| geneid | 100507747 |
|---|---|
| ensemblid | ENSG00000283199.3 |
| hgncid | 53786 |
| symbol | C13orf46 |
| name | chromosome 13 open reading frame 46 |
| refseq_nuc | NM_001365455.2 |
| refseq_prot | NP_001352384.1 |
| ensembl_nuc | ENST00000636427.3 |
| ensembl_prot | ENSP00000490032.2 |
| mane_status | MANE Select |
| chr | chr13 |
| start | 113953705 |
| end | 113974076 |
| strand | - |
| ver | v1.2 |
| region | chr13:113953705-113974076 |
| region5000 | chr13:113948705-113979076 |
| regionname0 | C13orf46_chr13_113953705_113974076 |
| regionname5000 | C13orf46_chr13_113948705_113979076 |
| chr:pos | ref | alt | af | annotation | impact | samples | AHAPIDS | ACHAPIDS | ACTHAPIDS | ACTGHAPIDS | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr13:113954158
|
A | G | 0.9565 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(393): Show |
a0001a0002a0003others(4): Show | a0001c0001a0001c0008a0002c0002others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(108): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(232): Show | 396 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*2615T>C | 2615 | |||||
|
chr13:113955386
|
C | T | 0.0459 | 3_prime_UTR_variant | MODIFIER | HG00738.hp2 HG01070.hp2 HG01168.hp2 others(16): Show |
a0001 | a0001c0001 | a0001c0001t0006a0001c0001t0030a0001c0001t0031others(5): Show | a0001c0001t0006g0005a0001c0001t0006g0098a0001c0001t0006g0099others(9): Show | 19 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*1387G>A | 1387 | |||||
|
chr13:113955390
|
G | A | 0.0459 | 3_prime_UTR_variant | MODIFIER | HG00738.hp2 HG01070.hp2 HG01168.hp2 others(16): Show |
a0001 | a0001c0001 | a0001c0001t0006a0001c0001t0030a0001c0001t0031others(5): Show | a0001c0001t0006g0005a0001c0001t0006g0098a0001c0001t0006g0099others(9): Show | 19 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*1383C>T | 1383 | |||||
|
chr13:113955435
|
T | C | 0.3551 | 3_prime_UTR_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp1 others(144): Show |
a0001a0005a0006others(1): Show | a0001c0001a0001c0008a0005c0005others(2): Show | a0001c0001t0001a0001c0001t0006a0001c0001t0009others(31): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(82): Show | 147 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*1338A>G | 1338 | |||||
|
chr13:113955529
|
CGGAGACG others(13): Show |
C | 0.0048 | 3_prime_UTR_variant | MODIFIER | HG01358.hp2 HG04184.hp1 |
a0001 | a0001c0001 | a0001c0001t0030 | a0001c0001t0030g0097a0001c0001t0030g0101 | 2 | 414 | -20 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*1224_*1243delACGAGATGCTCCTCGTCTCC | 1224 | |||||
|
chr13:113955555
|
G | T | 0.0048 | 3_prime_UTR_variant | MODIFIER | HG01358.hp2 HG04184.hp1 |
a0001 | a0001c0001 | a0001c0001t0030 | a0001c0001t0030g0097a0001c0001t0030g0101 | 2 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*1218C>A | 1218 | |||||
|
chr13:113955639
|
GAGGAGTA others(16): Show |
G | 0.0894 | 3_prime_UTR_variant | MODIFIER | HG00423.hp1 HG00558.hp2 HG00609.hp2 others(34): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0001a0001c0001t0005a0001c0001t0010others(15): Show | a0001c0001t0001g0002a0001c0001t0001g0028a0001c0001t0001g0219others(25): Show | 37 | 414 | -23 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*1111_*1133delTGTCTCTGCCAGACACTACTCCT | 1111 | |||||
|
chr13:113955762
|
TCCGGCGG others(13): Show |
T | 0.0676 | 3_prime_UTR_variant | MODIFIER | HG00597.hp2 HG00738.hp2 HG01070.hp2 others(25): Show |
a0001 | a0001c0001 | a0001c0001t0006a0001c0001t0020a0001c0001t0030others(11): Show | a0001c0001t0006g0005a0001c0001t0006g0098a0001c0001t0006g0099others(15): Show | 28 | 414 | -20 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*991_*1010delCTGCTCCTCGTCTCCGCCGG | 991 | |||||
|
chr13:113955940
|
C | G | 0.0459 | 3_prime_UTR_variant | MODIFIER | HG00738.hp2 HG01070.hp2 HG01168.hp2 others(16): Show |
a0001 | a0001c0001 | a0001c0001t0006a0001c0001t0030a0001c0001t0031others(5): Show | a0001c0001t0006g0005a0001c0001t0006g0098a0001c0001t0006g0099others(9): Show | 19 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*833G>C | 833 | |||||
|
chr13:113955994
|
A | G | 0.6570 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(269): Show |
a0001a0002a0003others(1): Show | a0001c0001a0002c0002a0003c0003others(1): Show | a0001c0001t0002a0001c0001t0003a0001c0001t0005others(82): Show | a0001c0001t0002g0004a0001c0001t0002g0010a0001c0001t0002g0014others(161): Show | 272 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*779T>C | 779 | |||||
|
chr13:113956039
|
C | T | 0.0459 | 3_prime_UTR_variant | MODIFIER | HG00738.hp2 HG01070.hp2 HG01168.hp2 others(16): Show |
a0001 | a0001c0001 | a0001c0001t0006a0001c0001t0030a0001c0001t0031others(5): Show | a0001c0001t0006g0005a0001c0001t0006g0098a0001c0001t0006g0099others(9): Show | 19 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*734G>A | 734 | |||||
|
chr13:113956040
|
A | G | 0.5145 | 3_prime_UTR_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp1 others(210): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0008a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0005a0001c0001t0006others(57): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(126): Show | 213 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*733T>C | 733 | |||||
|
chr13:113956082
|
C | T | 0.0459 | 3_prime_UTR_variant | MODIFIER | HG00738.hp2 HG01070.hp2 HG01168.hp2 others(16): Show |
a0001 | a0001c0001 | a0001c0001t0006a0001c0001t0030a0001c0001t0031others(5): Show | a0001c0001t0006g0005a0001c0001t0006g0098a0001c0001t0006g0099others(9): Show | 19 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*691G>A | 691 | |||||
|
chr13:113956178
|
A | G | 0.5193 | 3_prime_UTR_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp1 others(212): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0008a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0005a0001c0001t0006others(59): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(128): Show | 215 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*595T>C | 595 | |||||
|
chr13:113956263
|
A | G | 0.5193 | 3_prime_UTR_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp1 others(212): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0008a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0005a0001c0001t0006others(59): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(128): Show | 215 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*510T>C | 510 | |||||
|
chr13:113956337
|
A | AGAG | 0.1329 | 3_prime_UTR_variant | MODIFIER | HG00639.hp2 HG00642.hp2 HG00738.hp2 others(52): Show |
a0001a0002a0003 | a0001c0001a0002c0002a0003c0003 | a0001c0001t0005a0001c0001t0006a0001c0001t0019others(14): Show | a0001c0001t0005g0009a0001c0001t0005g0029a0001c0001t0005g0080others(31): Show | 55 | 414 | 3 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*433_*435dupCTC | 435 | |||||
|
chr13:113956547
|
A | G | 0.5169 | 3_prime_UTR_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp1 others(211): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0008a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0005a0001c0001t0006others(58): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(127): Show | 214 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*226T>C | 226 |
| chr:pos | ref | alt | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | af | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr13:113958051
|
G | A | intron_variant | MODIFIER | HG00738.hp2 HG01070.hp2 HG01168.hp2 others(16): Show |
a0001 | a0001c0001 | a0001c0001t0006a0001c0001t0030a0001c0001t0031others(5): Show | a0001c0001t0006g0005a0001c0001t0006g0098a0001c0001t0006g0099others(9): Show | 19 | 414 | 0.0459 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 6/6 | c.573-1212C>T | ||||||
|
chr13:113958151
|
G | A | intron_variant | MODIFIER | HG00738.hp2 HG01070.hp2 HG01168.hp2 others(16): Show |
a0001 | a0001c0001 | a0001c0001t0006a0001c0001t0030a0001c0001t0031others(5): Show | a0001c0001t0006g0005a0001c0001t0006g0098a0001c0001t0006g0099others(9): Show | 19 | 414 | 0.0459 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 6/6 | c.573-1312C>T | ||||||
|
chr13:113960024
|
A | G | intron_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp1 others(212): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0008a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0005a0001c0001t0006others(59): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(128): Show | 215 | 414 | 0.5193 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 6/6 | c.573-3185T>C | ||||||
|
chr13:113960255
|
C | CA | intron_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp1 others(212): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0008a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0005a0001c0001t0006others(59): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(128): Show | 215 | 414 | 0.5193 | 1 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 6/6 | c.573-3417dupT | ||||||
|
chr13:113961341
|
C | T | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(406): Show |
a0001a0002a0003others(4): Show | a0001c0001a0001c0008a0002c0002others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(113): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(241): Show | 409 | 414 | 0.9879 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 6/6 | c.572+3586G>A | ||||||
|
chr13:113963177
|
G | C | intron_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp1 others(212): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0008a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0005a0001c0001t0006others(59): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(128): Show | 215 | 414 | 0.5193 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 6/6 | c.572+1750C>G | ||||||
|
chr13:113963321
|
T | C | intron_variant | MODIFIER | HG00639.hp2 HG00642.hp2 HG00738.hp2 others(87): Show |
a0001a0002a0003 | a0001c0001a0002c0002a0003c0003 | a0001c0001t0001a0001c0001t0005a0001c0001t0006others(36): Show | a0001c0001t0001g0208a0001c0001t0005g0009a0001c0001t0005g0029others(58): Show | 90 | 414 | 0.2174 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 6/6 | c.572+1606A>G | ||||||
|
chr13:113963360
|
C | CCT | intron_variant | MODIFIER | HG00639.hp2 HG00642.hp2 HG00738.hp2 others(81): Show |
a0001a0002a0003 | a0001c0001a0002c0002a0003c0003 | a0001c0001t0005a0001c0001t0006a0001c0001t0012others(33): Show | a0001c0001t0005g0009a0001c0001t0005g0029a0001c0001t0005g0080others(54): Show | 84 | 414 | 0.2029 | 2 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 6/6 | c.572+1566_572+1567insAG | ||||||
|
chr13:113963407
|
G | A | intron_variant | MODIFIER | HG00738.hp2 HG01070.hp2 HG01168.hp2 others(16): Show |
a0001 | a0001c0001 | a0001c0001t0006a0001c0001t0030a0001c0001t0031others(5): Show | a0001c0001t0006g0005a0001c0001t0006g0098a0001c0001t0006g0099others(9): Show | 19 | 414 | 0.0459 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 6/6 | c.572+1520C>T | ||||||
|
chr13:113965237
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(282): Show |
a0001a0002a0003others(1): Show | a0001c0001a0002c0002a0003c0003others(1): Show | a0001c0001t0002a0001c0001t0003a0001c0001t0005others(89): Show | a0001c0001t0002g0004a0001c0001t0002g0010a0001c0001t0002g0014others(171): Show | 285 | 414 | 0.6884 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 5/6 | c.505-243T>C | ||||||
|
chr13:113965746
|
G | GTGA | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(272): Show |
a0001a0002a0003others(1): Show | a0001c0001a0002c0002a0003c0003others(1): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(84): Show | a0001c0001t0001g0063a0001c0001t0002g0004a0001c0001t0002g0010others(162): Show | 275 | 414 | 0.6643 | 3 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 5/6 | c.505-755_505-753dupTCA | ||||||
|
chr13:113965758
|
A | ATGG | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(268): Show |
a0001a0002a0003others(1): Show | a0001c0001a0002c0002a0003c0003others(1): Show | a0001c0001t0002a0001c0001t0003a0001c0001t0005others(85): Show | a0001c0001t0002g0004a0001c0001t0002g0010a0001c0001t0002g0014others(160): Show | 271 | 414 | 0.6546 | 3 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 5/6 | c.505-767_505-765dupCCA | ||||||
|
chr13:113965796
|
G | C | intron_variant | MODIFIER | HG00738.hp2 HG01070.hp2 HG01168.hp2 others(16): Show |
a0001 | a0001c0001 | a0001c0001t0006a0001c0001t0030a0001c0001t0031others(5): Show | a0001c0001t0006g0005a0001c0001t0006g0098a0001c0001t0006g0099others(9): Show | 19 | 414 | 0.0459 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 5/6 | c.505-802C>G | ||||||
|
chr13:113965839
|
G | GTGA | intron_variant | MODIFIER | HG00099.hp2 HG00140.hp1 HG00140.hp2 others(237): Show |
a0001a0002a0003others(1): Show | a0001c0001a0002c0002a0003c0003others(1): Show | a0001c0001t0002a0001c0001t0003a0001c0001t0005others(74): Show | a0001c0001t0002g0004a0001c0001t0002g0014a0001c0001t0002g0018others(144): Show | 240 | 414 | 0.5797 | 3 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 5/6 | c.505-848_505-846dupTCA | ||||||
|
chr13:113965922
|
A | AATG | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(266): Show |
a0001a0003a0004 | a0001c0001a0003c0003a0004c0004 | a0001c0001t0002a0001c0001t0003a0001c0001t0005others(86): Show | a0001c0001t0002g0004a0001c0001t0002g0010a0001c0001t0002g0014others(161): Show | 269 | 414 | 0.6498 | 3 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 5/6 | c.505-931_505-929dupCAT | ||||||
|
chr13:113966184
|
T | TGGC | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(278): Show |
a0001a0002a0003others(1): Show | a0001c0001a0002c0002a0003c0003others(1): Show | a0001c0001t0002a0001c0001t0003a0001c0001t0005others(88): Show | a0001c0001t0002g0004a0001c0001t0002g0010a0001c0001t0002g0014others(168): Show | 281 | 414 | 0.6787 | 3 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 5/6 | c.504+1156_504+1157insGCC | ||||||
|
chr13:113966371
|
GTGA | G | intron_variant | MODIFIER | HG00738.hp2 HG01070.hp2 HG01168.hp2 others(16): Show |
a0001 | a0001c0001 | a0001c0001t0006a0001c0001t0030a0001c0001t0031others(5): Show | a0001c0001t0006g0005a0001c0001t0006g0098a0001c0001t0006g0099others(9): Show | 19 | 414 | 0.0459 | -3 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 5/6 | c.504+967_504+969delTCA | ||||||
|
chr13:113967217
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(282): Show |
a0001a0002a0003others(1): Show | a0001c0001a0002c0002a0003c0003others(1): Show | a0001c0001t0002a0001c0001t0003a0001c0001t0005others(89): Show | a0001c0001t0002g0004a0001c0001t0002g0010a0001c0001t0002g0014others(171): Show | 285 | 414 | 0.6884 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 5/6 | c.504+124A>G | ||||||
|
chr13:113967392
|
C | T | splice_region_variant others(1): Show |
LOW | HG00738.hp2 HG01070.hp2 HG01168.hp2 others(16): Show |
a0001 | a0001c0001 | a0001c0001t0006a0001c0001t0030a0001c0001t0031others(5): Show | a0001c0001t0006g0005a0001c0001t0006g0098a0001c0001t0006g0099others(9): Show | 19 | 414 | 0.0459 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 4/6 | c.457-4G>A | ||||||
|
chr13:113968015
|
G | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(282): Show |
a0001a0002a0003others(1): Show | a0001c0001a0002c0002a0003c0003others(1): Show | a0001c0001t0002a0001c0001t0003a0001c0001t0005others(89): Show | a0001c0001t0002g0004a0001c0001t0002g0010a0001c0001t0002g0014others(171): Show | 285 | 414 | 0.6884 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 4/6 | c.456+452C>G | ||||||
|
chr13:113968465
|
A | G | splice_donor_variant others(1): Show |
HIGH | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(403): Show |
a0001a0002a0003others(4): Show | a0001c0001a0001c0008a0002c0002others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(115): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(241): Show | 406 | 414 | 0.9807 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 4/6 | c.456+2T>C | ||||||
|
chr13:113968830
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(282): Show |
a0001a0002a0003others(1): Show | a0001c0001a0002c0002a0003c0003others(1): Show | a0001c0001t0002a0001c0001t0003a0001c0001t0005others(89): Show | a0001c0001t0002g0004a0001c0001t0002g0010a0001c0001t0002g0014others(171): Show | 285 | 414 | 0.6884 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 2/6 | c.243-70A>G | ||||||
|
chr13:113969452
|
C | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(282): Show |
a0001a0002a0003others(1): Show | a0001c0001a0002c0002a0003c0003others(1): Show | a0001c0001t0002a0001c0001t0003a0001c0001t0005others(89): Show | a0001c0001t0002g0004a0001c0001t0002g0010a0001c0001t0002g0014others(171): Show | 285 | 414 | 0.6884 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 2/6 | c.243-692G>C | ||||||
|
chr13:113972191
|
A | G | intron_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp1 others(212): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0008a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0005a0001c0001t0006others(59): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(128): Show | 215 | 414 | 0.5193 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 1/6 | c.190+1617T>C | ||||||
|
chr13:113972874
|
C | G | intron_variant | MODIFIER | HG00738.hp2 HG01070.hp2 HG01168.hp2 others(16): Show |
a0001 | a0001c0001 | a0001c0001t0006a0001c0001t0030a0001c0001t0031others(5): Show | a0001c0001t0006g0005a0001c0001t0006g0098a0001c0001t0006g0099others(9): Show | 19 | 414 | 0.0459 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 1/6 | c.190+934G>C |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
ahapid | alen | total | AFR | AMR | EAS | EUR | SAS | aseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| C13orf46 | 1/1 | a0001 | 212 | 390 | 88 | 82 | 159 | 16 | 43 | subcellular location copy fasta | chr13 | 113948705 | 113979076 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
chapid | clen | total | AFR | AMR | EAS | EUR | SAS | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| C13orf46 | 1/1 | c0001 | 639 | 389 | 88 | 82 | 158 | 16 | 43 | copy fasta | chr13 | 113948705 | 113979076 |
| genename | grch38/chm13v2 | thapid | tlen | total | AFR | AMR | EAS | EUR | SAS | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| C13orf46 | 0/0 | t0030 | 3088 | 2 | 0 | 1 | 0 | 0 | 1 | copy fasta | chr13 | 113948705 | 113979076 |
| genename | grch38/chm13v2 | ghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| C13orf46 | 0/0 | g0097 | 1 | 0 | 1 | 0 | 0 | 0 | chr13 | 113948705 | 113979076 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
achapid | total | AFR | AMR | EAS | EUR | SAS | clen | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| C13orf46 | 1/1 | a0001c0001 | 389 | 88 | 82 | 158 | 16 | 43 | 639 | copy fasta | chr13 | 113948705 | 113979076 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
acthapid | total | AFR | AMR | EAS | EUR | SAS | tlen | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| C13orf46 | 0/0 | a0001c0001t0030 | 2 | 0 | 1 | 0 | 0 | 1 | 3726 | copy fasta | chr13 | 113948705 | 113979076 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
actghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| C13orf46 | 0/0 | a0001c0001t0030g0097 | 1 | 0 | 1 | 0 | 0 | 0 | chr13 | 113948705 | 113979076 |
Click to load Haplotype QTL data...
| pos | S. Strand |
E# Exon Number |
max | median | min | diff | type | haplotypeid | max_hap_list | min_hap_list | symbol | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 113973808 | - | 1 | -0.0671 | -0.0671 | -0.0671 | 0.0000 | acceptor | a0001c0001t0030g0097 | HG01358.hp2 | HG01358.hp2 | C13orf46 | chr13 | 113948705 | 113979076 |
| 113970171 | - | 2 | -0.9886 | -0.9886 | -0.9886 | 0.0000 | acceptor | a0001c0001t0030g0097 | HG01358.hp2 | HG01358.hp2 | C13orf46 | chr13 | 113948705 | 113979076 |
| 113970222 | - | 2 | 0.9910 | 0.9910 | 0.9910 | 0.0000 | donor | a0001c0001t0030g0097 | HG01358.hp2 | HG01358.hp2 | C13orf46 | chr13 | 113948705 | 113979076 |
| 113968595 | - | 3 | -0.5307 | -0.5307 | -0.5307 | 0.0000 | acceptor | a0001c0001t0030g0097 | HG01358.hp2 | HG01358.hp2 | C13orf46 | chr13 | 113948705 | 113979076 |
| 113968760 | - | 3 | 0.6847 | 0.6847 | 0.6847 | 0.0000 | donor | a0001c0001t0030g0097 | HG01358.hp2 | HG01358.hp2 | C13orf46 | chr13 | 113948705 | 113979076 |
| 113968467 | - | 4 | -0.1785 | -0.1785 | -0.1785 | 0.0000 | acceptor | a0001c0001t0030g0097 | HG01358.hp2 | HG01358.hp2 | C13orf46 | chr13 | 113948705 | 113979076 |
| 113968514 | - | 4 | 0.5449 | 0.5449 | 0.5449 | 0.0000 | donor | a0001c0001t0030g0097 | HG01358.hp2 | HG01358.hp2 | C13orf46 | chr13 | 113948705 | 113979076 |
| 113967341 | - | 5 | -0.2695 | -0.2695 | -0.2695 | 0.0000 | acceptor | a0001c0001t0030g0097 | HG01358.hp2 | HG01358.hp2 | C13orf46 | chr13 | 113948705 | 113979076 |
| 113967388 | - | 5 | 0.3475 | 0.3475 | 0.3475 | 0.0000 | donor | a0001c0001t0030g0097 | HG01358.hp2 | HG01358.hp2 | C13orf46 | chr13 | 113948705 | 113979076 |
| 113964927 | - | 6 | -0.9966 | -0.9966 | -0.9966 | 0.0000 | acceptor | a0001c0001t0030g0097 | HG01358.hp2 | HG01358.hp2 | C13orf46 | chr13 | 113948705 | 113979076 |
| 113964994 | - | 6 | 0.9937 | 0.9937 | 0.9937 | 0.0000 | donor | a0001c0001t0030g0097 | HG01358.hp2 | HG01358.hp2 | C13orf46 | chr13 | 113948705 | 113979076 |
| 113956839 | - | 7 | 0.8583 | 0.8583 | 0.8583 | 0.0000 | donor | a0001c0001t0030g0097 | HG01358.hp2 | HG01358.hp2 | C13orf46 | chr13 | 113948705 | 113979076 |
| pos | annotationhgvs_chgvs_p | clinvarid | clnsig | geneinfo | mc | clndisdb | strand strand
|
ahapid ahapid_count
|
chapid chapid count
|
thapid thapid_count
|
ghapid ghapid_count
|
AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
impact | chr | ref | alt | external |
|---|
| CHR:POS | annotationhgvs_chgvs_p | disease trait-log10podds or beta | AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
study | initial sample size/replication sample size | report genes | mapped gene | strongest snp risk allele | strand strand
|
impact | chr | ref | alt |
|---|