| geneid | 390928 |
|---|---|
| ensemblid | ENSG00000183760.11 |
| hgncid | 33781 |
| symbol | ACP7 |
| name | acid phosphatase 7, tartrate resistant (putative) |
| refseq_nuc | NM_001004318.3 |
| refseq_prot | NP_001004318.2 |
| ensembl_nuc | ENST00000331256.10 |
| ensembl_prot | ENSP00000327557.4 |
| mane_status | MANE Select |
| chr | chr19 |
| start | 39084368 |
| end | 39111493 |
| strand | + |
| ver | v1.2 |
| region | chr19:39084368-39111493 |
| region5000 | chr19:39079368-39116493 |
| regionname0 | ACP7_chr19_39084368_39111493 |
| regionname5000 | ACP7_chr19_39079368_39116493 |
| chr:pos | ref | alt | af | annotation | impact | samples | AHAPIDS | ACHAPIDS | ACTHAPIDS | ACTGHAPIDS | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr19:39101498
|
C | T | 0.1990 | synonymous_variant | LOW | HG00140.hp2 HG00423.hp1 HG00621.hp1 others(77): Show |
a0001a0002a0004 | a0001c0004a0001c0006a0001c0008others(3): Show | a0001c0004t0002a0001c0004t0004a0001c0004t0005others(13): Show | a0001c0004t0002g0203a0001c0004t0004g0033a0001c0004t0004g0034others(77): Show | 80 | 402 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 11/13 | c.1074C>T | p.Thr358Thr | 1285/2903 | 1074/1317 | 358/438 |
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr19:39085110
|
T | C | 0.2338 | 5_prime_UTR_variant | MODIFIER | HG00408.hp1 HG00408.hp2 HG00438.hp2 others(91): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(5): Show | a0001c0001t0011a0001c0001t0014a0001c0001t0015others(16): Show | a0001c0001t0011g0166a0001c0001t0011g0167a0001c0001t0011g0168others(91): Show | 94 | 402 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/13 | c.-160T>C | 160 | |||||
|
chr19:39085130
|
C | CCCT | 0.2264 | 5_prime_UTR_variant | MODIFIER | HG00408.hp2 HG00438.hp2 HG00544.hp1 others(88): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(5): Show | a0001c0001t0011a0001c0001t0014a0001c0001t0015others(16): Show | a0001c0001t0011g0166a0001c0001t0011g0167a0001c0001t0011g0168others(88): Show | 91 | 402 | 3 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/13 | c.-139_-137dupCCT | 136 | INFO_REALIGN_3_PRIME | ||||
|
chr19:39110899
|
C | T | 0.1294 | 3_prime_UTR_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00544.hp2 others(49): Show |
a0001a0002a0004 | a0001c0001a0001c0003a0001c0004others(3): Show | a0001c0001t0004a0001c0003t0020a0001c0004t0004others(5): Show | a0001c0001t0004g0327a0001c0001t0004g0374a0001c0003t0020g0264others(49): Show | 52 | 402 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 13/13 | c.*781C>T | 781 |
| chr:pos | ref | alt | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | af | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr19:39084536
|
AG | A | intron_variant | MODIFIER | HG00280.hp1 HG00408.hp1 HG00408.hp2 others(199): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0003others(12): Show | a0001c0001t0001a0001c0001t0006a0001c0001t0011others(34): Show | a0001c0001t0001g0028a0001c0001t0001g0029a0001c0001t0001g0030others(199): Show | 202 | 402 | 0.5025 | -1 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 1/12 | c.-179+139delG | INFO_REALIGN_3_PRIME | |||||
|
chr19:39085949
|
T | G | intron_variant | MODIFIER | HG00099.hp1 HG00280.hp1 HG00408.hp1 others(212): Show |
a0001a0002a0004 | a0001c0001a0001c0002a0001c0003others(11): Show | a0001c0001t0001a0001c0001t0006a0001c0001t0011others(36): Show | a0001c0001t0001g0028a0001c0001t0001g0029a0001c0001t0001g0030others(212): Show | 215 | 402 | 0.5348 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.121+559T>G | ||||||
|
chr19:39085953
|
C | T | intron_variant | MODIFIER | HG00099.hp1 HG00408.hp1 HG00408.hp2 others(106): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(4): Show | a0001c0001t0001a0001c0001t0011a0001c0001t0015others(20): Show | a0001c0001t0001g0201a0001c0001t0001g0230a0001c0001t0011g0166others(106): Show | 109 | 402 | 0.2711 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.121+563C>T | ||||||
|
chr19:39086104
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00408.hp1 HG00408.hp2 others(117): Show |
a0001 | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0001a0001c0001t0011a0001c0001t0015others(24): Show | a0001c0001t0001g0201a0001c0001t0001g0230a0001c0001t0011g0166others(117): Show | 120 | 402 | 0.2985 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.121+714A>G | ||||||
|
chr19:39086641
|
A | AG | intron_variant | MODIFIER | HG00099.hp2 HG00408.hp1 HG00408.hp2 others(131): Show |
a0001a0006 | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0011others(26): Show | a0001c0001t0001g0201a0001c0001t0001g0204a0001c0001t0001g0225others(131): Show | 134 | 402 | 0.3333 | 1 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.121+1261dupG | INFO_REALIGN_3_PRIME | |||||
|
chr19:39086659
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00280.hp1 HG00408.hp1 others(199): Show |
a0001a0002a0004 | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0006a0001c0001t0011others(32): Show | a0001c0001t0001g0028a0001c0001t0001g0029a0001c0001t0001g0030others(199): Show | 202 | 402 | 0.5025 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.121+1269T>C | ||||||
|
chr19:39086724
|
A | C | intron_variant | MODIFIER | HG00099.hp1 HG00280.hp1 HG00408.hp1 others(195): Show |
a0001a0002a0004 | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0011a0001c0001t0015others(30): Show | a0001c0001t0001g0028a0001c0001t0001g0029a0001c0001t0001g0030others(195): Show | 198 | 402 | 0.4925 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.121+1334A>C | ||||||
|
chr19:39086788
|
G | C | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00280.hp1 others(275): Show |
a0001a0002a0004others(1): Show | a0001c0001a0001c0002a0001c0003others(12): Show | a0001c0001t0001a0001c0001t0006a0001c0001t0011others(43): Show | a0001c0001t0001g0028a0001c0001t0001g0029a0001c0001t0001g0030others(272): Show | 278 | 402 | 0.6915 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.121+1398G>C | ||||||
|
chr19:39087100
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00280.hp1 HG00408.hp1 others(192): Show |
a0001a0002a0004 | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0011a0001c0001t0015others(29): Show | a0001c0001t0001g0028a0001c0001t0001g0029a0001c0001t0001g0030others(192): Show | 195 | 402 | 0.4851 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.121+1710G>A | ||||||
|
chr19:39087632
|
GT | G | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00280.hp1 others(243): Show |
a0001a0002a0004 | a0001c0001a0001c0002a0001c0003others(11): Show | a0001c0001t0001a0001c0001t0011a0001c0001t0015others(34): Show | a0001c0001t0001g0028a0001c0001t0001g0029a0001c0001t0001g0030others(240): Show | 246 | 402 | 0.6119 | -1 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.121+2261delT | INFO_REALIGN_3_PRIME | |||||
|
chr19:39087638
|
T | G | intron_variant | MODIFIER | HG00099.hp1 HG00280.hp1 HG00408.hp1 others(179): Show |
a0001a0002a0004 | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0011a0001c0001t0015others(26): Show | a0001c0001t0001g0028a0001c0001t0001g0029a0001c0001t0001g0030others(179): Show | 182 | 402 | 0.4527 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.121+2248T>G | ||||||
|
chr19:39087643
|
T | G | intron_variant | MODIFIER | HG00099.hp1 HG00280.hp1 HG00408.hp1 others(179): Show |
a0001a0002a0004 | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0011a0001c0001t0015others(26): Show | a0001c0001t0001g0028a0001c0001t0001g0029a0001c0001t0001g0030others(179): Show | 182 | 402 | 0.4527 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.121+2253T>G | ||||||
|
chr19:39087648
|
T | G | intron_variant | MODIFIER | HG00099.hp1 HG00280.hp1 HG00408.hp1 others(178): Show |
a0001a0002a0004 | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0011a0001c0001t0015others(26): Show | a0001c0001t0001g0028a0001c0001t0001g0029a0001c0001t0001g0030others(178): Show | 181 | 402 | 0.4503 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.121+2258T>G | ||||||
|
chr19:39087909
|
C | T | intron_variant | MODIFIER | HG00099.hp1 HG00280.hp1 HG00408.hp1 others(182): Show |
a0001a0002a0004 | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0011a0001c0001t0015others(27): Show | a0001c0001t0001g0032a0001c0001t0001g0036a0001c0001t0001g0040others(182): Show | 185 | 402 | 0.4602 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.121+2519C>T | ||||||
|
chr19:39088419
|
C | T | intron_variant | MODIFIER | HG00280.hp1 HG00423.hp1 HG00621.hp1 others(81): Show |
a0001a0002a0004 | a0001c0001a0001c0002a0001c0003others(4): Show | a0001c0001t0001a0001c0001t0015a0001c0002t0002others(13): Show | a0001c0001t0001g0036a0001c0001t0001g0040a0001c0001t0001g0049others(81): Show | 84 | 402 | 0.2090 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.121+3029C>T | ||||||
|
chr19:39088934
|
AT | A | intron_variant | MODIFIER | HG00280.hp1 HG00423.hp1 HG00621.hp1 others(86): Show |
a0001a0002a0004 | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0001a0001c0001t0015a0001c0002t0002others(15): Show | a0001c0001t0001g0036a0001c0001t0001g0040a0001c0001t0001g0049others(86): Show | 89 | 402 | 0.2214 | -1 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.121+3557delT | INFO_REALIGN_3_PRIME | |||||
|
chr19:39089358
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp2 others(328): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0002a0001c0003others(15): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0006others(50): Show | a0001c0001t0001g0028a0001c0001t0001g0029a0001c0001t0001g0030others(328): Show | 331 | 402 | 0.8234 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.121+3968A>G | ||||||
|
chr19:39090097
|
A | G | intron_variant | MODIFIER | HG00423.hp1 HG00621.hp1 HG00673.hp1 others(102): Show |
a0001a0002a0004 | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0015a0001c0002t0002others(20): Show | a0001c0001t0001g0040a0001c0001t0001g0049a0001c0001t0001g0083others(102): Show | 105 | 402 | 0.2612 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.121+4707A>G | ||||||
|
chr19:39090790
|
C | CT | intron_variant | MODIFIER | HG00099.hp2 HG00140.hp2 HG00280.hp2 others(130): Show |
a0001a0002a0004others(1): Show | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0013others(23): Show | a0001c0001t0001g0032a0001c0001t0001g0049a0001c0001t0001g0080others(130): Show | 133 | 402 | 0.3309 | 1 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.121+5417dupT | INFO_REALIGN_3_PRIME | |||||
|
chr19:39091478
|
T | C | intron_variant | MODIFIER | HG00423.hp1 HG00621.hp1 HG00673.hp1 others(89): Show |
a0001a0002a0004 | a0001c0001a0001c0002a0001c0003others(5): Show | a0001c0001t0001a0001c0001t0015a0001c0002t0002others(15): Show | a0001c0001t0001g0040a0001c0001t0001g0049a0001c0001t0001g0083others(89): Show | 92 | 402 | 0.2289 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.121+6088T>C | ||||||
|
chr19:39092370
|
GTATA | G | intron_variant | MODIFIER | HG00099.hp2 HG00140.hp2 HG00280.hp1 others(217): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0002a0001c0003others(14): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0006others(34): Show | a0001c0001t0001g0028a0001c0001t0001g0029a0001c0001t0001g0030others(217): Show | 220 | 402 | 0.5473 | -4 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.122-6067_122-6064delTATA | INFO_REALIGN_3_PRIME | |||||
|
chr19:39092376
|
A | G | intron_variant | MODIFIER | HG00423.hp1 HG00673.hp1 HG00741.hp2 others(95): Show |
a0001a0002a0004 | a0001c0001a0001c0002a0001c0003others(7): Show | a0001c0001t0001a0001c0001t0015a0001c0002t0002others(15): Show | a0001c0001t0001g0040a0001c0001t0001g0049a0001c0001t0001g0083others(95): Show | 98 | 402 | 0.2438 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.122-6082A>G | ||||||
|
chr19:39092520
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp2 others(321): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0002a0001c0003others(15): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0006others(47): Show | a0001c0001t0001g0028a0001c0001t0001g0029a0001c0001t0001g0030others(321): Show | 324 | 402 | 0.8060 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.122-5938G>A | ||||||
|
chr19:39092728
|
C | A | intron_variant | MODIFIER | HG00423.hp1 HG00621.hp1 HG00673.hp1 others(81): Show |
a0001a0002a0004 | a0001c0001a0001c0002a0001c0003others(4): Show | a0001c0001t0001a0001c0001t0015a0001c0002t0002others(13): Show | a0001c0001t0001g0040a0001c0001t0001g0049a0001c0001t0001g0083others(81): Show | 84 | 402 | 0.2090 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.122-5730C>A | ||||||
|
chr19:39092771
|
C | CT | intron_variant | MODIFIER | HG00423.hp1 HG00673.hp1 HG00741.hp2 others(93): Show |
a0001a0002a0004 | a0001c0001a0001c0002a0001c0003others(8): Show | a0001c0001t0001a0001c0001t0011a0001c0001t0015others(23): Show | a0001c0001t0001g0049a0001c0001t0001g0083a0001c0001t0001g0097others(93): Show | 96 | 402 | 0.2388 | 1 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.122-5663dupT | INFO_REALIGN_3_PRIME | |||||
|
chr19:39093099
|
T | TTTCC | intron_variant | MODIFIER | HG00423.hp1 HG00621.hp1 HG00673.hp1 others(82): Show |
a0001a0002a0004 | a0001c0001a0001c0002a0001c0003others(4): Show | a0001c0001t0001a0001c0001t0015a0001c0002t0002others(13): Show | a0001c0001t0001g0040a0001c0001t0001g0049a0001c0001t0001g0083others(82): Show | 85 | 402 | 0.2114 | 4 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.122-5357_122-5356insCCTT | INFO_REALIGN_3_PRIME | |||||
|
chr19:39093141
|
C | CTGCT | intron_variant | MODIFIER | HG00099.hp2 HG00140.hp2 HG00280.hp1 others(212): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0002a0001c0003others(12): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0006others(33): Show | a0001c0001t0001g0028a0001c0001t0001g0029a0001c0001t0001g0030others(212): Show | 215 | 402 | 0.5348 | 4 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.122-5316_122-5315insGCTT | INFO_REALIGN_3_PRIME | |||||
|
chr19:39093143
|
C | T | intron_variant | MODIFIER | HG00099.hp2 HG00140.hp2 HG00280.hp1 others(235): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0002a0001c0003others(14): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0006others(39): Show | a0001c0001t0001g0028a0001c0001t0001g0029a0001c0001t0001g0030others(235): Show | 238 | 402 | 0.5920 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.122-5315C>T | ||||||
|
chr19:39093172
|
C | CTTTCTTT others(39): Show |
intron_variant | MODIFIER | HG00099.hp2 HG00597.hp1 HG00639.hp1 others(23): Show |
a0001 | a0001c0001a0001c0002a0001c0004others(2): Show | a0001c0001t0001a0001c0001t0015a0001c0002t0005others(5): Show | a0001c0001t0001g0032a0001c0001t0001g0308a0001c0001t0001g0310others(23): Show | 26 | 402 | 0.0647 | 46 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.122-5285_122-5284insTTCTTTCTTTCTTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTT | INFO_REALIGN_3_PRIME | |||||
|
chr19:39094502
|
CAA | C | intron_variant | MODIFIER | HG00423.hp1 HG00558.hp2 HG00621.hp1 others(86): Show |
a0001a0002a0004 | a0001c0001a0001c0002a0001c0003others(5): Show | a0001c0001t0001a0001c0001t0015a0001c0002t0002others(13): Show | a0001c0001t0001g0032a0001c0001t0001g0040a0001c0001t0001g0083others(86): Show | 89 | 402 | 0.2214 | -2 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.122-3942_122-3941delAA | INFO_REALIGN_3_PRIME | |||||
|
chr19:39097017
|
G | T | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00621.hp1 others(77): Show |
a0001a0002a0004 | a0001c0001a0001c0002a0001c0003others(4): Show | a0001c0001t0015a0001c0002t0002a0001c0002t0005others(12): Show | a0001c0001t0015g0199a0001c0002t0002g0147a0001c0002t0002g0160others(77): Show | 80 | 402 | 0.1990 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.122-1441G>T | ||||||
|
chr19:39097080
|
A | G | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00621.hp1 others(87): Show |
a0001a0002a0004 | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0015a0001c0002t0002a0001c0002t0005others(16): Show | a0001c0001t0015g0199a0001c0002t0002g0147a0001c0002t0002g0160others(87): Show | 90 | 402 | 0.2239 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.122-1378A>G | ||||||
|
chr19:39097255
|
C | T | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00621.hp1 others(83): Show |
a0001a0002a0004 | a0001c0002a0001c0003a0001c0004others(4): Show | a0001c0002t0002a0001c0002t0005a0001c0002t0021others(14): Show | a0001c0002t0002g0147a0001c0002t0002g0160a0001c0002t0002g0161others(83): Show | 86 | 402 | 0.2139 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.122-1203C>T | ||||||
|
chr19:39097308
|
T | C | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00621.hp1 others(84): Show |
a0001a0002a0004 | a0001c0002a0001c0003a0001c0004others(4): Show | a0001c0002t0002a0001c0002t0005a0001c0002t0021others(14): Show | a0001c0002t0002g0147a0001c0002t0002g0160a0001c0002t0002g0161others(84): Show | 87 | 402 | 0.2164 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.122-1150T>C | ||||||
|
chr19:39097335
|
C | G | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00621.hp1 others(84): Show |
a0001a0002a0004 | a0001c0002a0001c0003a0001c0004others(4): Show | a0001c0002t0002a0001c0002t0005a0001c0002t0021others(14): Show | a0001c0002t0002g0147a0001c0002t0002g0160a0001c0002t0002g0161others(84): Show | 87 | 402 | 0.2164 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.122-1123C>G | ||||||
|
chr19:39097352
|
G | A | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00621.hp1 others(84): Show |
a0001a0002a0004 | a0001c0002a0001c0003a0001c0004others(4): Show | a0001c0002t0002a0001c0002t0005a0001c0002t0021others(14): Show | a0001c0002t0002g0147a0001c0002t0002g0160a0001c0002t0002g0161others(84): Show | 87 | 402 | 0.2164 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.122-1106G>A | ||||||
|
chr19:39097359
|
C | T | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00621.hp1 others(83): Show |
a0001a0002a0004 | a0001c0002a0001c0003a0001c0004others(4): Show | a0001c0002t0002a0001c0002t0005a0001c0002t0021others(14): Show | a0001c0002t0002g0147a0001c0002t0002g0160a0001c0002t0002g0161others(83): Show | 86 | 402 | 0.2139 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.122-1099C>T | ||||||
|
chr19:39097399
|
C | CAAAAA | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00673.hp1 others(74): Show |
a0001a0002a0004 | a0001c0002a0001c0003a0001c0004others(4): Show | a0001c0002t0002a0001c0002t0005a0001c0002t0021others(13): Show | a0001c0002t0002g0147a0001c0002t0002g0160a0001c0002t0002g0161others(74): Show | 77 | 402 | 0.1915 | 5 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.122-1048_122-1044dupAAAAA | INFO_REALIGN_3_PRIME | |||||
|
chr19:39097479
|
G | A | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00621.hp1 others(86): Show |
a0001a0002a0004 | a0001c0001a0001c0002a0001c0003others(6): Show | a0001c0001t0001a0001c0002t0002a0001c0002t0005others(16): Show | a0001c0001t0001g0326a0001c0002t0002g0147a0001c0002t0002g0160others(86): Show | 89 | 402 | 0.2214 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.122-979G>A | ||||||
|
chr19:39097568
|
GAA | G | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00621.hp1 others(56): Show |
a0001a0002a0004 | a0001c0003a0001c0004a0001c0008others(2): Show | a0001c0003t0006a0001c0004t0002a0001c0004t0004others(9): Show | a0001c0003t0006g0038a0001c0004t0002g0203a0001c0004t0004g0033others(56): Show | 59 | 402 | 0.1468 | -2 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.122-876_122-875delAA | INFO_REALIGN_3_PRIME | |||||
|
chr19:39097799
|
G | C | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00621.hp1 others(58): Show |
a0001a0002a0004 | a0001c0003a0001c0004a0001c0008others(2): Show | a0001c0003t0006a0001c0004t0002a0001c0004t0004others(9): Show | a0001c0003t0006g0038a0001c0004t0002g0203a0001c0004t0004g0033others(58): Show | 61 | 402 | 0.1517 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.122-659G>C | ||||||
|
chr19:39097931
|
A | C | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00621.hp1 others(58): Show |
a0001a0002a0004 | a0001c0003a0001c0004a0001c0008others(2): Show | a0001c0003t0006a0001c0004t0002a0001c0004t0004others(9): Show | a0001c0003t0006g0038a0001c0004t0002g0203a0001c0004t0004g0033others(58): Show | 61 | 402 | 0.1517 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.122-527A>C | ||||||
|
chr19:39098106
|
C | T | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00621.hp1 others(58): Show |
a0001a0002a0004 | a0001c0003a0001c0004a0001c0008others(2): Show | a0001c0003t0006a0001c0004t0002a0001c0004t0004others(9): Show | a0001c0003t0006g0038a0001c0004t0002g0203a0001c0004t0004g0033others(58): Show | 61 | 402 | 0.1517 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.122-352C>T | ||||||
|
chr19:39098177
|
C | G | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00621.hp1 others(58): Show |
a0001a0002a0004 | a0001c0003a0001c0004a0001c0008others(2): Show | a0001c0003t0006a0001c0004t0002a0001c0004t0004others(9): Show | a0001c0003t0006g0038a0001c0004t0002g0203a0001c0004t0004g0033others(58): Show | 61 | 402 | 0.1517 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.122-281C>G | ||||||
|
chr19:39098253
|
CA | C | intron_variant | MODIFIER | HG00099.hp2 HG00140.hp2 HG00280.hp1 others(147): Show |
a0001a0002a0004 | a0001c0001a0001c0003a0001c0004others(6): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0011others(20): Show | a0001c0001t0001g0028a0001c0001t0001g0029a0001c0001t0001g0030others(147): Show | 150 | 402 | 0.3731 | -1 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.122-179delA | INFO_REALIGN_3_PRIME | |||||
|
chr19:39098275
|
A | G | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00621.hp1 others(57): Show |
a0001a0002a0004 | a0001c0002a0001c0003a0001c0004others(3): Show | a0001c0002t0005a0001c0003t0006a0001c0004t0002others(10): Show | a0001c0002t0005g0236a0001c0003t0006g0038a0001c0004t0002g0203others(57): Show | 60 | 402 | 0.1493 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.122-183A>G | ||||||
|
chr19:39098363
|
T | C | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00621.hp1 others(59): Show |
a0001a0002a0004 | a0001c0003a0001c0004a0001c0008others(2): Show | a0001c0003t0006a0001c0004t0002a0001c0004t0004others(9): Show | a0001c0003t0006g0038a0001c0004t0002g0203a0001c0004t0004g0033others(59): Show | 62 | 402 | 0.1542 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 2/12 | c.122-95T>C | ||||||
|
chr19:39098694
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp2 others(317): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0002a0001c0003others(14): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0006others(45): Show | a0001c0001t0001g0028a0001c0001t0001g0029a0001c0001t0001g0030others(317): Show | 320 | 402 | 0.7960 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 3/12 | c.322+36G>A | ||||||
|
chr19:39098878
|
T | C | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00621.hp1 others(50): Show |
a0001a0002a0004 | a0001c0003a0001c0004a0002c0011others(1): Show | a0001c0003t0006a0001c0004t0002a0001c0004t0004others(6): Show | a0001c0003t0006g0038a0001c0004t0002g0203a0001c0004t0004g0033others(50): Show | 53 | 402 | 0.1318 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 3/12 | c.323-82T>C | ||||||
|
chr19:39098880
|
CACCAGTC others(26): Show |
C | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00621.hp1 others(50): Show |
a0001a0002a0004 | a0001c0003a0001c0004a0002c0011others(1): Show | a0001c0003t0006a0001c0004t0002a0001c0004t0004others(6): Show | a0001c0003t0006g0038a0001c0004t0002g0203a0001c0004t0004g0033others(50): Show | 53 | 402 | 0.1318 | -33 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 3/12 | c.323-79_323-47delACCAGTCGGGGAAGGATGGGGTTGGAGGGAGGG | ||||||
|
chr19:39099992
|
C | CA | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00423.hp2 others(61): Show |
a0001a0002a0004 | a0001c0001a0001c0003a0001c0004others(3): Show | a0001c0001t0001a0001c0001t0006a0001c0003t0003others(12): Show | a0001c0001t0001g0201a0001c0001t0006g0136a0001c0003t0003g0224others(61): Show | 64 | 402 | 0.1592 | 1 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 4/12 | c.506-212dupA | INFO_REALIGN_3_PRIME | |||||
|
chr19:39100121
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp2 others(325): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0002a0001c0003others(15): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0006others(48): Show | a0001c0001t0001g0028a0001c0001t0001g0029a0001c0001t0001g0030others(325): Show | 328 | 402 | 0.8159 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 4/12 | c.506-106G>A | ||||||
|
chr19:39101805
|
A | G | intron_variant | MODIFIER | HG01081.hp1 | a0001 | a0001c0004 | a0001c0004t0017 | a0001c0004t0017g0197 | 1 | 402 | 0.0025 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 11/12 | c.1113+268A>G | ||||||
|
chr19:39101942
|
CA | C | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00621.hp1 others(61): Show |
a0001a0002a0004 | a0001c0002a0001c0003a0001c0004others(4): Show | a0001c0002t0002a0001c0003t0003a0001c0004t0002others(11): Show | a0001c0002t0002g0161a0001c0003t0003g0273a0001c0004t0002g0203others(61): Show | 64 | 402 | 0.1592 | -1 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 11/12 | c.1113+421delA | INFO_REALIGN_3_PRIME | |||||
|
chr19:39102118
|
T | TCA | intron_variant | MODIFIER | HG00140.hp2 HG00597.hp1 HG00621.hp1 others(48): Show |
a0001a0002 | a0001c0001a0001c0002a0001c0004others(3): Show | a0001c0001t0001a0001c0001t0011a0001c0001t0015others(9): Show | a0001c0001t0001g0309a0001c0001t0001g0322a0001c0001t0001g0339others(48): Show | 51 | 402 | 0.1269 | 2 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 11/12 | c.1113+582_1113+583insAC | INFO_REALIGN_3_PRIME | |||||
|
chr19:39102120
|
T | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp2 others(295): Show |
a0001a0002a0004others(2): Show | a0001c0001a0001c0002a0001c0003others(12): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0011others(39): Show | a0001c0001t0001g0028a0001c0001t0001g0029a0001c0001t0001g0030others(295): Show | 298 | 402 | 0.7413 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 11/12 | c.1113+583T>A | ||||||
|
chr19:39102767
|
C | CTTTCTTT others(3): Show |
intron_variant | MODIFIER | HG00423.hp1 HG00741.hp2 HG01081.hp1 others(18): Show |
a0001a0002a0004 | a0001c0001a0001c0004a0001c0006others(2): Show | a0001c0001t0030a0001c0004t0004a0001c0004t0009others(6): Show | a0001c0001t0030g0093a0001c0004t0004g0037a0001c0004t0004g0044others(18): Show | 21 | 402 | 0.0522 | 10 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 11/12 | c.1113+1231_1113+1232insTTCTTTCTTT | INFO_REALIGN_3_PRIME | |||||
|
chr19:39103441
|
G | GTGTTTT | intron_variant | MODIFIER | HG00621.hp1 HG01081.hp1 HG01099.hp2 others(18): Show |
a0001a0004 | a0001c0004a0001c0006a0004c0015 | a0001c0004t0002a0001c0004t0004a0001c0004t0005others(4): Show | a0001c0004t0002g0203a0001c0004t0004g0039a0001c0004t0004g0041others(18): Show | 21 | 402 | 0.0522 | 6 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 11/12 | c.1113+1905_1113+1906insGTTTTT | INFO_REALIGN_3_PRIME | |||||
|
chr19:39104816
|
C | T | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00621.hp1 others(76): Show |
a0001a0002 | a0001c0004a0001c0006a0001c0008others(2): Show | a0001c0004t0002a0001c0004t0004a0001c0004t0005others(12): Show | a0001c0004t0002g0203a0001c0004t0004g0033a0001c0004t0004g0034others(76): Show | 79 | 402 | 0.1965 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 11/12 | c.1114-2131C>T | ||||||
|
chr19:39105306
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp2 others(304): Show |
a0001a0002a0004others(2): Show | a0001c0001a0001c0002a0001c0003others(12): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0011others(40): Show | a0001c0001t0001g0028a0001c0001t0001g0029a0001c0001t0001g0030others(304): Show | 307 | 402 | 0.7637 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 11/12 | c.1114-1641T>C | ||||||
|
chr19:39105481
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp2 others(324): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0002a0001c0003others(15): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0006others(47): Show | a0001c0001t0001g0028a0001c0001t0001g0029a0001c0001t0001g0030others(324): Show | 327 | 402 | 0.8134 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 11/12 | c.1114-1466A>G | ||||||
|
chr19:39105726
|
G | A | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00621.hp1 others(50): Show |
a0001a0002a0004 | a0001c0004a0001c0010a0002c0011others(1): Show | a0001c0004t0002a0001c0004t0004a0001c0004t0005others(6): Show | a0001c0004t0002g0203a0001c0004t0004g0033a0001c0004t0004g0034others(50): Show | 53 | 402 | 0.1318 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 11/12 | c.1114-1221G>A | ||||||
|
chr19:39105932
|
A | C | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00741.hp2 others(47): Show |
a0001a0002a0004 | a0001c0004a0001c0009a0001c0010others(2): Show | a0001c0004t0004a0001c0004t0017a0001c0004t0020others(4): Show | a0001c0004t0004g0033a0001c0004t0004g0034a0001c0004t0004g0035others(47): Show | 50 | 402 | 0.1244 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 11/12 | c.1114-1015A>C | ||||||
|
chr19:39107262
|
C | T | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00544.hp2 others(58): Show |
a0001a0002a0004 | a0001c0001a0001c0004a0001c0008others(4): Show | a0001c0001t0004a0001c0004t0004a0001c0004t0009others(8): Show | a0001c0001t0004g0327a0001c0001t0004g0374a0001c0004t0004g0033others(58): Show | 61 | 402 | 0.1517 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 12/12 | c.1251+178C>T | ||||||
|
chr19:39107358
|
G | A | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00544.hp2 others(58): Show |
a0001a0002a0004 | a0001c0001a0001c0004a0001c0008others(4): Show | a0001c0001t0004a0001c0004t0004a0001c0004t0009others(8): Show | a0001c0001t0004g0327a0001c0001t0004g0374a0001c0004t0004g0033others(58): Show | 61 | 402 | 0.1517 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 12/12 | c.1251+274G>A | ||||||
|
chr19:39107402
|
G | A | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00544.hp2 others(58): Show |
a0001a0002a0004 | a0001c0001a0001c0004a0001c0008others(4): Show | a0001c0001t0004a0001c0004t0004a0001c0004t0009others(8): Show | a0001c0001t0004g0327a0001c0001t0004g0374a0001c0004t0004g0033others(58): Show | 61 | 402 | 0.1517 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 12/12 | c.1251+318G>A | ||||||
|
chr19:39107508
|
C | T | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00544.hp2 others(58): Show |
a0001a0002a0004 | a0001c0001a0001c0004a0001c0008others(4): Show | a0001c0001t0004a0001c0004t0004a0001c0004t0009others(8): Show | a0001c0001t0004g0327a0001c0001t0004g0374a0001c0004t0004g0033others(58): Show | 61 | 402 | 0.1517 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 12/12 | c.1251+424C>T | ||||||
|
chr19:39107578
|
C | CAAAAAAA others(1): Show |
intron_variant | MODIFIER | HG00423.hp1 HG01081.hp1 HG01175.hp1 others(6): Show |
a0001 | a0001c0004a0001c0010 | a0001c0004t0004a0001c0004t0017a0001c0010t0004 | a0001c0004t0004g0037a0001c0004t0004g0039a0001c0004t0004g0060others(6): Show | 9 | 402 | 0.0224 | 8 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 12/12 | c.1251+509_1251+516dupAAAAAAAA | INFO_REALIGN_3_PRIME | |||||
|
chr19:39107622
|
A | G | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00544.hp2 others(48): Show |
a0001a0002a0004 | a0001c0001a0001c0004a0001c0010others(2): Show | a0001c0001t0004a0001c0004t0004a0001c0004t0017others(4): Show | a0001c0001t0004g0327a0001c0001t0004g0374a0001c0004t0004g0033others(48): Show | 51 | 402 | 0.1269 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 12/12 | c.1251+538A>G | ||||||
|
chr19:39107973
|
T | C | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00544.hp2 others(58): Show |
a0001a0002a0004 | a0001c0001a0001c0004a0001c0008others(4): Show | a0001c0001t0004a0001c0004t0004a0001c0004t0009others(8): Show | a0001c0001t0004g0327a0001c0001t0004g0374a0001c0004t0004g0033others(58): Show | 61 | 402 | 0.1517 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 12/12 | c.1251+889T>C | ||||||
|
chr19:39108139
|
ATTT | A | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00544.hp2 others(60): Show |
a0001a0002a0004 | a0001c0001a0001c0004a0001c0006others(5): Show | a0001c0001t0004a0001c0004t0004a0001c0004t0009others(9): Show | a0001c0001t0004g0327a0001c0001t0004g0374a0001c0004t0004g0033others(60): Show | 63 | 402 | 0.1567 | -3 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 12/12 | c.1251+1071_1251+1073delTTT | INFO_REALIGN_3_PRIME | |||||
|
chr19:39108667
|
C | G | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00544.hp2 others(62): Show |
a0001a0002a0004 | a0001c0001a0001c0003a0001c0004others(6): Show | a0001c0001t0004a0001c0003t0020a0001c0004t0004others(10): Show | a0001c0001t0004g0327a0001c0001t0004g0374a0001c0003t0020g0264others(62): Show | 65 | 402 | 0.1617 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 12/12 | c.1252-1386C>G | ||||||
|
chr19:39108854
|
C | T | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00544.hp2 others(62): Show |
a0001a0002a0004 | a0001c0001a0001c0003a0001c0004others(6): Show | a0001c0001t0004a0001c0003t0020a0001c0004t0004others(10): Show | a0001c0001t0004g0327a0001c0001t0004g0374a0001c0003t0020g0264others(62): Show | 65 | 402 | 0.1617 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 12/12 | c.1252-1199C>T | ||||||
|
chr19:39108866
|
G | A | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00544.hp2 others(62): Show |
a0001a0002a0004 | a0001c0001a0001c0003a0001c0004others(6): Show | a0001c0001t0004a0001c0003t0020a0001c0004t0004others(10): Show | a0001c0001t0004g0327a0001c0001t0004g0374a0001c0003t0020g0264others(62): Show | 65 | 402 | 0.1617 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 12/12 | c.1252-1187G>A | ||||||
|
chr19:39108914
|
A | G | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00544.hp2 others(62): Show |
a0001a0002a0004 | a0001c0001a0001c0003a0001c0004others(6): Show | a0001c0001t0004a0001c0003t0020a0001c0004t0004others(10): Show | a0001c0001t0004g0327a0001c0001t0004g0374a0001c0003t0020g0264others(62): Show | 65 | 402 | 0.1617 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 12/12 | c.1252-1139A>G | ||||||
|
chr19:39109332
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp2 others(305): Show |
a0001a0002a0004others(2): Show | a0001c0001a0001c0002a0001c0003others(12): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0011others(41): Show | a0001c0001t0001g0028a0001c0001t0001g0029a0001c0001t0001g0030others(305): Show | 308 | 402 | 0.7662 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 12/12 | c.1252-721A>G | ||||||
|
chr19:39109396
|
T | G | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00544.hp2 others(50): Show |
a0001a0002a0004 | a0001c0001a0001c0003a0001c0004others(4): Show | a0001c0001t0004a0001c0003t0020a0001c0004t0004others(6): Show | a0001c0001t0004g0327a0001c0001t0004g0374a0001c0003t0020g0264others(50): Show | 53 | 402 | 0.1318 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 12/12 | c.1252-657T>G | ||||||
|
chr19:39109486
|
C | G | intron_variant | MODIFIER | HG00140.hp2 HG00423.hp1 HG00544.hp2 others(50): Show |
a0001a0002a0004 | a0001c0001a0001c0003a0001c0004others(4): Show | a0001c0001t0004a0001c0003t0020a0001c0004t0004others(6): Show | a0001c0001t0004g0327a0001c0001t0004g0374a0001c0003t0020g0264others(50): Show | 53 | 402 | 0.1318 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 12/12 | c.1252-567C>G | ||||||
|
chr19:39109597
|
T | C | intron_variant | MODIFIER | HG00099.hp2 HG00140.hp2 HG00280.hp1 others(193): Show |
a0001a0002a0004others(2): Show | a0001c0001a0001c0002a0001c0003others(10): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0011others(24): Show | a0001c0001t0001g0028a0001c0001t0001g0029a0001c0001t0001g0030others(193): Show | 196 | 402 | 0.4876 | 0 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 12/12 | c.1252-456T>C | ||||||
|
chr19:39109685
|
T | TAA | intron_variant | MODIFIER | HG00140.hp2 HG00544.hp2 HG00639.hp2 others(70): Show |
a0001a0002a0004 | a0001c0001a0001c0003a0001c0004others(6): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0013others(11): Show | a0001c0001t0001g0253a0001c0001t0001g0309a0001c0001t0001g0335others(70): Show | 73 | 402 | 0.1816 | 2 | ACP7 | ENSG00000183760.11 | transcript | ENST00000331256.10 | protein_coding | 12/12 | c.1252-345_1252-344dupAA | INFO_REALIGN_3_PRIME |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
ahapid | alen | total | AFR | AMR | EAS | EUR | SAS | aseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ACP7 | 1/1 | a0001 | 438 | 395 | 82 | 80 | 175 | 16 | 40 | subcellular location copy fasta | chr19 | 39079368 | 39116493 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
chapid | clen | total | AFR | AMR | EAS | EUR | SAS | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ACP7 | 0/0 | c0004 | 1317 | 52 | 5 | 13 | 28 | 1 | 5 | copy fasta | chr19 | 39079368 | 39116493 |
| genename | grch38/chm13v2 | thapid | tlen | total | AFR | AMR | EAS | EUR | SAS | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ACP7 | 0/0 | t0017 | 1590 | 3 | 0 | 2 | 0 | 0 | 1 | copy fasta | chr19 | 39079368 | 39116493 |
| genename | grch38/chm13v2 | ghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| ACP7 | 0/0 | g0197 | 1 | 0 | 1 | 0 | 0 | 0 | chr19 | 39079368 | 39116493 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
achapid | total | AFR | AMR | EAS | EUR | SAS | clen | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ACP7 | 0/0 | a0001c0004 | 52 | 5 | 13 | 28 | 1 | 5 | 1317 | copy fasta | chr19 | 39079368 | 39116493 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
acthapid | total | AFR | AMR | EAS | EUR | SAS | tlen | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ACP7 | 0/0 | a0001c0004t0017 | 3 | 0 | 2 | 0 | 0 | 1 | 2906 | copy fasta | chr19 | 39079368 | 39116493 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
actghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| ACP7 | 0/0 | a0001c0004t0017g0197 | 1 | 0 | 1 | 0 | 0 | 0 | chr19 | 39079368 | 39116493 |
Click to load Haplotype QTL data...
| pos | S. Strand |
E# Exon Number |
max | median | min | diff | type | haplotypeid | max_hap_list | min_hap_list | symbol | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 39084400 | + | 1 | -0.5302 | -0.5302 | -0.5302 | 0.0000 | acceptor | a0001c0004t0017g0197 | HG01081.hp1 | HG01081.hp1 | ACP7 | chr19 | 39079368 | 39116493 |
| 39085092 | + | 2 | 0.5978 | 0.5978 | 0.5978 | 0.0000 | donor | a0001c0004t0017g0197 | HG01081.hp1 | HG01081.hp1 | ACP7 | chr19 | 39079368 | 39116493 |
| 39085390 | + | 2 | -0.7709 | -0.7709 | -0.7709 | 0.0000 | acceptor | a0001c0004t0017g0197 | HG01081.hp1 | HG01081.hp1 | ACP7 | chr19 | 39079368 | 39116493 |
| 39098458 | + | 3 | 0.9877 | 0.9877 | 0.9877 | 0.0000 | donor | a0001c0004t0017g0197 | HG01081.hp1 | HG01081.hp1 | ACP7 | chr19 | 39079368 | 39116493 |
| 39098658 | + | 3 | -0.9788 | -0.9788 | -0.9788 | 0.0000 | acceptor | a0001c0004t0017g0197 | HG01081.hp1 | HG01081.hp1 | ACP7 | chr19 | 39079368 | 39116493 |
| 39098960 | + | 4 | 0.9945 | 0.9945 | 0.9945 | 0.0000 | donor | a0001c0004t0017g0197 | HG01081.hp1 | HG01081.hp1 | ACP7 | chr19 | 39079368 | 39116493 |
| 39099142 | + | 4 | -0.9351 | -0.9351 | -0.9351 | 0.0000 | acceptor | a0001c0004t0017g0197 | HG01081.hp1 | HG01081.hp1 | ACP7 | chr19 | 39079368 | 39116493 |
| 39100227 | + | 5 | 0.9215 | 0.9214 | 0.9215 | 0.0000 | donor | a0001c0004t0017g0197 | HG01081.hp1 | HG01081.hp1 | ACP7 | chr19 | 39079368 | 39116493 |
| 39100350 | + | 5 | -0.9178 | -0.9178 | -0.9178 | 0.0000 | acceptor | a0001c0004t0017g0197 | HG01081.hp1 | HG01081.hp1 | ACP7 | chr19 | 39079368 | 39116493 |
| 39100580 | + | 6 | 0.9946 | 0.9946 | 0.9946 | 0.0000 | donor | a0001c0004t0017g0197 | HG01081.hp1 | HG01081.hp1 | ACP7 | chr19 | 39079368 | 39116493 |
| 39100642 | + | 6 | -0.9925 | -0.9925 | -0.9925 | 0.0000 | acceptor | a0001c0004t0017g0197 | HG01081.hp1 | HG01081.hp1 | ACP7 | chr19 | 39079368 | 39116493 |
| 39100739 | + | 7 | 0.9977 | 0.9977 | 0.9977 | 0.0000 | donor | a0001c0004t0017g0197 | HG01081.hp1 | HG01081.hp1 | ACP7 | chr19 | 39079368 | 39116493 |
| 39100853 | + | 7 | -0.9984 | -0.9984 | -0.9984 | 0.0000 | acceptor | a0001c0004t0017g0197 | HG01081.hp1 | HG01081.hp1 | ACP7 | chr19 | 39079368 | 39116493 |
| 39100949 | + | 8 | 0.9991 | 0.9991 | 0.9991 | 0.0000 | donor | a0001c0004t0017g0197 | HG01081.hp1 | HG01081.hp1 | ACP7 | chr19 | 39079368 | 39116493 |
| 39101056 | + | 8 | -0.9995 | -0.9995 | -0.9995 | 0.0000 | acceptor | a0001c0004t0017g0197 | HG01081.hp1 | HG01081.hp1 | ACP7 | chr19 | 39079368 | 39116493 |
| 39101150 | + | 9 | 0.9972 | 0.9972 | 0.9972 | 0.0000 | donor | a0001c0004t0017g0197 | HG01081.hp1 | HG01081.hp1 | ACP7 | chr19 | 39079368 | 39116493 |
| 39101207 | + | 9 | -0.9952 | -0.9952 | -0.9952 | 0.0000 | acceptor | a0001c0004t0017g0197 | HG01081.hp1 | HG01081.hp1 | ACP7 | chr19 | 39079368 | 39116493 |
| 39101288 | + | 10 | 0.9959 | 0.9959 | 0.9959 | 0.0000 | donor | a0001c0004t0017g0197 | HG01081.hp1 | HG01081.hp1 | ACP7 | chr19 | 39079368 | 39116493 |
| 39101355 | + | 10 | -0.9973 | -0.9973 | -0.9973 | 0.0000 | acceptor | a0001c0004t0017g0197 | HG01081.hp1 | HG01081.hp1 | ACP7 | chr19 | 39079368 | 39116493 |
| 39101466 | + | 11 | 0.9940 | 0.9940 | 0.9940 | 0.0000 | donor | a0001c0004t0017g0197 | HG01081.hp1 | HG01081.hp1 | ACP7 | chr19 | 39079368 | 39116493 |
| 39101537 | + | 11 | -0.9882 | -0.9882 | -0.9882 | 0.0000 | acceptor | a0001c0004t0017g0197 | HG01081.hp1 | HG01081.hp1 | ACP7 | chr19 | 39079368 | 39116493 |
| 39106947 | + | 12 | 0.9819 | 0.9819 | 0.9819 | 0.0000 | donor | a0001c0004t0017g0197 | HG01081.hp1 | HG01081.hp1 | ACP7 | chr19 | 39079368 | 39116493 |
| 39107084 | + | 12 | -0.9978 | -0.9978 | -0.9978 | 0.0000 | acceptor | a0001c0004t0017g0197 | HG01081.hp1 | HG01081.hp1 | ACP7 | chr19 | 39079368 | 39116493 |
| 39110053 | + | 13 | 0.8699 | 0.8699 | 0.8699 | 0.0000 | donor | a0001c0004t0017g0197 | HG01081.hp1 | HG01081.hp1 | ACP7 | chr19 | 39079368 | 39116493 |
| pos | annotationhgvs_chgvs_p | clinvarid | clnsig | geneinfo | mc | clndisdb | strand strand
|
ahapid ahapid_count
|
chapid chapid count
|
thapid thapid_count
|
ghapid ghapid_count
|
AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
impact | chr | ref | alt | external |
|---|
| CHR:POS | annotationhgvs_chgvs_p | disease trait-log10podds or beta | AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
study | initial sample size/replication sample size | report genes | mapped gene | strongest snp risk allele | strand strand
|
impact | chr | ref | alt |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr19:39090097
|
c.121+4707A>G | Type 2 diabetes1.39 | a0001a0002a0004 | a0001c0001a0001c0002a0001c0003a0001c0004a0001c0005others(6): Show | a0001c0001t0001a0001c0001t0015a0001c0002t0002a0001c0002t0005a0001c0002t0021others(18): Show | a0001c0001t0001g0040a0001c0001t0001g0049a0001c0001t0001g0083a0001c0001t0001g0097a0001c0001t0001g0098others(100): Show | HG00423.hp1 HG00621.hp1 HG00673.hp1 HG00741.hp2 HG01070.hp1 others(100): Show |
Transferability of type 2 diabetes implicated loci others(45): Show |
2,010 Chinese ancestry cases, 1,945 Chinese ancest others(140): Show |
FLJ16165 | ACP7 | rs472265-G | + | MODIFIER | chr19 | A | G |
|
chr19:39098694
|
c.322+36G>A | Iron/zinc purple acid phosphatase-like protein levelsothers(19): Show | a0001a0002a0003a0004a0005others(1): Show | a0001c0001a0001c0002a0001c0003a0001c0004a0001c0005others(12): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0006a0001c0001t0011a0001c0001t0013others(43): Show | a0001c0001t0001g0028a0001c0001t0001g0029a0001c0001t0001g0030a0001c0001t0001g0032a0001c0001t0001g0036others(315): Show | HG00099.hp1 HG00099.hp2 HG00140.hp2 HG00280.hp1 HG00280.hp2 others(315): Show |
Proteogenomic analysis of human cerebrospinal flui others(103): Show |
3,506 European ancestry individuals/ | ACP7 | rs560364-G | + | MODIFIER | chr19 | G | A | |
|
chr19:39087643
|
c.121+2253T>G | Resistance to COVID-19 infection (Exposed negative vs positive)others(23): Show | a0001a0002a0004 | a0001c0001a0001c0002a0001c0003a0001c0004a0001c0006others(6): Show | a0001c0001t0001a0001c0001t0011a0001c0001t0015a0001c0002t0002a0001c0002t0005others(24): Show | a0001c0001t0001g0028a0001c0001t0001g0029a0001c0001t0001g0030a0001c0001t0001g0032a0001c0001t0001g0036others(177): Show | HG00099.hp1 HG00280.hp1 HG00408.hp1 HG00408.hp2 HG00423.hp1 others(177): Show |
Better safe than sorry-Whole-genome sequencing ind others(76): Show |
306 resistant cases, up to 770 benign, mild or sev others(13): Show |
ACP7 | rs140656818-? | + | MODIFIER | chr19 | T | G |