| geneid | 79669 |
|---|---|
| ensemblid | ENSG00000114529.13 |
| hgncid | 26255 |
| symbol | C3orf52 |
| name | chromosome 3 open reading frame 52 |
| refseq_nuc | NM_024616.3 |
| refseq_prot | NP_078892.3 |
| ensembl_nuc | ENST00000264848.10 |
| ensembl_prot | ENSP00000264848.5 |
| mane_status | MANE Select |
| chr | chr3 |
| start | 112086389 |
| end | 112118210 |
| strand | + |
| ver | v1.2 |
| region | chr3:112086389-112118210 |
| region5000 | chr3:112081389-112123210 |
| regionname0 | C3orf52_chr3_112086389_112118210 |
| regionname5000 | C3orf52_chr3_112081389_112123210 |
| chr:pos | ref | alt | af | annotation | impact | samples | AHAPIDS | ACHAPIDS | ACTHAPIDS | ACTGHAPIDS | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr3:112102900
|
A | G | 0.0995 | missense_variant | MODERATE | HG00140.hp2 HG01243.hp2 HG02015.hp1 others(34): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0002c0002t0004others(2): Show | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0025others(24): Show | 37 | 372 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/6 | c.331A>G | p.Ile111Val | 350/2237 | 331/654 | 111/217 | ||
|
chr3:112109576
|
G | A | 0.9731 | missense_variant | MODERATE | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(359): Show |
a0001a0002a0004others(5): Show | a0001c0001a0001c0004a0001c0011others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004others(28): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0005others(214): Show | 362 | 372 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 4/6 | c.430G>A | p.Gly144Ser | 449/2237 | 430/654 | 144/217 |
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr3:112118102
|
C | T | 0.9839 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(363): Show |
a0001a0002a0003others(6): Show | a0001c0001a0001c0004a0001c0011others(10): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0005others(27): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0005others(215): Show | 366 | 372 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 6/6 | c.*1456C>T | 1456 |
| chr:pos | ref | alt | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | af | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr3:112087765
|
C | G | intron_variant | MODIFIER | HG03453.hp1 NA18906.hp1 NA19030.hp1 others(2): Show |
a0002 | a0002c0002 | a0002c0002t0002 | a0002c0002t0002g0024a0002c0002t0002g0091a0002c0002t0002g0092others(1): Show | 5 | 372 | 0.0134 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 1/5 | c.138+1220C>G | ||||||
|
chr3:112087774
|
TG | T | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02109.hp1 others(25): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(17): Show | 28 | 372 | 0.0753 | -1 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 1/5 | c.138+1230delG | ||||||
|
chr3:112087776
|
T | A | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02109.hp1 others(25): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(17): Show | 28 | 372 | 0.0753 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 1/5 | c.138+1231T>A | ||||||
|
chr3:112088542
|
T | TGAAGAAA others(14): Show |
intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02109.hp1 others(25): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(17): Show | 28 | 372 | 0.0753 | 21 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 1/5 | c.138+2000_138+2020dupAGAAATTGAGGGAGGCTCAGA | INFO_REALIGN_3_PRIME | |||||
|
chr3:112088661
|
TTCTATCT others(1): Show |
T | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02109.hp1 others(25): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(17): Show | 28 | 372 | 0.0753 | -8 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 1/5 | c.138+2134_138+2141delCTATCTAT | INFO_REALIGN_3_PRIME | |||||
|
chr3:112088715
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(346): Show |
a0001a0002a0004others(5): Show | a0001c0001a0001c0004a0001c0011others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004others(28): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0005others(204): Show | 349 | 372 | 0.9382 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 1/5 | c.138+2170T>C | ||||||
|
chr3:112088959
|
G | A | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02109.hp1 others(25): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(17): Show | 28 | 372 | 0.0753 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 1/5 | c.138+2414G>A | ||||||
|
chr3:112089363
|
TA | T | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02109.hp1 others(25): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(17): Show | 28 | 372 | 0.0753 | -1 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 1/5 | c.138+2826delA | INFO_REALIGN_3_PRIME | |||||
|
chr3:112089529
|
CAAA | C | intron_variant | MODIFIER | HG00140.hp2 HG01168.hp2 HG02109.hp1 others(14): Show |
a0001a0002a0006 | a0001c0001a0002c0002a0006c0007 | a0001c0001t0001a0001c0001t0016a0002c0002t0002others(1): Show | a0001c0001t0001g0175a0001c0001t0001g0176a0001c0001t0016g0174others(12): Show | 17 | 372 | 0.0457 | -3 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 1/5 | c.138+3003_138+3005delAAA | INFO_REALIGN_3_PRIME | |||||
|
chr3:112090287
|
C | CT | intron_variant | MODIFIER | HG00140.hp2 HG00621.hp2 HG01243.hp2 others(41): Show |
a0001a0002a0005others(1): Show | a0001c0001a0002c0002a0005c0006others(1): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0013others(6): Show | a0001c0001t0001g0009a0001c0001t0001g0143a0001c0001t0001g0154others(34): Show | 44 | 372 | 0.1183 | 1 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 1/5 | c.139-3052dupT | INFO_REALIGN_3_PRIME | |||||
|
chr3:112090474
|
AT | A | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02109.hp1 others(25): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(17): Show | 28 | 372 | 0.0753 | -1 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 1/5 | c.139-2880delT | INFO_REALIGN_3_PRIME | |||||
|
chr3:112090688
|
A | C | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02109.hp1 others(25): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(17): Show | 28 | 372 | 0.0753 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 1/5 | c.139-2672A>C | ||||||
|
chr3:112090926
|
T | C | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02109.hp1 others(25): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(17): Show | 28 | 372 | 0.0753 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 1/5 | c.139-2434T>C | ||||||
|
chr3:112091707
|
TAAG | T | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02109.hp1 others(25): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(17): Show | 28 | 372 | 0.0753 | -3 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 1/5 | c.139-1650_139-1648delGAA | INFO_REALIGN_3_PRIME | |||||
|
chr3:112091821
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(346): Show |
a0001a0002a0004others(5): Show | a0001c0001a0001c0004a0001c0011others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004others(28): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0005others(204): Show | 349 | 372 | 0.9382 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 1/5 | c.139-1539A>G | ||||||
|
chr3:112091935
|
C | T | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02109.hp1 others(25): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(17): Show | 28 | 372 | 0.0753 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 1/5 | c.139-1425C>T | ||||||
|
chr3:112091963
|
T | C | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02109.hp1 others(25): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(17): Show | 28 | 372 | 0.0753 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 1/5 | c.139-1397T>C | ||||||
|
chr3:112092014
|
GAA | G | intron_variant | MODIFIER | HG00140.hp2 HG00621.hp2 HG01975.hp2 others(32): Show |
a0001a0002a0006 | a0001c0001a0002c0002a0006c0007 | a0001c0001t0001a0002c0002t0002a0002c0002t0003others(1): Show | a0001c0001t0001g0009a0001c0001t0001g0155a0001c0001t0001g0156others(21): Show | 35 | 372 | 0.0941 | -2 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 1/5 | c.139-1333_139-1332delAA | INFO_REALIGN_3_PRIME | |||||
|
chr3:112095087
|
A | C | intron_variant | MODIFIER | HG00140.hp2 HG02109.hp1 HG02148.hp2 others(11): Show |
a0002 | a0002c0002 | a0002c0002t0002 | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(9): Show | 14 | 372 | 0.0376 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 2/5 | c.268+1598A>C | ||||||
|
chr3:112095744
|
C | T | intron_variant | MODIFIER | HG00140.hp2 HG01243.hp2 HG02015.hp1 others(34): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0002c0002t0004others(2): Show | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0025others(24): Show | 37 | 372 | 0.0995 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 2/5 | c.268+2255C>T | ||||||
|
chr3:112095789
|
TG | T | intron_variant | MODIFIER | HG00140.hp2 HG01243.hp2 HG02015.hp1 others(34): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0002c0002t0004others(2): Show | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0025others(24): Show | 37 | 372 | 0.0995 | -1 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 2/5 | c.268+2306delG | INFO_REALIGN_3_PRIME | |||||
|
chr3:112096329
|
G | A | intron_variant | MODIFIER | HG00140.hp2 HG02148.hp2 HG03453.hp1 others(4): Show |
a0002 | a0002c0002 | a0002c0002t0002 | a0002c0002t0002g0024a0002c0002t0002g0054a0002c0002t0002g0055others(3): Show | 7 | 372 | 0.0188 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 2/5 | c.268+2840G>A | ||||||
|
chr3:112096431
|
A | G | intron_variant | MODIFIER | HG00140.hp2 HG01243.hp2 HG02015.hp1 others(34): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0002c0002t0004others(2): Show | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0025others(24): Show | 37 | 372 | 0.0995 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 2/5 | c.268+2942A>G | ||||||
|
chr3:112098491
|
T | A | intron_variant | MODIFIER | HG00140.hp2 HG01243.hp2 HG02015.hp1 others(34): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0002c0002t0004others(2): Show | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0025others(24): Show | 37 | 372 | 0.0995 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 2/5 | c.269-4347T>A | ||||||
|
chr3:112098762
|
A | G | intron_variant | MODIFIER | NA20129.hp2 | a0002 | a0002c0002 | a0002c0002t0002 | a0002c0002t0002g0093 | 1 | 372 | 0.0027 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 2/5 | c.269-4076A>G | ||||||
|
chr3:112098952
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(344): Show |
a0001a0002a0004others(5): Show | a0001c0001a0001c0004a0001c0011others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004others(28): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0005others(202): Show | 347 | 372 | 0.9328 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 2/5 | c.269-3886A>G | ||||||
|
chr3:112099231
|
G | A | intron_variant | MODIFIER | HG00140.hp2 HG01243.hp2 HG02015.hp1 others(34): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0002c0002t0004others(2): Show | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0025others(24): Show | 37 | 372 | 0.0995 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 2/5 | c.269-3607G>A | ||||||
|
chr3:112101103
|
T | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(341): Show |
a0001a0002a0005others(4): Show | a0001c0001a0001c0004a0001c0011others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004others(27): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0005others(201): Show | 344 | 372 | 0.9247 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 2/5 | c.269-1735T>G | ||||||
|
chr3:112101513
|
A | G | intron_variant | MODIFIER | HG00140.hp2 HG01243.hp2 HG02015.hp1 others(34): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0002c0002t0004others(2): Show | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0025others(24): Show | 37 | 372 | 0.0995 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 2/5 | c.269-1325A>G | ||||||
|
chr3:112101583
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(344): Show |
a0001a0002a0004others(5): Show | a0001c0001a0001c0004a0001c0011others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004others(28): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0005others(202): Show | 347 | 372 | 0.9328 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 2/5 | c.269-1255T>C | ||||||
|
chr3:112101678
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(367): Show |
a0001a0002a0003others(6): Show | a0001c0001a0001c0004a0001c0011others(10): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004others(29): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0005others(218): Show | 370 | 372 | 0.9946 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 2/5 | c.269-1160A>G | ||||||
|
chr3:112101865
|
T | G | intron_variant | MODIFIER | HG00140.hp2 HG01243.hp2 HG02015.hp1 others(34): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0002c0002t0004others(2): Show | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0025others(24): Show | 37 | 372 | 0.0995 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 2/5 | c.269-973T>G | ||||||
|
chr3:112101866
|
T | C | intron_variant | MODIFIER | HG00140.hp2 HG01243.hp2 HG02015.hp1 others(34): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0002c0002t0004others(2): Show | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0025others(24): Show | 37 | 372 | 0.0995 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 2/5 | c.269-972T>C | ||||||
|
chr3:112101867
|
G | A | intron_variant | MODIFIER | HG00140.hp2 HG01243.hp2 HG02015.hp1 others(34): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0002c0002t0004others(2): Show | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0025others(24): Show | 37 | 372 | 0.0995 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 2/5 | c.269-971G>A | ||||||
|
chr3:112101896
|
T | G | intron_variant | MODIFIER | HG00140.hp2 HG01243.hp2 HG02015.hp1 others(33): Show |
a0002 | a0002c0002 | a0002c0002t0002a0002c0002t0003a0002c0002t0004others(1): Show | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0025others(23): Show | 36 | 372 | 0.0968 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 2/5 | c.269-942T>G | ||||||
|
chr3:112102051
|
A | G | intron_variant | MODIFIER | HG00140.hp2 HG01243.hp2 HG02015.hp1 others(34): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0002c0002t0004others(2): Show | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0025others(24): Show | 37 | 372 | 0.0995 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 2/5 | c.269-787A>G | ||||||
|
chr3:112102171
|
A | G | intron_variant | MODIFIER | HG00140.hp2 HG01243.hp2 HG02015.hp1 others(34): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0002c0002t0004others(2): Show | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0025others(24): Show | 37 | 372 | 0.0995 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 2/5 | c.269-667A>G | ||||||
|
chr3:112102200
|
G | A | intron_variant | MODIFIER | HG00140.hp2 HG01243.hp2 HG02015.hp1 others(34): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0002c0002t0004others(2): Show | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0025others(24): Show | 37 | 372 | 0.0995 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 2/5 | c.269-638G>A | ||||||
|
chr3:112102201
|
T | C | intron_variant | MODIFIER | HG00140.hp2 HG01243.hp2 HG02015.hp1 others(34): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0002c0002t0004others(2): Show | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0025others(24): Show | 37 | 372 | 0.0995 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 2/5 | c.269-637T>C | ||||||
|
chr3:112102375
|
A | C | intron_variant | MODIFIER | HG00140.hp2 HG01243.hp2 HG02015.hp1 others(34): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0002c0002t0004others(2): Show | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0025others(24): Show | 37 | 372 | 0.0995 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 2/5 | c.269-463A>C | ||||||
|
chr3:112102642
|
A | T | intron_variant | MODIFIER | HG00140.hp2 HG01243.hp2 HG02015.hp1 others(34): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0002c0002t0004others(2): Show | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0025others(24): Show | 37 | 372 | 0.0995 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 2/5 | c.269-196A>T | ||||||
|
chr3:112103016
|
A | G | intron_variant | MODIFIER | HG00140.hp2 HG01243.hp2 HG02015.hp1 others(34): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0002c0002t0004others(2): Show | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0025others(24): Show | 37 | 372 | 0.0995 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.396+51A>G | ||||||
|
chr3:112103251
|
G | A | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02109.hp1 others(25): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(17): Show | 28 | 372 | 0.0753 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.396+286G>A | ||||||
|
chr3:112103500
|
A | C | intron_variant | MODIFIER | HG00140.hp2 HG01243.hp2 HG02015.hp1 others(34): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0002c0002t0004others(2): Show | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0025others(24): Show | 37 | 372 | 0.0995 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.396+535A>C | ||||||
|
chr3:112103538
|
C | T | intron_variant | MODIFIER | HG00140.hp2 HG01243.hp2 HG02015.hp1 others(34): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0002c0002t0004others(2): Show | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0025others(24): Show | 37 | 372 | 0.0995 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.396+573C>T | ||||||
|
chr3:112103872
|
C | G | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02109.hp1 others(25): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(17): Show | 28 | 372 | 0.0753 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.396+907C>G | ||||||
|
chr3:112104104
|
T | C | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02109.hp1 others(25): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(17): Show | 28 | 372 | 0.0753 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.396+1139T>C | ||||||
|
chr3:112104242
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(344): Show |
a0001a0002a0004others(5): Show | a0001c0001a0001c0004a0001c0011others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004others(28): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0005others(202): Show | 347 | 372 | 0.9328 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.396+1277A>G | ||||||
|
chr3:112104268
|
C | T | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02109.hp1 others(25): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(17): Show | 28 | 372 | 0.0753 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.396+1303C>T | ||||||
|
chr3:112104269
|
C | G | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02109.hp1 others(25): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(17): Show | 28 | 372 | 0.0753 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.396+1304C>G | ||||||
|
chr3:112104375
|
A | G | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02109.hp1 others(25): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(17): Show | 28 | 372 | 0.0753 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.396+1410A>G | ||||||
|
chr3:112104706
|
G | A | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02109.hp1 others(25): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(17): Show | 28 | 372 | 0.0753 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.396+1741G>A | ||||||
|
chr3:112104843
|
C | G | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02109.hp1 others(25): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(17): Show | 28 | 372 | 0.0753 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.396+1878C>G | ||||||
|
chr3:112105133
|
G | A | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02109.hp1 others(25): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(17): Show | 28 | 372 | 0.0753 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.396+2168G>A | ||||||
|
chr3:112105189
|
G | T | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02109.hp1 others(25): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(17): Show | 28 | 372 | 0.0753 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.396+2224G>T | ||||||
|
chr3:112105225
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp2 HG00280.hp2 others(151): Show |
a0001a0002a0005others(3): Show | a0001c0001a0001c0011a0001c0012others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004others(14): Show | a0001c0001t0001g0067a0001c0001t0001g0118a0001c0001t0002g0002others(97): Show | 154 | 372 | 0.4140 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.396+2260T>C | ||||||
|
chr3:112105461
|
T | G | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02109.hp1 others(25): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(17): Show | 28 | 372 | 0.0753 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.396+2496T>G | ||||||
|
chr3:112105539
|
CGTGTGT | C | intron_variant | MODIFIER | HG00140.hp2 HG00323.hp2 HG00741.hp1 others(7): Show |
a0001a0002a0006 | a0001c0001a0002c0002a0006c0007 | a0001c0001t0001a0002c0002t0002a0006c0007t0006 | a0001c0001t0001g0037a0002c0002t0002g0024a0002c0002t0002g0054others(5): Show | 10 | 372 | 0.0269 | -6 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.396+2601_396+2606delGTGTGT | INFO_REALIGN_3_PRIME | |||||
|
chr3:112105823
|
C | CA | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp2 HG00280.hp2 others(48): Show |
a0001a0002a0008others(1): Show | a0001c0001a0002c0002a0008c0010others(1): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0006others(5): Show | a0001c0001t0001g0067a0001c0001t0001g0094a0001c0001t0002g0004others(30): Show | 51 | 372 | 0.1371 | 1 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.396+2877dupA | INFO_REALIGN_3_PRIME | |||||
|
chr3:112106264
|
CT | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(346): Show |
a0001a0002a0004others(5): Show | a0001c0001a0001c0004a0001c0011others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004others(28): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0005others(204): Show | 349 | 372 | 0.9382 | -1 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.397-3269delT | INFO_REALIGN_3_PRIME | |||||
|
chr3:112106297
|
T | C | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02109.hp1 others(25): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(17): Show | 28 | 372 | 0.0753 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.397-3246T>C | ||||||
|
chr3:112106373
|
A | G | intron_variant | MODIFIER | HG00140.hp2 HG01243.hp2 HG02015.hp1 others(34): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0002c0002t0004others(2): Show | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0025others(24): Show | 37 | 372 | 0.0995 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.397-3170A>G | ||||||
|
chr3:112106425
|
G | A | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02109.hp1 others(25): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(17): Show | 28 | 372 | 0.0753 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.397-3118G>A | ||||||
|
chr3:112107111
|
T | C | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02109.hp1 others(25): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(17): Show | 28 | 372 | 0.0753 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.397-2432T>C | ||||||
|
chr3:112107219
|
AG | A | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02109.hp1 others(25): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(17): Show | 28 | 372 | 0.0753 | -1 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.397-2321delG | INFO_REALIGN_3_PRIME | |||||
|
chr3:112107266
|
T | C | intron_variant | MODIFIER | HG00140.hp2 HG01106.hp2 HG02015.hp1 others(27): Show |
a0002a0005a0006 | a0002c0002a0005c0006a0006c0007 | a0002c0002t0002a0002c0002t0003a0005c0006t0002others(1): Show | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(19): Show | 30 | 372 | 0.0807 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.397-2277T>C | ||||||
|
chr3:112107564
|
A | G | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02109.hp1 others(25): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(17): Show | 28 | 372 | 0.0753 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.397-1979A>G | ||||||
|
chr3:112107827
|
T | TTC | intron_variant | MODIFIER | HG00140.hp2 HG01106.hp2 HG02015.hp1 others(27): Show |
a0002a0005a0006 | a0002c0002a0005c0006a0006c0007 | a0002c0002t0002a0002c0002t0003a0005c0006t0002others(1): Show | a0002c0002t0002g0023a0002c0002t0002g0024a0002c0002t0002g0046others(19): Show | 30 | 372 | 0.0807 | 2 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.397-1712_397-1711dupCT | INFO_REALIGN_3_PRIME | |||||
|
chr3:112108063
|
A | C | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02148.hp2 others(18): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0024a0002c0002t0002g0052a0002c0002t0002g0054others(11): Show | 21 | 372 | 0.0565 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.397-1480A>C | ||||||
|
chr3:112108294
|
T | C | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02148.hp2 others(18): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0024a0002c0002t0002g0052a0002c0002t0002g0054others(11): Show | 21 | 372 | 0.0565 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.397-1249T>C | ||||||
|
chr3:112108381
|
T | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(359): Show |
a0001a0002a0004others(5): Show | a0001c0001a0001c0004a0001c0011others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004others(28): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0005others(214): Show | 362 | 372 | 0.9731 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.397-1162T>G | ||||||
|
chr3:112108414
|
A | T | intron_variant | MODIFIER | HG00140.hp2 HG02148.hp2 HG03453.hp1 others(4): Show |
a0002 | a0002c0002 | a0002c0002t0002 | a0002c0002t0002g0024a0002c0002t0002g0054a0002c0002t0002g0055others(3): Show | 7 | 372 | 0.0188 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.397-1129A>T | ||||||
|
chr3:112108860
|
A | G | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02148.hp2 others(18): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0024a0002c0002t0002g0052a0002c0002t0002g0054others(11): Show | 21 | 372 | 0.0565 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.397-683A>G | ||||||
|
chr3:112108910
|
T | C | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02148.hp2 others(18): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0024a0002c0002t0002g0052a0002c0002t0002g0054others(11): Show | 21 | 372 | 0.0565 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.397-633T>C | ||||||
|
chr3:112108933
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(359): Show |
a0001a0002a0004others(5): Show | a0001c0001a0001c0004a0001c0011others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004others(28): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0005others(214): Show | 362 | 372 | 0.9731 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.397-610T>C | ||||||
|
chr3:112109275
|
A | G | intron_variant | MODIFIER | HG03453.hp1 NA19043.hp2 NA20129.hp2 |
a0002 | a0002c0002 | a0002c0002t0002 | a0002c0002t0002g0091a0002c0002t0002g0092a0002c0002t0002g0093 | 3 | 372 | 0.0081 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.397-268A>G | ||||||
|
chr3:112109537
|
G | GT | splice_acceptor_variant others(1): Show |
HIGH | HG00099.hp1 HG00140.hp2 HG00280.hp2 others(154): Show |
a0001a0002a0004others(4): Show | a0001c0001a0001c0011a0001c0012others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004others(15): Show | a0001c0001t0001g0067a0001c0001t0001g0118a0001c0001t0002g0002others(98): Show | 157 | 372 | 0.4220 | 1 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 3/5 | c.397-3dupT | INFO_REALIGN_3_PRIME | |||||
|
chr3:112109676
|
C | T | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02148.hp2 others(18): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0024a0002c0002t0002g0052a0002c0002t0002g0054others(11): Show | 21 | 372 | 0.0565 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 4/5 | c.467+63C>T | ||||||
|
chr3:112109722
|
G | A | intron_variant | MODIFIER | HG00140.hp2 HG02015.hp1 HG02148.hp2 others(18): Show |
a0002a0006 | a0002c0002a0006c0007 | a0002c0002t0002a0002c0002t0003a0006c0007t0006 | a0002c0002t0002g0024a0002c0002t0002g0052a0002c0002t0002g0054others(11): Show | 21 | 372 | 0.0565 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 4/5 | c.467+109G>A | ||||||
|
chr3:112111457
|
A | G | intron_variant | MODIFIER | HG00140.hp2 HG01106.hp2 HG01884.hp1 others(28): Show |
a0001a0002a0005 | a0001c0001a0002c0002a0005c0006 | a0001c0001t0002a0002c0002t0002a0002c0002t0003others(1): Show | a0001c0001t0002g0056a0001c0001t0002g0074a0001c0001t0002g0080others(20): Show | 31 | 372 | 0.0833 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 4/5 | c.468-1507A>G | ||||||
|
chr3:112112876
|
T | TAAAA | intron_variant | MODIFIER | HG00140.hp2 HG01884.hp1 HG02015.hp1 others(25): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0002a0002c0002t0002a0002c0002t0003 | a0001c0001t0002g0056a0001c0001t0002g0074a0002c0002t0002g0023others(17): Show | 28 | 372 | 0.0753 | 4 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 4/5 | c.468-78_468-75dupAAAA | INFO_REALIGN_3_PRIME | |||||
|
chr3:112113273
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp2 HG00280.hp2 others(154): Show |
a0001a0002a0005others(3): Show | a0001c0001a0001c0011a0001c0012others(5): Show | a0001c0001t0002a0001c0001t0004a0001c0001t0006others(13): Show | a0001c0001t0002g0002a0001c0001t0002g0004a0001c0001t0002g0007others(100): Show | 157 | 372 | 0.4220 | 0 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 5/5 | c.649+128A>G | ||||||
|
chr3:112114404
|
T | TA | intron_variant | MODIFIER | HG00621.hp1 HG01884.hp1 HG01884.hp2 others(60): Show |
a0001a0002 | a0001c0001a0001c0011a0002c0002 | a0001c0001t0001a0001c0001t0002a0001c0001t0007others(4): Show | a0001c0001t0001g0167a0001c0001t0001g0191a0001c0001t0002g0007others(42): Show | 63 | 372 | 0.1694 | 1 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 5/5 | c.649+1277dupA | INFO_REALIGN_3_PRIME | |||||
|
chr3:112116484
|
T | TG | intron_variant | MODIFIER | HG00140.hp2 HG01884.hp1 HG02015.hp1 others(18): Show |
a0001a0002 | a0001c0001a0002c0002 | a0001c0001t0002a0002c0002t0002a0002c0002t0003 | a0001c0001t0002g0056a0001c0001t0002g0074a0002c0002t0002g0024others(11): Show | 21 | 372 | 0.0565 | 1 | C3orf52 | ENSG00000114529.13 | transcript | ENST00000264848.10 | protein_coding | 5/5 | c.650-158_650-157insG |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
ahapid | alen | total | AFR | AMR | EAS | EUR | SAS | aseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| C3orf52 | 0/0 | a0002 | 217 | 36 | 20 | 2 | 10 | 1 | 3 | subcellular location copy fasta | chr3 | 112081389 | 112123210 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
chapid | clen | total | AFR | AMR | EAS | EUR | SAS | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| C3orf52 | 0/0 | c0002 | 654 | 36 | 20 | 2 | 10 | 1 | 3 | copy fasta | chr3 | 112081389 | 112123210 |
| genename | grch38/chm13v2 | thapid | tlen | total | AFR | AMR | EAS | EUR | SAS | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| C3orf52 | 0/1 | t0002 | 1584 | 156 | 62 | 26 | 44 | 8 | 15 | copy fasta | chr3 | 112081389 | 112123210 |
| genename | grch38/chm13v2 | ghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| C3orf52 | 0/0 | g0093 | 1 | 1 | 0 | 0 | 0 | 0 | chr3 | 112081389 | 112123210 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
achapid | total | AFR | AMR | EAS | EUR | SAS | clen | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| C3orf52 | 0/0 | a0002c0002 | 36 | 20 | 2 | 10 | 1 | 3 | 654 | copy fasta | chr3 | 112081389 | 112123210 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
acthapid | total | AFR | AMR | EAS | EUR | SAS | tlen | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| C3orf52 | 0/0 | a0002c0002t0002 | 19 | 15 | 2 | 0 | 1 | 1 | 2237 | copy fasta | chr3 | 112081389 | 112123210 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
actghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| C3orf52 | 0/0 | a0002c0002t0002g0093 | 1 | 1 | 0 | 0 | 0 | 0 | chr3 | 112081389 | 112123210 |
Click to load Haplotype QTL data...
| pos | S. Strand |
E# Exon Number |
max | median | min | diff | type | haplotypeid | max_hap_list | min_hap_list | symbol | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 112086545 | + | 1 | -0.9110 | -0.9110 | -0.9110 | 0.0000 | acceptor | a0002c0002t0002g0093 | NA20129.hp2 | NA20129.hp2 | C3orf52 | chr3 | 112081389 | 112123210 |
| 112093360 | + | 2 | 0.9906 | 0.9906 | 0.9906 | 0.0000 | donor | a0002c0002t0002g0093 | NA20129.hp2 | NA20129.hp2 | C3orf52 | chr3 | 112081389 | 112123210 |
| 112093489 | + | 2 | -0.9903 | -0.9903 | -0.9903 | 0.0000 | acceptor | a0002c0002t0002g0093 | NA20129.hp2 | NA20129.hp2 | C3orf52 | chr3 | 112081389 | 112123210 |
| 112102838 | + | 3 | 0.9969 | 0.9969 | 0.9969 | 0.0000 | donor | a0002c0002t0002g0093 | NA20129.hp2 | NA20129.hp2 | C3orf52 | chr3 | 112081389 | 112123210 |
| 112102965 | + | 3 | -0.9918 | -0.9918 | -0.9918 | 0.0000 | acceptor | a0002c0002t0002g0093 | NA20129.hp2 | NA20129.hp2 | C3orf52 | chr3 | 112081389 | 112123210 |
| 112109543 | + | 4 | 0.9895 | 0.9895 | 0.9895 | 0.0000 | donor | a0002c0002t0002g0093 | NA20129.hp2 | NA20129.hp2 | C3orf52 | chr3 | 112081389 | 112123210 |
| 112109613 | + | 4 | -0.9793 | -0.9793 | -0.9793 | 0.0000 | acceptor | a0002c0002t0002g0093 | NA20129.hp2 | NA20129.hp2 | C3orf52 | chr3 | 112081389 | 112123210 |
| 112112964 | + | 5 | 0.9953 | 0.9953 | 0.9953 | 0.0000 | donor | a0002c0002t0002g0093 | NA20129.hp2 | NA20129.hp2 | C3orf52 | chr3 | 112081389 | 112123210 |
| 112113145 | + | 5 | -0.9963 | -0.9963 | -0.9963 | 0.0000 | acceptor | a0002c0002t0002g0093 | NA20129.hp2 | NA20129.hp2 | C3orf52 | chr3 | 112081389 | 112123210 |
| 112116642 | + | 6 | 0.9765 | 0.9765 | 0.9765 | 0.0000 | donor | a0002c0002t0002g0093 | NA20129.hp2 | NA20129.hp2 | C3orf52 | chr3 | 112081389 | 112123210 |
| pos | annotationhgvs_chgvs_p | clinvarid | clnsig | geneinfo | mc | clndisdb | strand strand
|
ahapid ahapid_count
|
chapid chapid count
|
thapid thapid_count
|
ghapid ghapid_count
|
AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
impact | chr | ref | alt | external |
|---|
| CHR:POS | annotationhgvs_chgvs_p | disease trait-log10podds or beta | AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
study | initial sample size/replication sample size | report genes | mapped gene | strongest snp risk allele | strand strand
|
impact | chr | ref | alt |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr3:112111457
|
c.468-1507A>G | Eosinophil counts0.048528645 | a0001a0002a0005 | a0001c0001a0002c0002a0005c0006 | a0001c0001t0002a0002c0002t0002a0002c0002t0003a0005c0006t0002 | a0001c0001t0002g0056a0001c0001t0002g0074a0001c0001t0002g0080a0002c0002t0002g0023a0002c0002t0002g0024others(18): Show | HG00140.hp2 HG01106.hp2 HG01884.hp1 HG02015.hp1 HG02109.hp1 others(26): Show |
The Polygenic and Monogenic Basis of Blood Traits others(13): Show |
408,112 British individuals/ | C3orf52 | C3orf52 | rs79754744-G | + | MODIFIER | chr3 | A | G |
|
chr3:112111457
|
c.468-1507A>G |
Eosinophil percentage of white cells0.04 others(7): Show |
a0001a0002a0005 | a0001c0001a0002c0002a0005c0006 | a0001c0001t0002a0002c0002t0002a0002c0002t0003a0005c0006t0002 | a0001c0001t0002g0056a0001c0001t0002g0074a0001c0001t0002g0080a0002c0002t0002g0023a0002c0002t0002g0024others(18): Show | HG00140.hp2 HG01106.hp2 HG01884.hp1 HG02015.hp1 HG02109.hp1 others(26): Show |
The Polygenic and Monogenic Basis of Blood Traits others(13): Show |
408,112 British individuals/ | C3orf52 | C3orf52 | rs79754744-G | + | MODIFIER | chr3 | A | G |