATGAAGGTGGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGAGCAGGTGTAGGGGGATGGAAGGGGTGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGAACAGGTGTGGGGGATGGAAGGGGTGGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGGAGCAGGTGTGGGGGATGGAAGGGGTGGGGGAACAGGTGTGGGGGATGGAAGGGGTGGGGG | ||||||
|
chr17:1037830
|
T | C | intron_variant | MODIFIER | HG00140.hp2 HG00280.hp2 HG00323.hp1 others(199): Show |
a0001a0002a0005 | a0001c0001a0001c0002a0001c0003others(7): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(82): Show | a0001c0001t0001g0054a0001c0001t0001g0058a0001c0001t0001g0065others(199): Show | 202 | 337 | 0.5994 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+12220A>G | ||||||
|
chr17:1038199
|
C | A | intron_variant | MODIFIER | HG00140.hp2 HG00323.hp2 HG00738.hp1 others(47): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(3): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(31): Show | a0001c0001t0001g0071a0001c0001t0001g0074a0001c0001t0001g0135others(47): Show | 50 | 337 | 0.1484 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+11851G>T | ||||||
|
chr17:1038952
|
A | C | intron_variant | MODIFIER | HG00140.hp2 HG00323.hp2 HG00408.hp1 others(143): Show |
a0001a0003a0004others(1): Show | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(68): Show | a0001c0001t0001g0054a0001c0001t0001g0063a0001c0001t0001g0065others(143): Show | 146 | 337 | 0.4332 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+11098T>G | ||||||
|
chr17:1038967
|
G | A | intron_variant | MODIFIER | HG00140.hp2 HG00323.hp2 HG00738.hp1 others(39): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(2): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(23): Show | a0001c0001t0001g0071a0001c0001t0001g0074a0001c0001t0001g0135others(39): Show | 42 | 337 | 0.1246 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+11083C>T | ||||||
|
chr17:1039494
|
T | G | intron_variant | MODIFIER | HG00140.hp2 HG00323.hp2 HG00408.hp1 others(139): Show |
a0001a0003a0004others(1): Show | a0001c0001a0001c0002a0001c0003others(7): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(69): Show | a0001c0001t0001g0054a0001c0001t0001g0063a0001c0001t0001g0065others(139): Show | 142 | 337 | 0.4214 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+10556A>C | ||||||
|
chr17:1040135
|
T | C | intron_variant | MODIFIER | HG00140.hp2 HG00323.hp2 HG00408.hp1 others(135): Show |
a0001a0003a0004others(1): Show | a0001c0001a0001c0002a0001c0003others(7): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(69): Show | a0001c0001t0001g0054a0001c0001t0001g0063a0001c0001t0001g0065others(135): Show | 138 | 337 | 0.4095 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+9915A>G | ||||||
|
chr17:1041297
|
G | A | intron_variant | MODIFIER | HG06807.hp1 | a0001 | a0001c0004 | a0001c0004t0037 | a0001c0004t0037g0017 | 1 | 337 | 0.0030 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+8753C>T | ||||||
|
chr17:1041450
|
C | T | intron_variant | MODIFIER | HG00408.hp1 HG00408.hp2 HG00544.hp2 others(57): Show |
a0001a0003a0004others(1): Show | a0001c0001a0001c0002a0001c0003others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(30): Show | a0001c0001t0001g0054a0001c0001t0001g0063a0001c0001t0001g0065others(57): Show | 60 | 337 | 0.1780 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+8600G>A | ||||||
|
chr17:1042176
|
GGACA | G | intron_variant | MODIFIER | HG00408.hp1 HG00408.hp2 HG00544.hp2 others(58): Show |
a0001a0003a0004others(1): Show | a0001c0001a0001c0002a0001c0003others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(30): Show | a0001c0001t0001g0054a0001c0001t0001g0063a0001c0001t0001g0065others(58): Show | 61 | 337 | 0.1810 | -4 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+7870_1791+7873delTGTC | ||||||
|
chr17:1042290
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(262): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(11): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(90): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0063others(261): Show | 265 | 337 | 0.7864 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+7760A>G | ||||||
|
chr17:1042324
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(316): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(12): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(104): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0061others(315): Show | 319 | 337 | 0.9466 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+7726T>C | ||||||
|
chr17:1043993
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00280.hp1 HG00280.hp2 others(218): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(73): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0063others(217): Show | 221 | 337 | 0.6558 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+6057T>C | ||||||
|
chr17:1044199
|
A | AG | intron_variant | MODIFIER | HG00140.hp1 HG00280.hp1 HG00280.hp2 others(214): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(72): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0063others(213): Show | 217 | 337 | 0.6439 | 1 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+5850dupC | ||||||
|
chr17:1044283
|
G | A | intron_variant | MODIFIER | HG00408.hp1 HG00408.hp2 HG00544.hp2 others(58): Show |
a0001a0003a0004others(1): Show | a0001c0001a0001c0002a0001c0003others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(30): Show | a0001c0001t0001g0054a0001c0001t0001g0063a0001c0001t0001g0065others(58): Show | 61 | 337 | 0.1810 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+5767C>T | ||||||
|
chr17:1044387
|
G | C | intron_variant | MODIFIER | HG00140.hp1 HG00280.hp1 HG00280.hp2 others(218): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(73): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0063others(217): Show | 221 | 337 | 0.6558 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+5663C>G | ||||||
|
chr17:1044423
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00280.hp1 HG00280.hp2 others(218): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(73): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0063others(217): Show | 221 | 337 | 0.6558 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+5627T>C | ||||||
|
chr17:1044600
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(258): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(11): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(88): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0063others(257): Show | 261 | 337 | 0.7745 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+5450T>C | ||||||
|
chr17:1044616
|
A | C | intron_variant | MODIFIER | HG00140.hp1 HG00280.hp1 HG00280.hp2 others(218): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(73): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0063others(217): Show | 221 | 337 | 0.6558 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+5434T>G | ||||||
|
chr17:1044650
|
CAA | C | intron_variant | MODIFIER | HG01109.hp2 HG02622.hp2 HG03209.hp1 others(4): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(1): Show | a0001c0001t0001a0001c0002t0038a0001c0002t0053others(4): Show | a0001c0001t0001g0133a0001c0002t0038g0013a0001c0002t0053g0070others(4): Show | 7 | 337 | 0.0208 | -2 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+5398_1791+5399delTT | ||||||
|
chr17:1044819
|
C | T | intron_variant | MODIFIER | HG00408.hp1 HG00408.hp2 HG00544.hp2 others(62): Show |
a0001a0003a0004others(1): Show | a0001c0001a0001c0002a0001c0003others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(34): Show | a0001c0001t0001g0054a0001c0001t0001g0063a0001c0001t0001g0065others(62): Show | 65 | 337 | 0.1929 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+5231G>A | ||||||
|
chr17:1044820
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00280.hp1 HG00280.hp2 others(218): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(73): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0063others(217): Show | 221 | 337 | 0.6558 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+5230T>C | ||||||
|
chr17:1045331
|
C | A | intron_variant | MODIFIER | HG00140.hp2 HG00408.hp1 HG00408.hp2 others(85): Show |
a0001a0003a0004others(1): Show | a0001c0001a0001c0002a0001c0003others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(41): Show | a0001c0001t0001g0054a0001c0001t0001g0063a0001c0001t0001g0065others(85): Show | 88 | 337 | 0.2611 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+4719G>T | ||||||
|
chr17:1045572
|
T | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(263): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0003others(11): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(89): Show | a0001c0001t0001g0001a0001c0001t0001g0054a0001c0001t0001g0058others(262): Show | 266 | 337 | 0.7893 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+4478A>C | ||||||
|
chr17:1045714
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00280.hp1 HG00280.hp2 others(161): Show |
a0001a0002 | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(58): Show | a0001c0001t0001g0001a0001c0001t0001g0064a0001c0001t0001g0069others(160): Show | 164 | 337 | 0.4867 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+4336A>G | ||||||
|
chr17:1046020
|
G | A | intron_variant | MODIFIER | HG00140.hp2 HG00323.hp2 HG00408.hp1 others(103): Show |
a0001a0003a0004others(1): Show | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(49): Show | a0001c0001t0001g0054a0001c0001t0001g0058a0001c0001t0001g0063others(103): Show | 106 | 337 | 0.3145 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+4030C>T | ||||||
|
chr17:1046028
|
G | A | intron_variant | MODIFIER | HG00140.hp1 HG00280.hp1 HG00280.hp2 others(161): Show |
a0001a0002 | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(58): Show | a0001c0001t0001g0001a0001c0001t0001g0064a0001c0001t0001g0069others(160): Show | 164 | 337 | 0.4867 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+4022C>T | ||||||
|
chr17:1046287
|
G | A | intron_variant | MODIFIER | HG03209.hp1 HG03516.hp2 HG06807.hp1 others(1): Show |
a0001 | a0001c0002a0001c0003a0001c0004 | a0001c0002t0053a0001c0002t0092a0001c0003t0012others(1): Show | a0001c0002t0053g0070a0001c0002t0092g0336a0001c0003t0012g0119others(1): Show | 4 | 337 | 0.0119 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+3763C>T | ||||||
|
chr17:1046357
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00280.hp1 HG00280.hp2 others(175): Show |
a0001a0002 | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(63): Show | a0001c0001t0001g0001a0001c0001t0001g0069a0001c0001t0001g0071others(174): Show | 178 | 337 | 0.5282 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+3693A>G | ||||||
|
chr17:1046415
|
C | T | intron_variant | MODIFIER | HG00280.hp1 HG00438.hp2 HG00544.hp1 others(104): Show |
a0001a0002 | a0001c0001a0001c0002a0001c0003others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(49): Show | a0001c0001t0001g0001a0001c0001t0001g0069a0001c0001t0001g0083others(103): Show | 107 | 337 | 0.3175 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+3635G>A | ||||||
|
chr17:1046539
|
G | A | intron_variant | MODIFIER | HG03209.hp1 HG03516.hp2 HG06807.hp1 others(1): Show |
a0001 | a0001c0002a0001c0003a0001c0004 | a0001c0002t0053a0001c0002t0092a0001c0003t0012others(1): Show | a0001c0002t0053g0070a0001c0002t0092g0336a0001c0003t0012g0119others(1): Show | 4 | 337 | 0.0119 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+3511C>T | ||||||
|
chr17:1046543
|
G | A | intron_variant | MODIFIER | HG00140.hp1 HG00280.hp1 HG00280.hp2 others(162): Show |
a0001a0002 | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(58): Show | a0001c0001t0001g0001a0001c0001t0001g0065a0001c0001t0001g0069others(161): Show | 165 | 337 | 0.4896 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+3507C>T | ||||||
|
chr17:1046596
|
G | A | intron_variant | MODIFIER | HG03209.hp1 HG03516.hp2 HG06807.hp1 others(1): Show |
a0001 | a0001c0002a0001c0003a0001c0004 | a0001c0002t0053a0001c0002t0092a0001c0003t0012others(1): Show | a0001c0002t0053g0070a0001c0002t0092g0336a0001c0003t0012g0119others(1): Show | 4 | 337 | 0.0119 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+3454C>T | ||||||
|
chr17:1046951
|
G | A | intron_variant | MODIFIER | HG00140.hp1 HG00280.hp1 HG00280.hp2 others(163): Show |
a0001a0002 | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(59): Show | a0001c0001t0001g0001a0001c0001t0001g0069a0001c0001t0001g0083others(162): Show | 166 | 337 | 0.4926 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+3099C>T | ||||||
|
chr17:1047023
|
G | T | intron_variant | MODIFIER | HG03209.hp1 HG03516.hp2 HG06807.hp1 others(1): Show |
a0001 | a0001c0002a0001c0003a0001c0004 | a0001c0002t0053a0001c0002t0092a0001c0003t0012others(1): Show | a0001c0002t0053g0070a0001c0002t0092g0336a0001c0003t0012g0119others(1): Show | 4 | 337 | 0.0119 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+3027C>A | ||||||
|
chr17:1047339
|
C | T | intron_variant | MODIFIER | HG03209.hp1 HG03516.hp2 HG06807.hp1 others(1): Show |
a0001 | a0001c0002a0001c0003a0001c0004 | a0001c0002t0053a0001c0002t0092a0001c0003t0012others(1): Show | a0001c0002t0053g0070a0001c0002t0092g0336a0001c0003t0012g0119others(1): Show | 4 | 337 | 0.0119 | 0 | ABR | ENSG00000159842.16 | transcript | ENST00000302538.10 | protein_coding | 16/22 | c.1791+2711G>A | ||||||
|
chr17:1047480
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(192): Show |
a0001a0002a0005 | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(65): Show | a0001c0001t0001g0001a0001c0001t0001g0069a0001c0001t0001g0071others(191): Show |