| geneid | 525 |
|---|---|
| ensemblid | ENSG00000116039.13 |
| hgncid | 853 |
| symbol | ATP6V1B1 |
| name | ATPase H+ transporting V1 subunit B1 |
| refseq_nuc | NM_001692.4 |
| refseq_prot | NP_001683.2 |
| ensembl_nuc | ENST00000234396.10 |
| ensembl_prot | ENSP00000234396.4 |
| mane_status | MANE Select |
| chr | chr2 |
| start | 70935900 |
| end | 70965431 |
| strand | + |
| ver | v1.2 |
| region | chr2:70935900-70965431 |
| region5000 | chr2:70930900-70970431 |
| regionname0 | ATP6V1B1_chr2_70935900_70965431 |
| regionname5000 | ATP6V1B1_chr2_70930900_70970431 |
| chr:pos | ref | alt | af | annotation | impact | samples | AHAPIDS | ACHAPIDS | ACTHAPIDS | ACTGHAPIDS | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr2:70935956
|
T | C | 0.3455 | start_lost | HIGH | HG00140.hp2 HG00323.hp2 HG00408.hp1 others(149): Show |
a0002a0004a0005others(4): Show | a0002c0003a0002c0006a0002c0008others(18): Show | a0002c0003t0001a0002c0006t0001a0002c0006t0003others(21): Show | a0002c0003t0001g0021a0002c0003t0001g0271a0002c0003t0001g0280others(144): Show | 152 | 440 | 0 | ATP6V1B1 | ENSG00000116039.13 | transcript | ENST00000234396.10 | protein_coding | 1/14 | c.2T>C | p.Met1? | 57/1907 | 2/1542 | 1/513 |
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|
| chr:pos | ref | alt | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | af | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr2:70936095
|
C | T | intron_variant | MODIFIER | HG00140.hp2 HG00323.hp2 HG00408.hp1 others(154): Show |
a0001a0002a0004others(5): Show | a0001c0001a0002c0003a0002c0006others(19): Show | a0001c0001t0006a0002c0003t0001a0002c0006t0001others(22): Show | a0001c0001t0006g0393a0001c0001t0006g0394a0001c0001t0006g0395others(149): Show | 157 | 440 | 0.3568 | 0 | ATP6V1B1 | ENSG00000116039.13 | transcript | ENST00000234396.10 | protein_coding | 1/13 | c.118+23C>T | ||||||
|
chr2:70936620
|
C | T | intron_variant | MODIFIER | HG00140.hp2 HG00323.hp2 HG00408.hp1 others(353): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0002a0001c0005others(33): Show | a0001c0001t0001a0001c0001t0006a0001c0001t0010others(40): Show | a0001c0001t0001g0010a0001c0001t0001g0013a0001c0001t0001g0024others(337): Show | 356 | 440 | 0.8091 | 0 | ATP6V1B1 | ENSG00000116039.13 | transcript | ENST00000234396.10 | protein_coding | 1/13 | c.118+548C>T | ||||||
|
chr2:70937072
|
AAGCCAGA others(43): Show |
A | intron_variant | MODIFIER | HG00323.hp2 HG00408.hp1 HG00408.hp2 others(306): Show |
a0001a0002a0003others(6): Show | a0001c0001a0001c0002a0001c0005others(30): Show | a0001c0001t0001a0001c0001t0006a0001c0001t0010others(36): Show | a0001c0001t0001g0010a0001c0001t0001g0013a0001c0001t0001g0025others(295): Show | 309 | 440 | 0.7023 | -50 | ATP6V1B1 | ENSG00000116039.13 | transcript | ENST00000234396.10 | protein_coding | 1/13 | c.118+1063_118+1112delACTGGAGTAAACCAGCATGGCCCGCCACAGCTATGCAGAGCCAGAGGCTC | INFO_REALIGN_3_PRIME | |||||
|
chr2:70940913
|
C | T | intron_variant | MODIFIER | HG00140.hp2 HG00323.hp2 HG00408.hp2 others(139): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0005a0002c0003others(14): Show | a0001c0001t0001a0001c0001t0010a0001c0005t0001others(18): Show | a0001c0001t0001g0024a0001c0001t0001g0026a0001c0001t0001g0027others(134): Show | 142 | 440 | 0.3227 | 0 | ATP6V1B1 | ENSG00000116039.13 | transcript | ENST00000234396.10 | protein_coding | 1/13 | c.119-2745C>T | ||||||
|
chr2:70942987
|
A | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(433): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0002a0001c0005others(33): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0006others(42): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(407): Show | 436 | 440 | 0.9909 | 0 | ATP6V1B1 | ENSG00000116039.13 | transcript | ENST00000234396.10 | protein_coding | 1/13 | c.119-671A>C | ||||||
|
chr2:70945701
|
GAT | G | intron_variant | MODIFIER | HG00621.hp1 HG01168.hp2 HG01169.hp1 others(28): Show |
a0001a0002a0003 | a0001c0001a0001c0005a0002c0003others(6): Show | a0001c0001t0001a0001c0005t0001a0002c0003t0001others(7): Show | a0001c0001t0001g0013a0001c0005t0001g0036a0002c0003t0001g0291others(26): Show | 31 | 440 | 0.0705 | -2 | ATP6V1B1 | ENSG00000116039.13 | transcript | ENST00000234396.10 | protein_coding | 2/13 | c.174+2028_174+2029delTA | INFO_REALIGN_3_PRIME | |||||
|
chr2:70949072
|
C | A | intron_variant | MODIFIER | HG00140.hp2 HG01496.hp1 HG01981.hp2 others(3): Show |
a0001a0002a0007 | a0001c0001a0002c0006a0007c0026 | a0001c0001t0001a0002c0006t0001a0007c0026t0001 | a0001c0001t0001g0060a0002c0006t0001g0279a0002c0006t0001g0306others(3): Show | 6 | 440 | 0.0136 | 0 | ATP6V1B1 | ENSG00000116039.13 | transcript | ENST00000234396.10 | protein_coding | 2/13 | c.174+5359C>A | ||||||
|
chr2:70949530
|
C | T | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00408.hp2 others(145): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0005others(17): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0006others(21): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(135): Show | 148 | 440 | 0.3364 | 0 | ATP6V1B1 | ENSG00000116039.13 | transcript | ENST00000234396.10 | protein_coding | 2/13 | c.174+5817C>T | ||||||
|
chr2:70950874
|
C | T | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00621.hp2 others(76): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0005a0002c0003others(6): Show | a0001c0001t0001a0001c0001t0003a0001c0005t0001others(8): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(67): Show | 79 | 440 | 0.1796 | 0 | ATP6V1B1 | ENSG00000116039.13 | transcript | ENST00000234396.10 | protein_coding | 2/13 | c.174+7161C>T | ||||||
|
chr2:70950932
|
A | AT | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00642.hp1 others(85): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0002a0001c0005others(14): Show | a0001c0001t0001a0001c0001t0003a0001c0002t0001others(18): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(78): Show | 88 | 440 | 0.2000 | 1 | ATP6V1B1 | ENSG00000116039.13 | transcript | ENST00000234396.10 | protein_coding | 2/13 | c.175-7087dupT | INFO_REALIGN_3_PRIME | |||||
|
chr2:70950968
|
G | A | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00621.hp2 others(81): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0005others(8): Show | a0001c0001t0001a0001c0001t0003a0001c0002t0001others(10): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(72): Show | 84 | 440 | 0.1909 | 0 | ATP6V1B1 | ENSG00000116039.13 | transcript | ENST00000234396.10 | protein_coding | 2/13 | c.175-7078G>A | ||||||
|
chr2:70951030
|
G | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(388): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0002a0001c0005others(30): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0006others(38): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(364): Show | 391 | 440 | 0.8886 | 0 | ATP6V1B1 | ENSG00000116039.13 | transcript | ENST00000234396.10 | protein_coding | 2/13 | c.175-7016G>C | ||||||
|
chr2:70951724
|
C | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00621.hp2 others(81): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0002a0001c0005others(8): Show | a0001c0001t0001a0001c0001t0003a0001c0002t0001others(10): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(72): Show | 84 | 440 | 0.1909 | 0 | ATP6V1B1 | ENSG00000116039.13 | transcript | ENST00000234396.10 | protein_coding | 2/13 | c.175-6322C>G | ||||||
|
chr2:70953488
|
A | T | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00408.hp2 others(154): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0002a0001c0005others(18): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0006others(22): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(144): Show | 157 | 440 | 0.3568 | 0 | ATP6V1B1 | ENSG00000116039.13 | transcript | ENST00000234396.10 | protein_coding | 2/13 | c.175-4558A>T | ||||||
|
chr2:70954852
|
AG | A | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00621.hp2 others(77): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0005a0002c0003others(7): Show | a0001c0001t0001a0001c0001t0003a0001c0005t0001others(9): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(68): Show | 80 | 440 | 0.1818 | -1 | ATP6V1B1 | ENSG00000116039.13 | transcript | ENST00000234396.10 | protein_coding | 2/13 | c.175-3191delG | INFO_REALIGN_3_PRIME | |||||
|
chr2:70955770
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00408.hp2 others(207): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0002a0001c0005others(20): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0006others(27): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(196): Show | 210 | 440 | 0.4773 | 0 | ATP6V1B1 | ENSG00000116039.13 | transcript | ENST00000234396.10 | protein_coding | 2/13 | c.175-2276T>C | ||||||
|
chr2:70956753
|
G | A | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00408.hp2 others(178): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0002a0001c0005others(19): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0006others(26): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(167): Show | 181 | 440 | 0.4114 | 0 | ATP6V1B1 | ENSG00000116039.13 | transcript | ENST00000234396.10 | protein_coding | 2/13 | c.175-1293G>A | ||||||
|
chr2:70957250
|
AAT | A | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00423.hp1 others(221): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0002a0001c0005others(22): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0006others(27): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0003others(200): Show | 224 | 440 | 0.5091 | -2 | ATP6V1B1 | ENSG00000116039.13 | transcript | ENST00000234396.10 | protein_coding | 2/13 | c.175-776_175-775delTA | INFO_REALIGN_3_PRIME | |||||
|
chr2:70964114
|
A | AT | intron_variant | MODIFIER | HG00140.hp1 HG00423.hp2 HG00558.hp1 others(75): Show |
a0001a0002a0003 | a0001c0001a0001c0007a0002c0006others(7): Show | a0001c0001t0001a0001c0007t0001a0002c0006t0001others(7): Show | a0001c0001t0001g0001a0001c0001t0001g0007a0001c0001t0001g0008others(69): Show | 78 | 440 | 0.1773 | 1 | ATP6V1B1 | ENSG00000116039.13 | transcript | ENST00000234396.10 | protein_coding | 11/13 | c.1144-302dupT | INFO_REALIGN_3_PRIME |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
ahapid | alen | total | AFR | AMR | EAS | EUR | SAS | aseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ATP6V1B1 | 0/1 | a0002 | 511 | 142 | 34 | 16 | 76 | 2 | 13 | subcellular location copy fasta | chr2 | 70930900 | 70970431 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
chapid | clen | total | AFR | AMR | EAS | EUR | SAS | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ATP6V1B1 | 0/1 | c0006 | 1542 | 28 | 9 | 2 | 11 | 2 | 3 | copy fasta | chr2 | 70930900 | 70970431 |
| genename | grch38/chm13v2 | thapid | tlen | total | AFR | AMR | EAS | EUR | SAS | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ATP6V1B1 | 1/1 | t0001 | 366 | 347 | 65 | 77 | 156 | 10 | 37 | copy fasta | chr2 | 70930900 | 70970431 |
| genename | grch38/chm13v2 | ghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| ATP6V1B1 | 0/0 | g0306 | 1 | 0 | 0 | 0 | 0 | 1 | chr2 | 70930900 | 70970431 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
achapid | total | AFR | AMR | EAS | EUR | SAS | clen | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ATP6V1B1 | 0/1 | a0002c0006 | 28 | 9 | 2 | 11 | 2 | 3 | 1542 | copy fasta | chr2 | 70930900 | 70970431 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
acthapid | total | AFR | AMR | EAS | EUR | SAS | tlen | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ATP6V1B1 | 0/1 | a0002c0006t0001 | 24 | 9 | 2 | 7 | 2 | 3 | 1907 | copy fasta | chr2 | 70930900 | 70970431 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
actghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| ATP6V1B1 | 0/0 | a0002c0006t0001g0306 | 1 | 0 | 0 | 0 | 0 | 1 | chr2 | 70930900 | 70970431 |
Click to load Haplotype QTL data...
| pos | S. Strand |
E# Exon Number |
max | median | min | diff | type | haplotypeid | max_hap_list | min_hap_list | symbol | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 70936072 | + | 1 | -0.4568 | -0.4568 | -0.4568 | 0.0000 | acceptor | a0002c0006t0001g0306 | NA20905.hp1 | NA20905.hp1 | ATP6V1B1 | chr2 | 70930900 | 70970431 |
| 70943658 | + | 2 | 0.9074 | 0.9074 | 0.9074 | 0.0000 | donor | a0002c0006t0001g0306 | NA20905.hp1 | NA20905.hp1 | ATP6V1B1 | chr2 | 70930900 | 70970431 |
| 70943713 | + | 2 | -0.9902 | -0.9902 | -0.9902 | 0.0000 | acceptor | a0002c0006t0001g0306 | NA20905.hp1 | NA20905.hp1 | ATP6V1B1 | chr2 | 70930900 | 70970431 |
| 70958046 | + | 3 | 0.9977 | 0.9977 | 0.9977 | 0.0000 | donor | a0002c0006t0001g0306 | NA20905.hp1 | NA20905.hp1 | ATP6V1B1 | chr2 | 70930900 | 70970431 |
| 70958144 | + | 3 | -0.9985 | -0.9985 | -0.9985 | 0.0000 | acceptor | a0002c0006t0001g0306 | NA20905.hp1 | NA20905.hp1 | ATP6V1B1 | chr2 | 70930900 | 70970431 |
| 70958333 | + | 4 | 0.9983 | 0.9983 | 0.9983 | 0.0000 | donor | a0002c0006t0001g0306 | NA20905.hp1 | NA20905.hp1 | ATP6V1B1 | chr2 | 70930900 | 70970431 |
| 70958426 | + | 4 | -0.9941 | -0.9941 | -0.9941 | 0.0000 | acceptor | a0002c0006t0001g0306 | NA20905.hp1 | NA20905.hp1 | ATP6V1B1 | chr2 | 70930900 | 70970431 |
| 70959018 | + | 5 | 0.9986 | 0.9986 | 0.9986 | 0.0000 | donor | a0002c0006t0001g0306 | NA20905.hp1 | NA20905.hp1 | ATP6V1B1 | chr2 | 70930900 | 70970431 |
| 70959095 | + | 5 | -0.9982 | -0.9981 | -0.9982 | 0.0000 | acceptor | a0002c0006t0001g0306 | NA20905.hp1 | NA20905.hp1 | ATP6V1B1 | chr2 | 70930900 | 70970431 |
| 70959939 | + | 6 | 0.9976 | 0.9976 | 0.9976 | 0.0000 | donor | a0002c0006t0001g0306 | NA20905.hp1 | NA20905.hp1 | ATP6V1B1 | chr2 | 70930900 | 70970431 |
| 70960078 | + | 6 | -0.9989 | -0.9989 | -0.9989 | 0.0000 | acceptor | a0002c0006t0001g0306 | NA20905.hp1 | NA20905.hp1 | ATP6V1B1 | chr2 | 70930900 | 70970431 |
| 70960921 | + | 7 | 0.9981 | 0.9981 | 0.9981 | 0.0000 | donor | a0002c0006t0001g0306 | NA20905.hp1 | NA20905.hp1 | ATP6V1B1 | chr2 | 70930900 | 70970431 |
| 70961022 | + | 7 | -0.9963 | -0.9963 | -0.9963 | 0.0000 | acceptor | a0002c0006t0001g0306 | NA20905.hp1 | NA20905.hp1 | ATP6V1B1 | chr2 | 70930900 | 70970431 |
| 70961596 | + | 8 | 0.9516 | 0.9516 | 0.9516 | 0.0000 | donor | a0002c0006t0001g0306 | NA20905.hp1 | NA20905.hp1 | ATP6V1B1 | chr2 | 70930900 | 70970431 |
| 70961693 | + | 8 | -0.8999 | -0.8999 | -0.8999 | 0.0000 | acceptor | a0002c0006t0001g0306 | NA20905.hp1 | NA20905.hp1 | ATP6V1B1 | chr2 | 70930900 | 70970431 |
| 70962777 | + | 9 | 0.9919 | 0.9919 | 0.9919 | 0.0000 | donor | a0002c0006t0001g0306 | NA20905.hp1 | NA20905.hp1 | ATP6V1B1 | chr2 | 70930900 | 70970431 |
| 70962900 | + | 9 | -0.9995 | -0.9995 | -0.9995 | 0.0000 | acceptor | a0002c0006t0001g0306 | NA20905.hp1 | NA20905.hp1 | ATP6V1B1 | chr2 | 70930900 | 70970431 |
| 70963162 | + | 10 | 0.9478 | 0.9478 | 0.9478 | 0.0000 | donor | a0002c0006t0001g0306 | NA20905.hp1 | NA20905.hp1 | ATP6V1B1 | chr2 | 70930900 | 70970431 |
| 70963312 | + | 10 | -0.9236 | -0.9236 | -0.9236 | 0.0000 | acceptor | a0002c0006t0001g0306 | NA20905.hp1 | NA20905.hp1 | ATP6V1B1 | chr2 | 70930900 | 70970431 |
| 70963572 | + | 11 | 0.9903 | 0.9903 | 0.9903 | 0.0000 | donor | a0002c0006t0001g0306 | NA20905.hp1 | NA20905.hp1 | ATP6V1B1 | chr2 | 70930900 | 70970431 |
| 70963654 | + | 11 | -0.9964 | -0.9964 | -0.9964 | 0.0000 | acceptor | a0002c0006t0001g0306 | NA20905.hp1 | NA20905.hp1 | ATP6V1B1 | chr2 | 70930900 | 70970431 |
| 70964438 | + | 12 | 0.9993 | 0.9992 | 0.9993 | 0.0000 | donor | a0002c0006t0001g0306 | NA20905.hp1 | NA20905.hp1 | ATP6V1B1 | chr2 | 70930900 | 70970431 |
| 70964542 | + | 12 | -0.9980 | -0.9980 | -0.9980 | 0.0000 | acceptor | a0002c0006t0001g0306 | NA20905.hp1 | NA20905.hp1 | ATP6V1B1 | chr2 | 70930900 | 70970431 |
| 70964736 | + | 13 | 0.9894 | 0.9894 | 0.9894 | 0.0000 | donor | a0002c0006t0001g0306 | NA20905.hp1 | NA20905.hp1 | ATP6V1B1 | chr2 | 70930900 | 70970431 |
| 70964865 | + | 13 | -0.9993 | -0.9993 | -0.9993 | 0.0000 | acceptor | a0002c0006t0001g0306 | NA20905.hp1 | NA20905.hp1 | ATP6V1B1 | chr2 | 70930900 | 70970431 |
| 70964958 | + | 14 | 0.9993 | 0.9993 | 0.9993 | 0.0000 | donor | a0002c0006t0001g0306 | NA20905.hp1 | NA20905.hp1 | ATP6V1B1 | chr2 | 70930900 | 70970431 |
| CHR:POS | annotationhgvs_chgvs_p | disease trait-log10podds or beta | AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
study | initial sample size/replication sample size | report genes | mapped gene | strongest snp risk allele | strand strand
|
impact | chr | ref | alt |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr2:70936095
|
c.118+23C>T | Urate levels0.022269 | a0001a0002a0004a0005a0007others(3): Show | a0001c0001a0002c0003a0002c0006a0002c0008a0002c0010others(17): Show | a0001c0001t0006a0002c0003t0001a0002c0006t0001a0002c0006t0003a0002c0008t0002others(20): Show | a0001c0001t0006g0393a0001c0001t0006g0394a0001c0001t0006g0395a0001c0001t0006g0396a0001c0001t0006g0408others(147): Show | HG00140.hp2 HG00323.hp2 HG00408.hp1 HG00438.hp2 HG00558.hp2 others(152): Show |
Target genes, variants, tissues and transcriptiona others(48): Show |
288,649 European ancestry individuals/ | ATP6V1B1 | VAX2, ATP6V1B1 | rs759219-T | + | MODIFIER | chr2 | C | T |
|
chr2:70936095
|
c.118+23C>T | Urate levels0.0182 | a0001a0002a0004a0005a0007others(3): Show | a0001c0001a0002c0003a0002c0006a0002c0008a0002c0010others(17): Show | a0001c0001t0006a0002c0003t0001a0002c0006t0001a0002c0006t0003a0002c0008t0002others(20): Show | a0001c0001t0006g0393a0001c0001t0006g0394a0001c0001t0006g0395a0001c0001t0006g0396a0001c0001t0006g0408others(147): Show | HG00140.hp2 HG00323.hp2 HG00408.hp1 HG00438.hp2 HG00558.hp2 others(152): Show |
Target genes, variants, tissues and transcriptiona others(48): Show |
288,649 European ancestry individuals, 125,725 Eas others(132): Show |
ATP6V1B1 | VAX2, ATP6V1B1 | rs759219-T | + | MODIFIER | chr2 | C | T |
|
chr2:70936095
|
c.118+23C>T | Serum urate levels0.0199 | a0001a0002a0004a0005a0007others(3): Show | a0001c0001a0002c0003a0002c0006a0002c0008a0002c0010others(17): Show | a0001c0001t0006a0002c0003t0001a0002c0006t0001a0002c0006t0003a0002c0008t0002others(20): Show | a0001c0001t0006g0393a0001c0001t0006g0394a0001c0001t0006g0395a0001c0001t0006g0396a0001c0001t0006g0408others(147): Show | HG00140.hp2 HG00323.hp2 HG00408.hp1 HG00438.hp2 HG00558.hp2 others(152): Show |
A genome-wide association analysis reveals new pat others(25): Show |
630,117 European ancestry individuals/ | VAX2, ATP6V1B1 | rs759219-T | + | MODIFIER | chr2 | C | T | |
|
chr2:70936095
|
c.118+23C>T | Estimated glomerular filtration rate (creatinine)others(14): Show | a0001a0002a0004a0005a0007others(3): Show | a0001c0001a0002c0003a0002c0006a0002c0008a0002c0010others(17): Show | a0001c0001t0006a0002c0003t0001a0002c0006t0001a0002c0006t0003a0002c0008t0002others(20): Show | a0001c0001t0006g0393a0001c0001t0006g0394a0001c0001t0006g0395a0001c0001t0006g0396a0001c0001t0006g0408others(147): Show | HG00140.hp2 HG00323.hp2 HG00408.hp1 HG00438.hp2 HG00558.hp2 others(152): Show |
Epigenomic and transcriptomic analyses define core others(64): Show |
1,205,871 European ancestry individuals, 168,300 E others(384): Show |
VAX2, ATP6V1B1 | rs759219-T | + | MODIFIER | chr2 | C | T | |
|
chr2:70935643
|
c.-312C>T | Serum urate levels0.0214 | a0002a0004a0005a0007a0008others(2): Show | a0002c0003a0002c0006a0002c0008a0002c0010a0002c0011others(16): Show | a0002c0003t0001a0002c0006t0001a0002c0006t0003a0002c0008t0002a0002c0010t0002others(19): Show | a0002c0003t0001g0271a0002c0003t0001g0280a0002c0003t0001g0282a0002c0003t0001g0285a0002c0003t0001g0286others(137): Show | HG00140.hp2 HG00323.hp2 HG00408.hp1 HG00438.hp2 HG00558.hp2 others(141): Show |
Large-scale cross-ancestry genome-wide meta-analys others(18): Show |
677,373 European ancestry individuals/ | VAX2 | rs17663700-T | + | MODIFIER | chr2 | C | T | |
|
chr2:70935956
|
c.2T>Cp.Met1? | Serum urate levels0.0187 | a0002a0004a0005a0007a0008others(2): Show | a0002c0003a0002c0006a0002c0008a0002c0010a0002c0011others(16): Show | a0002c0003t0001a0002c0006t0001a0002c0006t0003a0002c0008t0002a0002c0010t0002others(19): Show | a0002c0003t0001g0021a0002c0003t0001g0271a0002c0003t0001g0280a0002c0003t0001g0282a0002c0003t0001g0285others(142): Show | HG00140.hp2 HG00323.hp2 HG00408.hp1 HG00438.hp2 HG00558.hp2 others(147): Show |
Large-scale cross-ancestry genome-wide meta-analys others(18): Show |
219,768 East Asian ancestry individuals, 677,373 E others(50): Show |
VAX2, ATP6V1B1 | rs11681642-T | + | HIGH | chr2 | T | C | |
|
chr2:70935643
|
c.-312C>T | Estimated glomerular filtration rate (creatinine)others(18): Show | a0002a0004a0005a0007a0008others(2): Show | a0002c0003a0002c0006a0002c0008a0002c0010a0002c0011others(16): Show | a0002c0003t0001a0002c0006t0001a0002c0006t0003a0002c0008t0002a0002c0010t0002others(19): Show | a0002c0003t0001g0271a0002c0003t0001g0280a0002c0003t0001g0282a0002c0003t0001g0285a0002c0003t0001g0286others(137): Show | HG00140.hp2 HG00323.hp2 HG00408.hp1 HG00438.hp2 HG00558.hp2 others(141): Show |
Variants in tubule epithelial regulatory elements others(60): Show |
406,504 European ancestry individuals/ | VAX2 | rs17663700-T | + | MODIFIER | chr2 | C | T | |
|
chr2:70935643
|
c.-312C>T | Estimated glomerular filtration rate (creatinine, cystatin c)others(29): Show | a0002a0004a0005a0007a0008others(2): Show | a0002c0003a0002c0006a0002c0008a0002c0010a0002c0011others(16): Show | a0002c0003t0001a0002c0006t0001a0002c0006t0003a0002c0008t0002a0002c0010t0002others(19): Show | a0002c0003t0001g0271a0002c0003t0001g0280a0002c0003t0001g0282a0002c0003t0001g0285a0002c0003t0001g0286others(137): Show | HG00140.hp2 HG00323.hp2 HG00408.hp1 HG00438.hp2 HG00558.hp2 others(141): Show |
Variants in tubule epithelial regulatory elements others(60): Show |
406,504 European ancestry individuals/ | VAX2 | rs17663700-T | + | MODIFIER | chr2 | C | T | |
|
chr2:70935643
|
c.-312C>T | Cystatin C levels in bottom 99% of individuals by creatinine levelsothers(37): Show | a0002a0004a0005a0007a0008others(2): Show | a0002c0003a0002c0006a0002c0008a0002c0010a0002c0011others(16): Show | a0002c0003t0001a0002c0006t0001a0002c0006t0003a0002c0008t0002a0002c0010t0002others(19): Show | a0002c0003t0001g0271a0002c0003t0001g0280a0002c0003t0001g0282a0002c0003t0001g0285a0002c0003t0001g0286others(137): Show | HG00140.hp2 HG00323.hp2 HG00408.hp1 HG00438.hp2 HG00558.hp2 others(141): Show |
Genetic analysis of elevated levels of creatinine others(85): Show |
417,815 European ancestry individuals/ | VAX2 | rs17663700-? | + | MODIFIER | chr2 | C | T | |
|
chr2:70935643
|
c.-312C>T |
Estimated glomerular filtration rate based on creatinine and cystatin C in bottom 99% of individuals others(88): Show |
a0002a0004a0005a0007a0008others(2): Show | a0002c0003a0002c0006a0002c0008a0002c0010a0002c0011others(16): Show | a0002c0003t0001a0002c0006t0001a0002c0006t0003a0002c0008t0002a0002c0010t0002others(19): Show | a0002c0003t0001g0271a0002c0003t0001g0280a0002c0003t0001g0282a0002c0003t0001g0285a0002c0003t0001g0286others(137): Show | HG00140.hp2 HG00323.hp2 HG00408.hp1 HG00438.hp2 HG00558.hp2 others(141): Show |
Genetic analysis of elevated levels of creatinine others(85): Show |
417,815 European ancestry individuals/ | VAX2 | rs17663700-? | + | MODIFIER | chr2 | C | T | |
|
chr2:70935643
|
c.-312C>T | Estimated glomerular filtration rate (cystatin c)others(18): Show | a0002a0004a0005a0007a0008others(2): Show | a0002c0003a0002c0006a0002c0008a0002c0010a0002c0011others(16): Show | a0002c0003t0001a0002c0006t0001a0002c0006t0003a0002c0008t0002a0002c0010t0002others(19): Show | a0002c0003t0001g0271a0002c0003t0001g0280a0002c0003t0001g0282a0002c0003t0001g0285a0002c0003t0001g0286others(137): Show | HG00140.hp2 HG00323.hp2 HG00408.hp1 HG00438.hp2 HG00558.hp2 others(141): Show |
Variants in tubule epithelial regulatory elements others(60): Show |
406,504 European ancestry individuals/ | VAX2 | rs17663700-T | + | MODIFIER | chr2 | C | T | |
|
chr2:70935956
|
c.2T>Cp.Met1? | Serum creatinine levels0.009 | a0002a0004a0005a0007a0008others(2): Show | a0002c0003a0002c0006a0002c0008a0002c0010a0002c0011others(16): Show | a0002c0003t0001a0002c0006t0001a0002c0006t0003a0002c0008t0002a0002c0010t0002others(19): Show | a0002c0003t0001g0021a0002c0003t0001g0271a0002c0003t0001g0280a0002c0003t0001g0282a0002c0003t0001g0285others(142): Show | HG00140.hp2 HG00323.hp2 HG00408.hp1 HG00438.hp2 HG00558.hp2 others(147): Show |
A cross-population atlas of genetic associations f others(24): Show |
344,104 European ancestry individuals, 150,266 Eas others(29): Show |
VAX2, ATP6V1B1 | rs11681642-C | + | HIGH | chr2 | T | C | |
|
chr2:70935643
|
c.-312C>T | Serum uric acid levels0.0124 | a0002a0004a0005a0007a0008others(2): Show | a0002c0003a0002c0006a0002c0008a0002c0010a0002c0011others(16): Show | a0002c0003t0001a0002c0006t0001a0002c0006t0003a0002c0008t0002a0002c0010t0002others(19): Show | a0002c0003t0001g0271a0002c0003t0001g0280a0002c0003t0001g0282a0002c0003t0001g0285a0002c0003t0001g0286others(137): Show | HG00140.hp2 HG00323.hp2 HG00408.hp1 HG00438.hp2 HG00558.hp2 others(141): Show |
A cross-population atlas of genetic associations f others(24): Show |
343,836 European ancestry individuals, 129,405 Eas others(29): Show |
VAX2 | rs17663700-T | + | MODIFIER | chr2 | C | T |