| geneid | 100507747 |
|---|---|
| ensemblid | ENSG00000283199.3 |
| hgncid | 53786 |
| symbol | C13orf46 |
| name | chromosome 13 open reading frame 46 |
| refseq_nuc | NM_001365455.2 |
| refseq_prot | NP_001352384.1 |
| ensembl_nuc | ENST00000636427.3 |
| ensembl_prot | ENSP00000490032.2 |
| mane_status | MANE Select |
| chr | chr13 |
| start | 113953705 |
| end | 113974076 |
| strand | - |
| ver | v1.2 |
| region | chr13:113953705-113974076 |
| region5000 | chr13:113948705-113979076 |
| regionname0 | C13orf46_chr13_113953705_113974076 |
| regionname5000 | C13orf46_chr13_113948705_113979076 |
| chr:pos | ref | alt | af | annotation | impact | samples | AHAPIDS | ACHAPIDS | ACTHAPIDS | ACTGHAPIDS | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr13:113968621
|
C | T | 0.0314 | missense_variant | MODERATE | HG01993.hp1 HG02004.hp2 HG02040.hp2 others(10): Show |
a0002 | a0002c0002 | a0002c0002t0004a0002c0002t0043a0002c0002t0044 | a0002c0002t0004g0012a0002c0002t0004g0019a0002c0002t0004g0067others(5): Show | 13 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 3/7 | c.382G>A | p.Ala128Thr | 461/3786 | 382/639 | 128/212 |
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr13:113953878
|
G | A | 0.0314 | 3_prime_UTR_variant | MODIFIER | HG01993.hp1 HG02004.hp2 HG02273.hp1 others(10): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0053a0002c0002t0004a0002c0002t0044 | a0001c0001t0053g0229a0002c0002t0004g0012a0002c0002t0004g0019others(5): Show | 13 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*2895C>T | 2895 | |||||
|
chr13:113954020
|
G | T | 0.4855 | 3_prime_UTR_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp1 others(198): Show |
a0001a0002a0003others(4): Show | a0001c0001a0001c0008a0002c0002others(5): Show | a0001c0001t0001a0001c0001t0005a0001c0001t0006others(53): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(120): Show | 201 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*2753C>A | 2753 | |||||
|
chr13:113954158
|
A | G | 0.9565 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(393): Show |
a0001a0002a0003others(4): Show | a0001c0001a0001c0008a0002c0002others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(108): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(232): Show | 396 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*2615T>C | 2615 | |||||
|
chr13:113955140
|
C | T | 0.0314 | 3_prime_UTR_variant | MODIFIER | HG01993.hp1 HG02004.hp2 HG02040.hp2 others(10): Show |
a0002 | a0002c0002 | a0002c0002t0004a0002c0002t0043a0002c0002t0044 | a0002c0002t0004g0012a0002c0002t0004g0019a0002c0002t0004g0067others(5): Show | 13 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*1633G>A | 1633 | |||||
|
chr13:113955486
|
T | C | 0.0749 | 3_prime_UTR_variant | MODIFIER | HG00639.hp2 HG00642.hp2 HG00741.hp1 others(28): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0005a0001c0001t0019a0001c0001t0034others(6): Show | a0001c0001t0005g0009a0001c0001t0005g0029a0001c0001t0005g0080others(17): Show | 31 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*1287A>G | 1287 | |||||
|
chr13:113955574
|
A | C | 0.4638 | 3_prime_UTR_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp1 others(189): Show |
a0001a0002a0005others(2): Show | a0001c0001a0001c0008a0002c0002others(3): Show | a0001c0001t0001a0001c0001t0005a0001c0001t0006others(50): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(114): Show | 192 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*1199T>G | 1199 | |||||
|
chr13:113955583
|
ATCTCGTG others(36): Show |
A | 0.4638 | 3_prime_UTR_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp1 others(189): Show |
a0001a0002a0005others(2): Show | a0001c0001a0001c0008a0002c0002others(3): Show | a0001c0001t0001a0001c0001t0005a0001c0001t0006others(50): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(114): Show | 192 | 414 | -43 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*1147_*1189delCACTACTCCTCGTCTCTGCCAGATGCTCCTCCGCTCCACGAGA | 1147 | |||||
|
chr13:113955633
|
G | A | 0.4686 | 3_prime_UTR_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp1 others(191): Show |
a0001a0002a0005others(2): Show | a0001c0001a0001c0008a0002c0002others(3): Show | a0001c0001t0001a0001c0001t0005a0001c0001t0006others(51): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(115): Show | 194 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*1140C>T | 1140 | |||||
|
chr13:113955656
|
A | G | 0.4300 | 3_prime_UTR_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp1 others(175): Show |
a0001a0002a0005others(2): Show | a0001c0001a0001c0008a0002c0002others(3): Show | a0001c0001t0001a0001c0001t0006a0001c0001t0009others(47): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(105): Show | 178 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*1117T>C | 1117 | |||||
|
chr13:113955662
|
A | G | 0.8792 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(361): Show |
a0001a0002a0003others(4): Show | a0001c0001a0001c0008a0002c0002others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(95): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(212): Show | 364 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*1111T>C | 1111 | |||||
|
chr13:113955777
|
G | A | 0.3841 | 3_prime_UTR_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp1 others(156): Show |
a0001a0002a0005others(2): Show | a0001c0001a0001c0008a0002c0002others(3): Show | a0001c0001t0001a0001c0001t0005a0001c0001t0009others(32): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(90): Show | 159 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*996C>T | 996 | |||||
|
chr13:113955808
|
G | A | 0.3816 | 3_prime_UTR_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp1 others(155): Show |
a0001a0002a0005others(2): Show | a0001c0001a0001c0008a0002c0002others(3): Show | a0001c0001t0001a0001c0001t0005a0001c0001t0009others(31): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(89): Show | 158 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*965C>T | 965 | |||||
|
chr13:113955976
|
C | CGAGGAGT others(16): Show |
0.0314 | 3_prime_UTR_variant | MODIFIER | HG01993.hp1 HG02004.hp2 HG02040.hp2 others(10): Show |
a0002 | a0002c0002 | a0002c0002t0004a0002c0002t0043a0002c0002t0044 | a0002c0002t0004g0012a0002c0002t0004g0019a0002c0002t0004g0067others(5): Show | 13 | 414 | 23 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*796_*797insCTCTCCGCCAGATCCTACTCCTC | 796 | |||||
|
chr13:113955994
|
A | G | 0.6570 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(269): Show |
a0001a0002a0003others(1): Show | a0001c0001a0002c0002a0003c0003others(1): Show | a0001c0001t0002a0001c0001t0003a0001c0001t0005others(82): Show | a0001c0001t0002g0004a0001c0001t0002g0010a0001c0001t0002g0014others(161): Show | 272 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*779T>C | 779 | |||||
|
chr13:113956040
|
A | G | 0.5145 | 3_prime_UTR_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp1 others(210): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0008a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0005a0001c0001t0006others(57): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(126): Show | 213 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*733T>C | 733 | |||||
|
chr13:113956178
|
A | G | 0.5193 | 3_prime_UTR_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp1 others(212): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0008a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0005a0001c0001t0006others(59): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(128): Show | 215 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*595T>C | 595 | |||||
|
chr13:113956250
|
G | A | 0.0314 | 3_prime_UTR_variant | MODIFIER | HG01993.hp1 HG02004.hp2 HG02040.hp2 others(10): Show |
a0002 | a0002c0002 | a0002c0002t0004a0002c0002t0043a0002c0002t0044 | a0002c0002t0004g0012a0002c0002t0004g0019a0002c0002t0004g0067others(5): Show | 13 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*523C>T | 523 | |||||
|
chr13:113956263
|
A | G | 0.5193 | 3_prime_UTR_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp1 others(212): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0008a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0005a0001c0001t0006others(59): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(128): Show | 215 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*510T>C | 510 | |||||
|
chr13:113956337
|
A | AGAG | 0.1329 | 3_prime_UTR_variant | MODIFIER | HG00639.hp2 HG00642.hp2 HG00738.hp2 others(52): Show |
a0001a0002a0003 | a0001c0001a0002c0002a0003c0003 | a0001c0001t0005a0001c0001t0006a0001c0001t0019others(14): Show | a0001c0001t0005g0009a0001c0001t0005g0029a0001c0001t0005g0080others(31): Show | 55 | 414 | 3 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*433_*435dupCTC | 435 | |||||
|
chr13:113956547
|
A | G | 0.5169 | 3_prime_UTR_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp1 others(211): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0008a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0005a0001c0001t0006others(58): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(127): Show | 214 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 7/7 | c.*226T>C | 226 | |||||
|
chr13:113974045
|
C | T | 0.0338 | 5_prime_UTR_variant | MODIFIER | HG01993.hp1 HG02004.hp2 HG02040.hp2 others(11): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0042a0002c0002t0004a0002c0002t0043others(1): Show | a0001c0001t0042g0065a0002c0002t0004g0012a0002c0002t0004g0019others(6): Show | 14 | 414 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 1/7 | c.-48G>A | 48 |
| chr:pos | ref | alt | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | af | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr13:113957393
|
C | T | intron_variant | MODIFIER | HG01993.hp1 HG02004.hp2 HG02040.hp2 others(10): Show |
a0002 | a0002c0002 | a0002c0002t0004a0002c0002t0043a0002c0002t0044 | a0002c0002t0004g0012a0002c0002t0004g0019a0002c0002t0004g0067others(5): Show | 13 | 414 | 0.0314 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 6/6 | c.573-554G>A | ||||||
|
chr13:113957656
|
T | C | intron_variant | MODIFIER | HG01993.hp1 HG02004.hp2 HG02040.hp2 others(10): Show |
a0002 | a0002c0002 | a0002c0002t0004a0002c0002t0043a0002c0002t0044 | a0002c0002t0004g0012a0002c0002t0004g0019a0002c0002t0004g0067others(5): Show | 13 | 414 | 0.0314 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 6/6 | c.573-817A>G | ||||||
|
chr13:113960024
|
A | G | intron_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp1 others(212): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0008a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0005a0001c0001t0006others(59): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(128): Show | 215 | 414 | 0.5193 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 6/6 | c.573-3185T>C | ||||||
|
chr13:113960255
|
C | CA | intron_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp1 others(212): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0008a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0005a0001c0001t0006others(59): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(128): Show | 215 | 414 | 0.5193 | 1 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 6/6 | c.573-3417dupT | ||||||
|
chr13:113960796
|
C | T | intron_variant | MODIFIER | HG03834.hp1 NA18947.hp1 NA18954.hp1 others(6): Show |
a0002 | a0002c0002 | a0002c0002t0004a0002c0002t0044 | a0002c0002t0004g0012a0002c0002t0004g0019a0002c0002t0004g0071others(1): Show | 9 | 414 | 0.0217 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 6/6 | c.573-3957G>A | ||||||
|
chr13:113961341
|
C | T | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(406): Show |
a0001a0002a0003others(4): Show | a0001c0001a0001c0008a0002c0002others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(113): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(241): Show | 409 | 414 | 0.9879 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 6/6 | c.572+3586G>A | ||||||
|
chr13:113961853
|
A | G | intron_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp1 others(157): Show |
a0001a0002a0005others(2): Show | a0001c0001a0001c0008a0002c0002others(3): Show | a0001c0001t0001a0001c0001t0005a0001c0001t0009others(33): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(91): Show | 160 | 414 | 0.3865 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 6/6 | c.572+3074T>C | ||||||
|
chr13:113963177
|
G | C | intron_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp1 others(212): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0008a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0005a0001c0001t0006others(59): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(128): Show | 215 | 414 | 0.5193 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 6/6 | c.572+1750C>G | ||||||
|
chr13:113963321
|
T | C | intron_variant | MODIFIER | HG00639.hp2 HG00642.hp2 HG00738.hp2 others(87): Show |
a0001a0002a0003 | a0001c0001a0002c0002a0003c0003 | a0001c0001t0001a0001c0001t0005a0001c0001t0006others(36): Show | a0001c0001t0001g0208a0001c0001t0005g0009a0001c0001t0005g0029others(58): Show | 90 | 414 | 0.2174 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 6/6 | c.572+1606A>G | ||||||
|
chr13:113963360
|
C | CCT | intron_variant | MODIFIER | HG00639.hp2 HG00642.hp2 HG00738.hp2 others(81): Show |
a0001a0002a0003 | a0001c0001a0002c0002a0003c0003 | a0001c0001t0005a0001c0001t0006a0001c0001t0012others(33): Show | a0001c0001t0005g0009a0001c0001t0005g0029a0001c0001t0005g0080others(54): Show | 84 | 414 | 0.2029 | 2 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 6/6 | c.572+1566_572+1567insAG | ||||||
|
chr13:113963454
|
T | TC | intron_variant | MODIFIER | HG00639.hp2 HG00642.hp2 HG00741.hp1 others(29): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0005a0001c0001t0019a0001c0001t0034others(7): Show | a0001c0001t0005g0009a0001c0001t0005g0029a0001c0001t0005g0080others(18): Show | 32 | 414 | 0.0773 | 1 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 6/6 | c.572+1472dupG | ||||||
|
chr13:113963881
|
G | A | intron_variant | MODIFIER | HG01993.hp1 HG02004.hp2 HG02040.hp2 others(10): Show |
a0002 | a0002c0002 | a0002c0002t0004a0002c0002t0043a0002c0002t0044 | a0002c0002t0004g0012a0002c0002t0004g0019a0002c0002t0004g0067others(5): Show | 13 | 414 | 0.0314 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 6/6 | c.572+1046C>T | ||||||
|
chr13:113963919
|
C | T | intron_variant | MODIFIER | HG01993.hp1 HG02004.hp2 HG02040.hp2 others(12): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0022a0002c0002t0004a0002c0002t0043others(1): Show | a0001c0001t0022g0053a0002c0002t0004g0012a0002c0002t0004g0019others(6): Show | 15 | 414 | 0.0362 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 6/6 | c.572+1008G>A | ||||||
|
chr13:113964318
|
A | G | intron_variant | MODIFIER | HG01993.hp1 HG02004.hp2 HG02040.hp2 others(10): Show |
a0002 | a0002c0002 | a0002c0002t0004a0002c0002t0043a0002c0002t0044 | a0002c0002t0004g0012a0002c0002t0004g0019a0002c0002t0004g0067others(5): Show | 13 | 414 | 0.0314 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 6/6 | c.572+609T>C | ||||||
|
chr13:113965237
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(282): Show |
a0001a0002a0003others(1): Show | a0001c0001a0002c0002a0003c0003others(1): Show | a0001c0001t0002a0001c0001t0003a0001c0001t0005others(89): Show | a0001c0001t0002g0004a0001c0001t0002g0010a0001c0001t0002g0014others(171): Show | 285 | 414 | 0.6884 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 5/6 | c.505-243T>C | ||||||
|
chr13:113965563
|
ATGGTGAT others(17): Show |
A | intron_variant | MODIFIER | HG01993.hp1 HG02004.hp2 HG02040.hp2 others(10): Show |
a0002 | a0002c0002 | a0002c0002t0004a0002c0002t0043a0002c0002t0044 | a0002c0002t0004g0012a0002c0002t0004g0019a0002c0002t0004g0067others(5): Show | 13 | 414 | 0.0314 | -24 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 5/6 | c.505-593_505-570delCCATTATAATCATCATCATCACCA | ||||||
|
chr13:113965626
|
A | G | intron_variant | MODIFIER | HG00639.hp2 HG00642.hp2 HG00741.hp1 others(29): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0005a0001c0001t0019a0001c0001t0034others(7): Show | a0001c0001t0005g0009a0001c0001t0005g0029a0001c0001t0005g0080others(18): Show | 32 | 414 | 0.0773 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 5/6 | c.505-632T>C | ||||||
|
chr13:113965746
|
G | GTGA | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(272): Show |
a0001a0002a0003others(1): Show | a0001c0001a0002c0002a0003c0003others(1): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(84): Show | a0001c0001t0001g0063a0001c0001t0002g0004a0001c0001t0002g0010others(162): Show | 275 | 414 | 0.6643 | 3 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 5/6 | c.505-755_505-753dupTCA | ||||||
|
chr13:113965758
|
A | ATGG | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(268): Show |
a0001a0002a0003others(1): Show | a0001c0001a0002c0002a0003c0003others(1): Show | a0001c0001t0002a0001c0001t0003a0001c0001t0005others(85): Show | a0001c0001t0002g0004a0001c0001t0002g0010a0001c0001t0002g0014others(160): Show | 271 | 414 | 0.6546 | 3 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 5/6 | c.505-767_505-765dupCCA | ||||||
|
chr13:113965839
|
G | GTGA | intron_variant | MODIFIER | HG00099.hp2 HG00140.hp1 HG00140.hp2 others(237): Show |
a0001a0002a0003others(1): Show | a0001c0001a0002c0002a0003c0003others(1): Show | a0001c0001t0002a0001c0001t0003a0001c0001t0005others(74): Show | a0001c0001t0002g0004a0001c0001t0002g0014a0001c0001t0002g0018others(144): Show | 240 | 414 | 0.5797 | 3 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 5/6 | c.505-848_505-846dupTCA | ||||||
|
chr13:113965931
|
GATT | G | intron_variant | MODIFIER | HG01993.hp1 HG02004.hp2 HG02040.hp2 others(10): Show |
a0002 | a0002c0002 | a0002c0002t0004a0002c0002t0043a0002c0002t0044 | a0002c0002t0004g0012a0002c0002t0004g0019a0002c0002t0004g0067others(5): Show | 13 | 414 | 0.0314 | -3 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 5/6 | c.505-940_505-938delAAT | ||||||
|
chr13:113965940
|
G | T | intron_variant | MODIFIER | HG01993.hp1 HG02004.hp2 HG02040.hp2 others(10): Show |
a0002 | a0002c0002 | a0002c0002t0004a0002c0002t0043a0002c0002t0044 | a0002c0002t0004g0012a0002c0002t0004g0019a0002c0002t0004g0067others(5): Show | 13 | 414 | 0.0314 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 5/6 | c.505-946C>A | ||||||
|
chr13:113965941
|
G | A | intron_variant | MODIFIER | HG01993.hp1 HG02004.hp2 HG02040.hp2 others(10): Show |
a0002 | a0002c0002 | a0002c0002t0004a0002c0002t0043a0002c0002t0044 | a0002c0002t0004g0012a0002c0002t0004g0019a0002c0002t0004g0067others(5): Show | 13 | 414 | 0.0314 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 5/6 | c.505-947C>T | ||||||
|
chr13:113965947
|
A | G | intron_variant | MODIFIER | HG01993.hp1 HG02004.hp2 HG02040.hp2 others(10): Show |
a0002 | a0002c0002 | a0002c0002t0004a0002c0002t0043a0002c0002t0044 | a0002c0002t0004g0012a0002c0002t0004g0019a0002c0002t0004g0067others(5): Show | 13 | 414 | 0.0314 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 5/6 | c.505-953T>C | ||||||
|
chr13:113965953
|
G | A | intron_variant | MODIFIER | HG01993.hp1 HG02004.hp2 HG02040.hp2 others(10): Show |
a0002 | a0002c0002 | a0002c0002t0004a0002c0002t0043a0002c0002t0044 | a0002c0002t0004g0012a0002c0002t0004g0019a0002c0002t0004g0067others(5): Show | 13 | 414 | 0.0314 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 5/6 | c.505-959C>T | ||||||
|
chr13:113966099
|
GTGA | G | intron_variant | MODIFIER | HG01993.hp1 HG02004.hp2 HG02040.hp2 others(10): Show |
a0002 | a0002c0002 | a0002c0002t0004a0002c0002t0043a0002c0002t0044 | a0002c0002t0004g0012a0002c0002t0004g0019a0002c0002t0004g0067others(5): Show | 13 | 414 | 0.0314 | -3 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 5/6 | c.505-1108_505-1106delTCA | ||||||
|
chr13:113966184
|
T | TGGC | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(278): Show |
a0001a0002a0003others(1): Show | a0001c0001a0002c0002a0003c0003others(1): Show | a0001c0001t0002a0001c0001t0003a0001c0001t0005others(88): Show | a0001c0001t0002g0004a0001c0001t0002g0010a0001c0001t0002g0014others(168): Show | 281 | 414 | 0.6787 | 3 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 5/6 | c.504+1156_504+1157insGCC | ||||||
|
chr13:113966927
|
G | T | intron_variant | MODIFIER | HG03834.hp1 NA18947.hp1 NA18954.hp1 others(6): Show |
a0002 | a0002c0002 | a0002c0002t0004a0002c0002t0044 | a0002c0002t0004g0012a0002c0002t0004g0019a0002c0002t0004g0071others(1): Show | 9 | 414 | 0.0217 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 5/6 | c.504+414C>A | ||||||
|
chr13:113967217
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(282): Show |
a0001a0002a0003others(1): Show | a0001c0001a0002c0002a0003c0003others(1): Show | a0001c0001t0002a0001c0001t0003a0001c0001t0005others(89): Show | a0001c0001t0002g0004a0001c0001t0002g0010a0001c0001t0002g0014others(171): Show | 285 | 414 | 0.6884 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 5/6 | c.504+124A>G | ||||||
|
chr13:113967601
|
T | C | intron_variant | MODIFIER | HG01993.hp1 HG02004.hp2 HG02040.hp2 others(10): Show |
a0002 | a0002c0002 | a0002c0002t0004a0002c0002t0043a0002c0002t0044 | a0002c0002t0004g0012a0002c0002t0004g0019a0002c0002t0004g0067others(5): Show | 13 | 414 | 0.0314 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 4/6 | c.457-213A>G | ||||||
|
chr13:113968015
|
G | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(282): Show |
a0001a0002a0003others(1): Show | a0001c0001a0002c0002a0003c0003others(1): Show | a0001c0001t0002a0001c0001t0003a0001c0001t0005others(89): Show | a0001c0001t0002g0004a0001c0001t0002g0010a0001c0001t0002g0014others(171): Show | 285 | 414 | 0.6884 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 4/6 | c.456+452C>G | ||||||
|
chr13:113968037
|
C | T | intron_variant | MODIFIER | HG01993.hp1 HG02004.hp2 HG02040.hp2 others(10): Show |
a0002 | a0002c0002 | a0002c0002t0004a0002c0002t0043a0002c0002t0044 | a0002c0002t0004g0012a0002c0002t0004g0019a0002c0002t0004g0067others(5): Show | 13 | 414 | 0.0314 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 4/6 | c.456+430G>A | ||||||
|
chr13:113968348
|
C | T | intron_variant | MODIFIER | HG01993.hp1 HG02004.hp2 HG02040.hp2 others(10): Show |
a0002 | a0002c0002 | a0002c0002t0004a0002c0002t0043a0002c0002t0044 | a0002c0002t0004g0012a0002c0002t0004g0019a0002c0002t0004g0067others(5): Show | 13 | 414 | 0.0314 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 4/6 | c.456+119G>A | ||||||
|
chr13:113968465
|
A | G | splice_donor_variant others(1): Show |
HIGH | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(403): Show |
a0001a0002a0003others(4): Show | a0001c0001a0001c0008a0002c0002others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(115): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(241): Show | 406 | 414 | 0.9807 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 4/6 | c.456+2T>C | ||||||
|
chr13:113968830
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(282): Show |
a0001a0002a0003others(1): Show | a0001c0001a0002c0002a0003c0003others(1): Show | a0001c0001t0002a0001c0001t0003a0001c0001t0005others(89): Show | a0001c0001t0002g0004a0001c0001t0002g0010a0001c0001t0002g0014others(171): Show | 285 | 414 | 0.6884 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 2/6 | c.243-70A>G | ||||||
|
chr13:113969154
|
G | A | intron_variant | MODIFIER | HG00639.hp2 HG00642.hp2 HG00741.hp1 others(28): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0005a0001c0001t0019a0001c0001t0034others(6): Show | a0001c0001t0005g0009a0001c0001t0005g0029a0001c0001t0005g0080others(17): Show | 31 | 414 | 0.0749 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 2/6 | c.243-394C>T | ||||||
|
chr13:113969452
|
C | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(282): Show |
a0001a0002a0003others(1): Show | a0001c0001a0002c0002a0003c0003others(1): Show | a0001c0001t0002a0001c0001t0003a0001c0001t0005others(89): Show | a0001c0001t0002g0004a0001c0001t0002g0010a0001c0001t0002g0014others(171): Show | 285 | 414 | 0.6884 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 2/6 | c.243-692G>C | ||||||
|
chr13:113969712
|
C | T | intron_variant | MODIFIER | NA18954.hp1 | a0002 | a0002c0002 | a0002c0002t0004 | a0002c0002t0004g0071 | 1 | 414 | 0.0024 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 2/6 | c.242+459G>A | ||||||
|
chr13:113970641
|
C | G | intron_variant | MODIFIER | HG01993.hp1 HG02004.hp2 HG02040.hp2 others(10): Show |
a0002 | a0002c0002 | a0002c0002t0004a0002c0002t0043a0002c0002t0044 | a0002c0002t0004g0012a0002c0002t0004g0019a0002c0002t0004g0067others(5): Show | 13 | 414 | 0.0314 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 1/6 | c.191-419G>C | ||||||
|
chr13:113972191
|
A | G | intron_variant | MODIFIER | HG00280.hp1 HG00280.hp2 HG00323.hp1 others(212): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0008a0002c0002others(4): Show | a0001c0001t0001a0001c0001t0005a0001c0001t0006others(59): Show | a0001c0001t0001g0001a0001c0001t0001g0002a0001c0001t0001g0008others(128): Show | 215 | 414 | 0.5193 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 1/6 | c.190+1617T>C | ||||||
|
chr13:113972664
|
CA | C | intron_variant | MODIFIER | HG01993.hp1 HG02004.hp2 HG02040.hp2 others(11): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0042a0002c0002t0004a0002c0002t0043others(1): Show | a0001c0001t0042g0065a0002c0002t0004g0012a0002c0002t0004g0019others(6): Show | 14 | 414 | 0.0338 | -1 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 1/6 | c.190+1143delT | ||||||
|
chr13:113973224
|
T | C | intron_variant | MODIFIER | NA18954.hp1 | a0002 | a0002c0002 | a0002c0002t0004 | a0002c0002t0004g0071 | 1 | 414 | 0.0024 | 0 | C13orf46 | ENSG00000283199.3 | transcript | ENST00000636427.3 | protein_coding | 1/6 | c.190+584A>G |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
ahapid | alen | total | AFR | AMR | EAS | EUR | SAS | aseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| C13orf46 | 0/0 | a0002 | 212 | 13 | 0 | 3 | 9 | 0 | 1 | subcellular location copy fasta | chr13 | 113948705 | 113979076 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
chapid | clen | total | AFR | AMR | EAS | EUR | SAS | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| C13orf46 | 0/0 | c0002 | 639 | 13 | 0 | 3 | 9 | 0 | 1 | copy fasta | chr13 | 113948705 | 113979076 |
| genename | grch38/chm13v2 | thapid | tlen | total | AFR | AMR | EAS | EUR | SAS | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| C13orf46 | 0/0 | t0004 | 3131 | 11 | 0 | 3 | 7 | 0 | 1 | copy fasta | chr13 | 113948705 | 113979076 |
| genename | grch38/chm13v2 | ghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| C13orf46 | 0/0 | g0071 | 1 | 0 | 0 | 1 | 0 | 0 | chr13 | 113948705 | 113979076 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
achapid | total | AFR | AMR | EAS | EUR | SAS | clen | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| C13orf46 | 0/0 | a0002c0002 | 13 | 0 | 3 | 9 | 0 | 1 | 639 | copy fasta | chr13 | 113948705 | 113979076 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
acthapid | total | AFR | AMR | EAS | EUR | SAS | tlen | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| C13orf46 | 0/0 | a0002c0002t0004 | 11 | 0 | 3 | 7 | 0 | 1 | 3769 | copy fasta | chr13 | 113948705 | 113979076 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
actghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| C13orf46 | 0/0 | a0002c0002t0004g0071 | 1 | 0 | 0 | 1 | 0 | 0 | chr13 | 113948705 | 113979076 |
Click to load Haplotype QTL data...
| pos | S. Strand |
E# Exon Number |
max | median | min | diff | type | haplotypeid | max_hap_list | min_hap_list | symbol | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 113973808 | - | 1 | -0.0449 | -0.0449 | -0.0449 | 0.0000 | acceptor | a0002c0002t0004g0071 | NA18954.hp1 | NA18954.hp1 | C13orf46 | chr13 | 113948705 | 113979076 |
| 113970171 | - | 2 | -0.9890 | -0.9890 | -0.9890 | 0.0000 | acceptor | a0002c0002t0004g0071 | NA18954.hp1 | NA18954.hp1 | C13orf46 | chr13 | 113948705 | 113979076 |
| 113970222 | - | 2 | 0.9898 | 0.9898 | 0.9898 | 0.0000 | donor | a0002c0002t0004g0071 | NA18954.hp1 | NA18954.hp1 | C13orf46 | chr13 | 113948705 | 113979076 |
| 113968595 | - | 3 | -0.5197 | -0.5197 | -0.5197 | 0.0000 | acceptor | a0002c0002t0004g0071 | NA18954.hp1 | NA18954.hp1 | C13orf46 | chr13 | 113948705 | 113979076 |
| 113968760 | - | 3 | 0.6653 | 0.6653 | 0.6653 | 0.0000 | donor | a0002c0002t0004g0071 | NA18954.hp1 | NA18954.hp1 | C13orf46 | chr13 | 113948705 | 113979076 |
| 113968467 | - | 4 | -0.1557 | -0.1557 | -0.1557 | 0.0000 | acceptor | a0002c0002t0004g0071 | NA18954.hp1 | NA18954.hp1 | C13orf46 | chr13 | 113948705 | 113979076 |
| 113968514 | - | 4 | 0.5647 | 0.5647 | 0.5647 | 0.0000 | donor | a0002c0002t0004g0071 | NA18954.hp1 | NA18954.hp1 | C13orf46 | chr13 | 113948705 | 113979076 |
| 113967341 | - | 5 | -0.3279 | -0.3279 | -0.3279 | 0.0000 | acceptor | a0002c0002t0004g0071 | NA18954.hp1 | NA18954.hp1 | C13orf46 | chr13 | 113948705 | 113979076 |
| 113967388 | - | 5 | 0.2760 | 0.2760 | 0.2760 | 0.0000 | donor | a0002c0002t0004g0071 | NA18954.hp1 | NA18954.hp1 | C13orf46 | chr13 | 113948705 | 113979076 |
| 113964927 | - | 6 | -0.9969 | -0.9969 | -0.9969 | 0.0000 | acceptor | a0002c0002t0004g0071 | NA18954.hp1 | NA18954.hp1 | C13orf46 | chr13 | 113948705 | 113979076 |
| 113964994 | - | 6 | 0.9945 | 0.9945 | 0.9945 | 0.0000 | donor | a0002c0002t0004g0071 | NA18954.hp1 | NA18954.hp1 | C13orf46 | chr13 | 113948705 | 113979076 |
| 113956839 | - | 7 | 0.8439 | 0.8439 | 0.8439 | 0.0000 | donor | a0002c0002t0004g0071 | NA18954.hp1 | NA18954.hp1 | C13orf46 | chr13 | 113948705 | 113979076 |
| pos | annotationhgvs_chgvs_p | clinvarid | clnsig | geneinfo | mc | clndisdb | strand strand
|
ahapid ahapid_count
|
chapid chapid count
|
thapid thapid_count
|
ghapid ghapid_count
|
AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
impact | chr | ref | alt | external |
|---|
| CHR:POS | annotationhgvs_chgvs_p | disease trait-log10podds or beta | AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
study | initial sample size/replication sample size | report genes | mapped gene | strongest snp risk allele | strand strand
|
impact | chr | ref | alt |
|---|