| geneid | 1056 |
|---|---|
| ensemblid | ENSG00000170835.17 |
| hgncid | 1848 |
| symbol | CEL |
| name | carboxyl ester lipase |
| refseq_nuc | NM_001807.6 |
| refseq_prot | NP_001798.3 |
| ensembl_nuc | ENST00000372080.8 |
| ensembl_prot | ENSP00000361151.6 |
| mane_status | MANE Select |
| chr | chr9 |
| start | 133061981 |
| end | 133071861 |
| strand | + |
| ver | v1.2 |
| region | chr9:133061981-133071861 |
| region5000 | chr9:133056981-133076861 |
| regionname0 | CEL_chr9_133061981_133071861 |
| regionname5000 | CEL_chr9_133056981_133076861 |
| chr:pos | ref | alt | af | annotation | impact | samples | AHAPIDS | ACHAPIDS | ACTHAPIDS | ACTGHAPIDS | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr9:133071533
|
G | GC | 0.4375 | frameshift_variant | HIGH | HG00280.hp2 HG00408.hp2 HG00423.hp1 others(179): Show |
a0001a0002a0004others(26): Show | a0001c0019a0001c0020a0001c0054others(112): Show | a0001c0019t0001a0001c0020t0001a0001c0054t0001others(112): Show | a0001c0019t0001g0001a0001c0019t0001g0003a0001c0020t0001g0001others(140): Show | 182 | 416 | 1 | CEL | ENSG00000170835.17 | transcript | ENST00000372080.8 | protein_coding | 11/11 | c.2040dupC | p.Val681fs | 2063/2381 | 2041/2262 | 681/753 | INFO_REALIGN_3_PRIME | |
|
chr9:133071535
|
CCCCCCCC others(25): Show |
C | 0.1010 | frameshift_variant | HIGH | HG00408.hp1 HG00597.hp1 HG00621.hp1 others(39): Show |
a0001a0004a0006others(4): Show | a0001c0192a0001c0194a0001c0195others(22): Show | a0001c0192t0001a0001c0194t0001a0001c0195t0001others(22): Show | a0001c0192t0001g0002a0001c0194t0001g0002a0001c0195t0001g0084others(28): Show | 42 | 416 | -32 | CEL | ENSG00000170835.17 | transcript | ENST00000372080.8 | protein_coding | 11/11 | c.2041_2072delGTGCCGCCCACGGGTGACTCCGGCGCCCCCCC | p.Val681fs | 2063/2381 | 2041/2262 | 681/753 | INFO_REALIGN_3_PRIME | |
|
chr9:133071600
|
G | GC | 0.1130 | frameshift_variant | HIGH | HG00423.hp2 HG00544.hp2 HG00597.hp2 others(44): Show |
a0001a0002a0004others(11): Show | a0001c0019a0001c0055a0001c0058others(42): Show | a0001c0019t0001a0001c0055t0001a0001c0058t0001others(42): Show | a0001c0019t0001g0001a0001c0019t0001g0003a0001c0055t0001g0001others(44): Show | 47 | 416 | 1 | CEL | ENSG00000170835.17 | transcript | ENST00000372080.8 | protein_coding | 11/11 | c.2106dupC | p.Val703fs | 2129/2381 | 2107/2262 | 703/753 | INFO_REALIGN_3_PRIME |
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
ahapid | alen | total | AFR | AMR | EAS | EUR | SAS | aseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CEL | 0/0 | a0023 | 685 | 3 | 0 | 0 | 2 | 0 | 1 | subcellular location copy fasta | chr9 | 133056981 | 133076861 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
chapid | clen | total | AFR | AMR | EAS | EUR | SAS | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CEL | 0/0 | c0172 | 2264 | 1 | 0 | 0 | 0 | 0 | 1 | copy fasta | chr9 | 133056981 | 133076861 |
| genename | grch38/chm13v2 | thapid | tlen | total | AFR | AMR | EAS | EUR | SAS | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CEL | 1/1 | t0001 | 120 | 410 | 89 | 84 | 179 | 16 | 40 | copy fasta | chr9 | 133056981 | 133076861 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
achapid | total | AFR | AMR | EAS | EUR | SAS | clen | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CEL | 0/0 | a0023c0172 | 1 | 0 | 0 | 0 | 0 | 1 | 2264 | copy fasta | chr9 | 133056981 | 133076861 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
acthapid | total | AFR | AMR | EAS | EUR | SAS | tlen | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CEL | 0/0 | a0023c0172t0001 | 1 | 0 | 0 | 0 | 0 | 1 | 2383 | copy fasta | chr9 | 133056981 | 133076861 |
Click to load Haplotype QTL data...
| pos | S. Strand |
E# Exon Number |
max | median | min | diff | type | haplotypeid | max_hap_list | min_hap_list | symbol | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 133062068 | + | 1 | -0.1454 | -0.1454 | -0.1454 | 0.0000 | acceptor | a0023c0172t0001 | HG02698.hp1 | HG02698.hp1 | CEL | chr9 | 133056981 | 133076861 |
| 133064404 | + | 2 | 0.9986 | 0.9986 | 0.9986 | 0.0000 | donor | a0023c0172t0001 | HG02698.hp1 | HG02698.hp1 | CEL | chr9 | 133056981 | 133076861 |
| 133064554 | + | 2 | -0.9930 | -0.9930 | -0.9930 | 0.0000 | acceptor | a0023c0172t0001 | HG02698.hp1 | HG02698.hp1 | CEL | chr9 | 133056981 | 133076861 |
| 133064640 | + | 3 | 0.9989 | 0.9989 | 0.9989 | 0.0000 | donor | a0023c0172t0001 | HG02698.hp1 | HG02698.hp1 | CEL | chr9 | 133056981 | 133076861 |
| 133064762 | + | 3 | -0.9953 | -0.9953 | -0.9953 | 0.0000 | acceptor | a0023c0172t0001 | HG02698.hp1 | HG02698.hp1 | CEL | chr9 | 133056981 | 133076861 |
| 133065040 | + | 4 | 0.9783 | 0.9783 | 0.9783 | 0.0000 | donor | a0023c0172t0001 | HG02698.hp1 | HG02698.hp1 | CEL | chr9 | 133056981 | 133076861 |
| 133065237 | + | 4 | -0.9957 | -0.9957 | -0.9957 | 0.0000 | acceptor | a0023c0172t0001 | HG02698.hp1 | HG02698.hp1 | CEL | chr9 | 133056981 | 133076861 |
| 133066530 | + | 5 | 0.9964 | 0.9963 | 0.9964 | 0.0000 | donor | a0023c0172t0001 | HG02698.hp1 | HG02698.hp1 | CEL | chr9 | 133056981 | 133076861 |
| 133066660 | + | 5 | -0.8695 | -0.8695 | -0.8695 | 0.0000 | acceptor | a0023c0172t0001 | HG02698.hp1 | HG02698.hp1 | CEL | chr9 | 133056981 | 133076861 |
| 133066838 | + | 6 | 0.9951 | 0.9951 | 0.9951 | 0.0000 | donor | a0023c0172t0001 | HG02698.hp1 | HG02698.hp1 | CEL | chr9 | 133056981 | 133076861 |
| 133066945 | + | 6 | -0.9956 | -0.9956 | -0.9956 | 0.0000 | acceptor | a0023c0172t0001 | HG02698.hp1 | HG02698.hp1 | CEL | chr9 | 133056981 | 133076861 |
| 133067088 | + | 7 | 0.9797 | 0.9797 | 0.9797 | 0.0000 | donor | a0023c0172t0001 | HG02698.hp1 | HG02698.hp1 | CEL | chr9 | 133056981 | 133076861 |
| 133067205 | + | 7 | -0.9861 | -0.9861 | -0.9861 | 0.0000 | acceptor | a0023c0172t0001 | HG02698.hp1 | HG02698.hp1 | CEL | chr9 | 133056981 | 133076861 |
| 133068672 | + | 8 | 0.9995 | 0.9995 | 0.9995 | 0.0000 | donor | a0023c0172t0001 | HG02698.hp1 | HG02698.hp1 | CEL | chr9 | 133056981 | 133076861 |
| 133068858 | + | 8 | -0.9954 | -0.9954 | -0.9954 | 0.0000 | acceptor | a0023c0172t0001 | HG02698.hp1 | HG02698.hp1 | CEL | chr9 | 133056981 | 133076861 |
| 133069056 | + | 9 | 0.9932 | 0.9932 | 0.9932 | 0.0000 | donor | a0023c0172t0001 | HG02698.hp1 | HG02698.hp1 | CEL | chr9 | 133056981 | 133076861 |
| 133069259 | + | 9 | -0.9932 | -0.9932 | -0.9932 | 0.0000 | acceptor | a0023c0172t0001 | HG02698.hp1 | HG02698.hp1 | CEL | chr9 | 133056981 | 133076861 |
| 133070461 | + | 10 | 0.9827 | 0.9827 | 0.9827 | 0.0000 | donor | a0023c0172t0001 | HG02698.hp1 | HG02698.hp1 | CEL | chr9 | 133056981 | 133076861 |
| 133070658 | + | 10 | -0.9893 | -0.9892 | -0.9893 | 0.0000 | acceptor | a0023c0172t0001 | HG02698.hp1 | HG02698.hp1 | CEL | chr9 | 133056981 | 133076861 |
| 133070987 | + | 11 | 0.9894 | 0.9894 | 0.9894 | 0.0000 | donor | a0023c0172t0001 | HG02698.hp1 | HG02698.hp1 | CEL | chr9 | 133056981 | 133076861 |
| pos | annotationhgvs_chgvs_p | clinvarid | clnsig | geneinfo | mc | clndisdb | strand strand
|
ahapid ahapid_count
|
chapid chapid count
|
thapid thapid_count
|
ghapid ghapid_count
|
AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
impact | chr | ref | alt | external |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 133071533:splice 133071533:variant goto | c.2040dupCp.Val681fs | 3779506 | Uncertain_significance | CEL:1056 | SO:0001589 frameshift_variant |
MONDO:MONDO:0012348 MedGen:C1853297 OMIM:609812 Orphanet:552 |
+ | 29 | 115 | 115 | 143 | a0001a0002a0004a0005a0006others(24): Show | a0001c0019a0001c0020a0001c0054a0001c0055a0001c0056others(110): Show | a0001c0019t0001a0001c0020t0001a0001c0054t0001a0001c0055t0001a0001c0056t0001others(110): Show | a0001c0019t0001g0001a0001c0019t0001g0003a0001c0020t0001g0001a0001c0020t0001g0043a0001c0054t0001g0056others(138): Show | HG00280.hp2 HG00408.hp2 HG00423.hp1 HG00423.hp2 HG00438.hp2 others(177): Show |
HIGH | chr9 | G | GC | TogoVar |
| CHR:POS | annotationhgvs_chgvs_p | disease trait-log10podds or beta | AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
study | initial sample size/replication sample size | report genes | mapped gene | strongest snp risk allele | strand strand
|
impact | chr | ref | alt |
|---|
| pos | genenamehgvs_chgvs_pannotation | tissueexpression gene-log10(pval)slope Tissue name in GTEx database(the target eQTL tissue name of the GTEx database)The -log10(nominal pvalue) in GTEx databaseSlope in GTEx database (positive value:alt allele has higher gene expression) |
ahapidchapidthapidghapid ahapid_countchapid_countthapid_countghapid_count
|
AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
af allele frequency in GTEx database |
ms The number of samples with minor allele in GTEx database |
ma The number of minor allele count in GTEx database |
ver GTEx version |
vid Variant ID in GTEx database |
strand strand
|
impact | chr | ref | alt | external |
|---|