| geneid | 222 |
|---|---|
| ensemblid | ENSG00000132746.16 |
| hgncid | 411 |
| symbol | ALDH3B2 |
| name | aldehyde dehydrogenase 3 family member B2 |
| refseq_nuc | NM_001393402.2 |
| refseq_prot | NP_001380331.1 |
| ensembl_nuc | ENST00000673966.2 |
| ensembl_prot | ENSP00000501254.1 |
| mane_status | MANE Select |
| chr | chr11 |
| start | 67662155 |
| end | 67674623 |
| strand | - |
| ver | v1.2 |
| region | chr11:67662155-67674623 |
| region5000 | chr11:67657155-67679623 |
| regionname0 | ALDH3B2_chr11_67662155_67674623 |
| regionname5000 | ALDH3B2_chr11_67657155_67679623 |
| chr:pos | ref | alt | af | annotation | impact | samples | AHAPIDS | ACHAPIDS | ACTHAPIDS | ACTGHAPIDS | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr11:67663291
|
T | C | 0.8615 | missense_variant | MODERATE | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(333): Show |
a0001a0003a0005others(13): Show | a0001c0001a0001c0007a0001c0009others(20): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0006others(29): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(168): Show | 336 | 390 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 10/10 | c.1082A>G | p.His361Arg | 1514/2650 | 1082/1158 | 361/385 | ||
|
chr11:67665333
|
T | C | 0.9974 | missense_variant | MODERATE | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(386): Show |
a0001a0002a0003others(17): Show | a0001c0001a0001c0007a0001c0009others(24): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0006others(38): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(207): Show | 389 | 390 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 7/10 | c.658A>G | p.Ser220Gly | 1090/2650 | 658/1158 | 220/385 | ||
|
chr11:67665383
|
T | C | 0.9564 | missense_variant | MODERATE | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(370): Show |
a0001a0002a0003others(15): Show | a0001c0001a0001c0007a0001c0009others(22): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0006others(36): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(194): Show | 373 | 390 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 7/10 | c.608A>G | p.His203Arg | 1040/2650 | 608/1158 | 203/385 | ||
|
chr11:67665502
|
G | T | 0.0026 | stop_gained | HIGH | NA20300.hp2 | a0012 | a0012c0018 | a0012c0018t0018 | a0012c0018t0018g0171 | 1 | 390 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 7/10 | c.489C>A | p.Cys163* | 921/2650 | 489/1158 | 163/385 | ||
|
chr11:67666398
|
C | T | 0.8590 | missense_variant | MODERATE | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(332): Show |
a0001a0003a0005others(12): Show | a0001c0001a0001c0007a0001c0009others(19): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0006others(28): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(167): Show | 335 | 390 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 5/10 | c.155G>A | p.Ser52Asn | 587/2650 | 155/1158 | 52/385 |
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr11:67662359
|
A | G | 0.0026 | 3_prime_UTR_variant | MODIFIER | NA20300.hp2 | a0012 | a0012c0018 | a0012c0018t0018 | a0012c0018t0018g0171 | 1 | 390 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 10/10 | c.*856T>C | 856 | |||||
|
chr11:67662793
|
A | G | 0.9590 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(371): Show |
a0001a0002a0003others(16): Show | a0001c0001a0001c0007a0001c0009others(23): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0006others(37): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(195): Show | 374 | 390 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 10/10 | c.*422T>C | 422 | |||||
|
chr11:67662925
|
T | C | 0.9974 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(386): Show |
a0001a0002a0003others(17): Show | a0001c0001a0001c0007a0001c0009others(24): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0006others(38): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(207): Show | 389 | 390 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 10/10 | c.*290A>G | 290 | |||||
|
chr11:67663118
|
A | G | 0.8615 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(333): Show |
a0001a0003a0005others(13): Show | a0001c0001a0001c0007a0001c0009others(20): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0006others(29): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(168): Show | 336 | 390 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 10/10 | c.*97T>C | 97 | |||||
|
chr11:67667569
|
C | T | 0.0026 | 5_prime_UTR_variant | MODIFIER | NA20300.hp2 | a0012 | a0012c0018 | a0012c0018t0018 | a0012c0018t0018g0171 | 1 | 390 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 2/10 | c.-178G>A | 634 |
| chr:pos | ref | alt | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | af | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr11:67663567
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(330): Show |
a0001a0003a0005others(12): Show | a0001c0001a0001c0007a0001c0009others(18): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0006others(27): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(165): Show | 333 | 390 | 0.8539 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 9/9 | c.973+95C>T | ||||||
|
chr11:67663639
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(330): Show |
a0001a0003a0005others(12): Show | a0001c0001a0001c0007a0001c0009others(18): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0006others(27): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(165): Show | 333 | 390 | 0.8539 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 9/9 | c.973+23C>T | ||||||
|
chr11:67664061
|
C | G | intron_variant | MODIFIER | NA20300.hp2 | a0012 | a0012c0018 | a0012c0018t0018 | a0012c0018t0018g0171 | 1 | 390 | 0.0026 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 8/9 | c.874-300G>C | ||||||
|
chr11:67665145
|
A | G | intron_variant | MODIFIER | NA20300.hp2 | a0012 | a0012c0018 | a0012c0018t0018 | a0012c0018t0018g0171 | 1 | 390 | 0.0026 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 7/9 | c.706+140T>C | ||||||
|
chr11:67665950
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(371): Show |
a0001a0002a0003others(16): Show | a0001c0001a0001c0007a0001c0009others(23): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0006others(37): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(195): Show | 374 | 390 | 0.9590 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 6/9 | c.319+172C>T | ||||||
|
chr11:67666237
|
C | CG | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(332): Show |
a0001a0003a0005others(12): Show | a0001c0001a0001c0007a0001c0009others(19): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0006others(28): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(167): Show | 335 | 390 | 0.8590 | 1 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 5/9 | c.238-35dupC | ||||||
|
chr11:67667292
|
C | CT | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(325): Show |
a0001a0003a0005others(11): Show | a0001c0001a0001c0007a0001c0011others(16): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0006others(25): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(160): Show | 328 | 390 | 0.8410 | 1 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 2/9 | c.-82+180dupA | ||||||
|
chr11:67667450
|
G | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(326): Show |
a0001a0003a0004others(13): Show | a0001c0001a0001c0007a0001c0011others(19): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0006others(28): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(166): Show | 329 | 390 | 0.8436 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 2/9 | c.-82+23C>G | ||||||
|
chr11:67667880
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(370): Show |
a0001a0002a0003others(16): Show | a0001c0001a0001c0007a0001c0009others(23): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0006others(37): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(194): Show | 373 | 390 | 0.9564 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 1/9 | c.-244-245A>G | ||||||
|
chr11:67668479
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(378): Show |
a0001a0002a0003others(17): Show | a0001c0001a0001c0007a0001c0009others(24): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0006others(38): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(201): Show | 381 | 390 | 0.9769 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 1/9 | c.-244-844A>G | ||||||
|
chr11:67668505
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(317): Show |
a0001a0002a0003others(14): Show | a0001c0001a0001c0007a0001c0015others(19): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0006others(33): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(154): Show | 320 | 390 | 0.8205 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 1/9 | c.-244-870T>C | ||||||
|
chr11:67669422
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(317): Show |
a0001a0002a0003others(13): Show | a0001c0001a0001c0007a0001c0009others(19): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0007others(31): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(154): Show | 320 | 390 | 0.8205 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 1/9 | c.-244-1787C>T | ||||||
|
chr11:67669605
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(314): Show |
a0001a0002a0003others(13): Show | a0001c0001a0001c0007a0001c0015others(18): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0007others(30): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(151): Show | 317 | 390 | 0.8128 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 1/9 | c.-244-1970T>C | ||||||
|
chr11:67669839
|
T | C | intron_variant | MODIFIER | NA20300.hp2 NA21309.hp2 |
a0003a0012 | a0003c0003a0012c0018 | a0003c0003t0001a0012c0018t0018 | a0003c0003t0001g0102a0012c0018t0018g0171 | 2 | 390 | 0.0051 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 1/9 | c.-244-2204A>G | ||||||
|
chr11:67669941
|
GGT | G | intron_variant | MODIFIER | HG02896.hp2 HG02897.hp1 HG03225.hp1 others(2): Show |
a0002a0003a0012 | a0002c0002a0003c0003a0012c0018 | a0002c0002t0002a0003c0003t0001a0012c0018t0018 | a0002c0002t0002g0047a0002c0002t0002g0190a0003c0003t0001g0102others(1): Show | 5 | 390 | 0.0128 | -2 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 1/9 | c.-244-2308_-244-2307delAC | ||||||
|
chr11:67670034
|
GTGTGTGT others(11): Show |
G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(301): Show |
a0001a0002a0003others(12): Show | a0001c0001a0001c0007a0001c0015others(16): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0007others(27): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(140): Show | 304 | 390 | 0.7795 | -18 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 1/9 | c.-244-2417_-244-2400delGAGACACCCATACACACA | ||||||
|
chr11:67670078
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(303): Show |
a0001a0002a0003others(12): Show | a0001c0001a0001c0007a0001c0015others(16): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0007others(27): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(142): Show | 306 | 390 | 0.7846 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 1/9 | c.-244-2443T>C | ||||||
|
chr11:67670122
|
GTGTGTGT others(45): Show |
G | intron_variant | MODIFIER | NA20300.hp2 | a0012 | a0012c0018 | a0012c0018t0018 | a0012c0018t0018g0171 | 1 | 390 | 0.0026 | -52 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 1/9 | c.-244-2539_-244-2488delGACACACGTGGACACAGACACCCATACACACACAGACACCCATACACACACA | ||||||
|
chr11:67670651
|
A | G | intron_variant | MODIFIER | HG01884.hp2 HG01891.hp1 HG02056.hp2 others(5): Show |
a0001a0012 | a0001c0001a0001c0015a0012c0018 | a0001c0001t0004a0001c0015t0004a0012c0018t0018 | a0001c0001t0004g0191a0001c0001t0004g0192a0001c0001t0004g0193others(4): Show | 8 | 390 | 0.0205 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 1/9 | c.-244-3016T>C | ||||||
|
chr11:67670724
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(315): Show |
a0001a0002a0003others(13): Show | a0001c0001a0001c0007a0001c0009others(19): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0007others(31): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(152): Show | 318 | 390 | 0.8154 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 1/9 | c.-244-3089A>G | ||||||
|
chr11:67670813
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(314): Show |
a0001a0002a0003others(13): Show | a0001c0001a0001c0007a0001c0015others(18): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0007others(30): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(151): Show | 317 | 390 | 0.8128 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 1/9 | c.-244-3178A>G | ||||||
|
chr11:67671005
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(314): Show |
a0001a0002a0003others(13): Show | a0001c0001a0001c0007a0001c0015others(18): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0007others(30): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(151): Show | 317 | 390 | 0.8128 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 1/9 | c.-244-3370C>T | ||||||
|
chr11:67671319
|
C | T | intron_variant | MODIFIER | NA20300.hp2 | a0012 | a0012c0018 | a0012c0018t0018 | a0012c0018t0018g0171 | 1 | 390 | 0.0026 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 1/9 | c.-245+3117G>A | ||||||
|
chr11:67671525
|
C | G | intron_variant | MODIFIER | NA20300.hp2 | a0012 | a0012c0018 | a0012c0018t0018 | a0012c0018t0018g0171 | 1 | 390 | 0.0026 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 1/9 | c.-245+2911G>C | ||||||
|
chr11:67671540
|
TCC | T | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(306): Show |
a0001a0002a0003others(11): Show | a0001c0001a0001c0007a0001c0009others(16): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0007others(28): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(144): Show | 309 | 390 | 0.7923 | -2 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 1/9 | c.-245+2894_-245+2895delGG | ||||||
|
chr11:67671548
|
C | T | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(305): Show |
a0001a0002a0003others(11): Show | a0001c0001a0001c0007a0001c0015others(15): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0007others(27): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(143): Show | 308 | 390 | 0.7897 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 1/9 | c.-245+2888G>A | ||||||
|
chr11:67671720
|
A | G | intron_variant | MODIFIER | HG01243.hp1 HG02055.hp1 HG02486.hp2 others(4): Show |
a0008a0011a0012 | a0008c0012a0008c0013a0011c0016others(1): Show | a0008c0012t0010a0008c0013t0008a0011c0016t0006others(1): Show | a0008c0012t0010g0197a0008c0012t0010g0198a0008c0013t0008g0066others(3): Show | 7 | 390 | 0.0180 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 1/9 | c.-245+2716T>C | ||||||
|
chr11:67672132
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(327): Show |
a0001a0002a0003others(13): Show | a0001c0001a0001c0007a0001c0011others(19): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0007others(26): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(161): Show | 330 | 390 | 0.8462 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 1/9 | c.-245+2304C>T | ||||||
|
chr11:67672134
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(362): Show |
a0001a0002a0003others(16): Show | a0001c0001a0001c0007a0001c0011others(22): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0007others(35): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(187): Show | 365 | 390 | 0.9359 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 1/9 | c.-245+2302C>T | ||||||
|
chr11:67672991
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(369): Show |
a0001a0002a0003others(15): Show | a0001c0001a0001c0007a0001c0009others(22): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0006others(36): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(193): Show | 372 | 390 | 0.9539 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 1/9 | c.-245+1445A>G | ||||||
|
chr11:67673582
|
A | C | intron_variant | MODIFIER | HG00423.hp1 HG00438.hp1 HG00639.hp2 others(48): Show |
a0001a0007a0012 | a0001c0001a0001c0007a0001c0011others(2): Show | a0001c0001t0001a0001c0001t0006a0001c0007t0001others(3): Show | a0001c0001t0001g0009a0001c0001t0001g0018a0001c0001t0001g0019others(35): Show | 51 | 390 | 0.1308 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 1/9 | c.-245+854T>G | ||||||
|
chr11:67674035
|
C | T | intron_variant | MODIFIER | HG01884.hp2 HG01891.hp1 HG02056.hp2 others(5): Show |
a0001a0012 | a0001c0001a0001c0015a0012c0018 | a0001c0001t0004a0001c0015t0004a0012c0018t0018 | a0001c0001t0004g0191a0001c0001t0004g0192a0001c0001t0004g0193others(4): Show | 8 | 390 | 0.0205 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 1/9 | c.-245+401G>A | ||||||
|
chr11:67674279
|
A | G | intron_variant | MODIFIER | HG00280.hp2 HG00423.hp2 HG00642.hp2 others(50): Show |
a0001a0002a0007others(3): Show | a0001c0001a0001c0007a0001c0011others(5): Show | a0001c0001t0001a0001c0007t0001a0001c0011t0001others(10): Show | a0001c0001t0001g0053a0001c0001t0001g0054a0001c0001t0001g0055others(38): Show | 53 | 390 | 0.1359 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 1/9 | c.-245+157T>C | ||||||
|
chr11:67674435
|
A | C | splice_donor_variant others(1): Show |
HIGH | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(370): Show |
a0001a0002a0003others(16): Show | a0001c0001a0001c0007a0001c0009others(23): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0006others(37): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(194): Show | 373 | 390 | 0.9564 | 0 | ALDH3B2 | ENSG00000132746.16 | transcript | ENST00000673966.2 | protein_coding | 1/9 | c.-245+1T>G |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
ahapid | alen | total | AFR | AMR | EAS | EUR | SAS | aseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ALDH3B2 | 0/0 | a0012 | 162 | 1 | 1 | 0 | 0 | 0 | 0 | subcellular location copy fasta | chr11 | 67657155 | 67679623 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
chapid | clen | total | AFR | AMR | EAS | EUR | SAS | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ALDH3B2 | 0/0 | c0018 | 1158 | 1 | 1 | 0 | 0 | 0 | 0 | copy fasta | chr11 | 67657155 | 67679623 |
| genename | grch38/chm13v2 | thapid | tlen | total | AFR | AMR | EAS | EUR | SAS | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ALDH3B2 | 0/0 | t0018 | 1493 | 1 | 1 | 0 | 0 | 0 | 0 | copy fasta | chr11 | 67657155 | 67679623 |
| genename | grch38/chm13v2 | ghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| ALDH3B2 | 0/0 | g0171 | 1 | 1 | 0 | 0 | 0 | 0 | chr11 | 67657155 | 67679623 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
achapid | total | AFR | AMR | EAS | EUR | SAS | clen | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ALDH3B2 | 0/0 | a0012c0018 | 1 | 1 | 0 | 0 | 0 | 0 | 1158 | copy fasta | chr11 | 67657155 | 67679623 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
acthapid | total | AFR | AMR | EAS | EUR | SAS | tlen | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ALDH3B2 | 0/0 | a0012c0018t0018 | 1 | 1 | 0 | 0 | 0 | 0 | 2650 | copy fasta | chr11 | 67657155 | 67679623 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
actghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| ALDH3B2 | 0/0 | a0012c0018t0018g0171 | 1 | 1 | 0 | 0 | 0 | 0 | chr11 | 67657155 | 67679623 |
Click to load Haplotype QTL data...
| pos | S. Strand |
E# Exon Number |
max | median | min | diff | type | haplotypeid | max_hap_list | min_hap_list | symbol | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 67674436 | - | 1 | -0.2287 | -0.2287 | -0.2287 | 0.0000 | acceptor | a0012c0018t0018g0171 | NA20300.hp2 | NA20300.hp2 | ALDH3B2 | chr11 | 67657155 | 67679623 |
| 67667473 | - | 2 | -0.9986 | -0.9986 | -0.9986 | 0.0000 | acceptor | a0012c0018t0018g0171 | NA20300.hp2 | NA20300.hp2 | ALDH3B2 | chr11 | 67657155 | 67679623 |
| 67667635 | - | 2 | 0.9822 | 0.9822 | 0.9822 | 0.0000 | donor | a0012c0018t0018g0171 | NA20300.hp2 | NA20300.hp2 | ALDH3B2 | chr11 | 67657155 | 67679623 |
| 67666906 | - | 3 | -0.9982 | -0.9981 | -0.9982 | 0.0000 | acceptor | a0012c0018t0018g0171 | NA20300.hp2 | NA20300.hp2 | ALDH3B2 | chr11 | 67657155 | 67679623 |
| 67667016 | - | 3 | 0.9966 | 0.9966 | 0.9966 | 0.0000 | donor | a0012c0018t0018g0171 | NA20300.hp2 | NA20300.hp2 | ALDH3B2 | chr11 | 67657155 | 67679623 |
| 67666574 | - | 4 | -0.9980 | -0.9980 | -0.9980 | 0.0000 | acceptor | a0012c0018t0018g0171 | NA20300.hp2 | NA20300.hp2 | ALDH3B2 | chr11 | 67657155 | 67679623 |
| 67666694 | - | 4 | 0.9990 | 0.9990 | 0.9990 | 0.0000 | donor | a0012c0018t0018g0171 | NA20300.hp2 | NA20300.hp2 | ALDH3B2 | chr11 | 67657155 | 67679623 |
| 67666316 | - | 5 | -0.9918 | -0.9918 | -0.9918 | 0.0000 | acceptor | a0012c0018t0018g0171 | NA20300.hp2 | NA20300.hp2 | ALDH3B2 | chr11 | 67657155 | 67679623 |
| 67666401 | - | 5 | 0.9988 | 0.9988 | 0.9988 | 0.0000 | donor | a0012c0018t0018g0171 | NA20300.hp2 | NA20300.hp2 | ALDH3B2 | chr11 | 67657155 | 67679623 |
| 67666122 | - | 6 | -0.9984 | -0.9984 | -0.9984 | 0.0000 | acceptor | a0012c0018t0018g0171 | NA20300.hp2 | NA20300.hp2 | ALDH3B2 | chr11 | 67657155 | 67679623 |
| 67666203 | - | 6 | 0.9940 | 0.9940 | 0.9940 | 0.0000 | donor | a0012c0018t0018g0171 | NA20300.hp2 | NA20300.hp2 | ALDH3B2 | chr11 | 67657155 | 67679623 |
| 67665285 | - | 7 | -0.9984 | -0.9984 | -0.9984 | 0.0000 | acceptor | a0012c0018t0018g0171 | NA20300.hp2 | NA20300.hp2 | ALDH3B2 | chr11 | 67657155 | 67679623 |
| 67665671 | - | 7 | 0.9992 | 0.9992 | 0.9992 | 0.0000 | donor | a0012c0018t0018g0171 | NA20300.hp2 | NA20300.hp2 | ALDH3B2 | chr11 | 67657155 | 67679623 |
| 67664396 | - | 8 | -0.9983 | -0.9983 | -0.9983 | 0.0000 | acceptor | a0012c0018t0018g0171 | NA20300.hp2 | NA20300.hp2 | ALDH3B2 | chr11 | 67657155 | 67679623 |
| 67664562 | - | 8 | 0.9985 | 0.9985 | 0.9985 | 0.0000 | donor | a0012c0018t0018g0171 | NA20300.hp2 | NA20300.hp2 | ALDH3B2 | chr11 | 67657155 | 67679623 |
| 67663662 | - | 9 | -0.9891 | -0.9891 | -0.9891 | 0.0000 | acceptor | a0012c0018t0018g0171 | NA20300.hp2 | NA20300.hp2 | ALDH3B2 | chr11 | 67657155 | 67679623 |
| 67663761 | - | 9 | 0.9939 | 0.9939 | 0.9939 | 0.0000 | donor | a0012c0018t0018g0171 | NA20300.hp2 | NA20300.hp2 | ALDH3B2 | chr11 | 67657155 | 67679623 |
| 67663399 | - | 10 | 0.9910 | 0.9910 | 0.9910 | 0.0000 | donor | a0012c0018t0018g0171 | NA20300.hp2 | NA20300.hp2 | ALDH3B2 | chr11 | 67657155 | 67679623 |
| pos | annotationhgvs_chgvs_p | clinvarid | clnsig | geneinfo | mc | clndisdb | strand strand
|
ahapid ahapid_count
|
chapid chapid count
|
thapid thapid_count
|
ghapid ghapid_count
|
AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
impact | chr | ref | alt | external |
|---|
| CHR:POS | annotationhgvs_chgvs_p | disease trait-log10podds or beta | AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
study | initial sample size/replication sample size | report genes | mapped gene | strongest snp risk allele | strand strand
|
impact | chr | ref | alt |
|---|