| geneid | 55748 |
|---|---|
| ensemblid | ENSG00000133313.15 |
| hgncid | 24437 |
| symbol | CNDP2 |
| name | carnosine dipeptidase 2 |
| refseq_nuc | NM_018235.3 |
| refseq_prot | NP_060705.2 |
| ensembl_nuc | ENST00000324262.9 |
| ensembl_prot | ENSP00000325548.4 |
| mane_status | MANE Select |
| chr | chr18 |
| start | 74496363 |
| end | 74523454 |
| strand | + |
| ver | v1.2 |
| region | chr18:74496363-74523454 |
| region5000 | chr18:74491363-74528454 |
| regionname0 | CNDP2_chr18_74496363_74523454 |
| regionname5000 | CNDP2_chr18_74491363_74528454 |
| chr:pos | ref | alt | af | annotation | impact | samples | AHAPIDS | ACHAPIDS | ACTHAPIDS | ACTGHAPIDS | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr18:74520377
|
C | T | 0.8797 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(370): Show |
a0001a0002a0004others(6): Show | a0001c0001a0001c0003a0001c0005others(14): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(54): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(269): Show | 373 | 424 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 12/12 | c.*309C>T | 309 | |||||
|
chr18:74521016
|
C | T | 0.8679 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(365): Show |
a0001a0002a0003others(6): Show | a0001c0001a0001c0003a0001c0005others(15): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(55): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(264): Show | 368 | 424 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 12/12 | c.*948C>T | 948 | |||||
|
chr18:74521017
|
A | G | 0.9127 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(384): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0003a0001c0005others(16): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(63): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(283): Show | 387 | 424 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 12/12 | c.*949A>G | 949 | |||||
|
chr18:74521136
|
A | G | 0.9127 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(384): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0003a0001c0005others(16): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(63): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(283): Show | 387 | 424 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 12/12 | c.*1068A>G | 1068 | |||||
|
chr18:74521339
|
TA | T | 0.9127 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(384): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0003a0001c0005others(16): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(63): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(283): Show | 387 | 424 | -1 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 12/12 | c.*1273delA | 1273 | INFO_REALIGN_3_PRIME | ||||
|
chr18:74522015
|
C | A | 0.9080 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(382): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0003a0001c0005others(16): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(62): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(281): Show | 385 | 424 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 12/12 | c.*1947C>A | 1947 | |||||
|
chr18:74522075
|
T | C | 0.9127 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(384): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0003a0001c0005others(16): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(63): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(283): Show | 387 | 424 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 12/12 | c.*2007T>C | 2007 |
| chr:pos | ref | alt | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | af | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr18:74500411
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(384): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0003a0001c0005others(15): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(67): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(281): Show | 387 | 424 | 0.9127 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 2/11 | c.60+378A>G | ||||||
|
chr18:74502269
|
T | A | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(210): Show |
a0001a0002a0004others(3): Show | a0001c0001a0001c0009a0002c0006others(5): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(26): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(139): Show | 213 | 424 | 0.5024 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.204+797T>A | ||||||
|
chr18:74503073
|
G | GT | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(251): Show |
a0001a0002a0004others(4): Show | a0001c0001a0001c0009a0001c0020others(7): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(34): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(173): Show | 254 | 424 | 0.5991 | 1 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.204+1614dupT | INFO_REALIGN_3_PRIME | |||||
|
chr18:74503847
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(209): Show |
a0001a0002a0004others(3): Show | a0001c0001a0001c0009a0002c0006others(5): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(26): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(138): Show | 212 | 424 | 0.5000 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.205-2002G>A | ||||||
|
chr18:74503870
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00280.hp1 others(70): Show |
a0001a0002a0011 | a0001c0001a0002c0006a0011c0018 | a0001c0001t0001a0001c0001t0003a0001c0001t0011others(8): Show | a0001c0001t0001g0001a0001c0001t0001g0004a0001c0001t0001g0017others(44): Show | 73 | 424 | 0.1722 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.205-1979G>A | ||||||
|
chr18:74503904
|
A | ACACACGC others(47): Show |
intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(355): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0003a0001c0005others(15): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(63): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(256): Show | 358 | 424 | 0.8443 | 54 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.205-1912_205-1911insTGGGCGTCAGGCCATACACTGCACACGCAGCCACACTGCCGCTGGGACAAATGA | INFO_REALIGN_3_PRIME | |||||
|
chr18:74504375
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(210): Show |
a0001a0002a0004others(3): Show | a0001c0001a0001c0009a0002c0006others(5): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(26): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(139): Show | 213 | 424 | 0.5024 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.205-1474G>A | ||||||
|
chr18:74504649
|
C | T | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(344): Show |
a0001a0002a0003others(6): Show | a0001c0001a0001c0003a0001c0009others(13): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(60): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(246): Show | 347 | 424 | 0.8184 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.205-1200C>T | ||||||
|
chr18:74505492
|
G | T | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(210): Show |
a0001a0002a0004others(3): Show | a0001c0001a0001c0009a0002c0002others(5): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004others(26): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(139): Show | 213 | 424 | 0.5024 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.205-357G>T | ||||||
|
chr18:74505564
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(414): Show |
a0001a0002a0003others(8): Show | a0001c0001a0001c0003a0001c0005others(17): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(73): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(305): Show | 417 | 424 | 0.9835 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.205-285G>A | ||||||
|
chr18:74507366
|
C | T | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(219): Show |
a0001a0004a0005others(3): Show | a0001c0001a0001c0003a0001c0009others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(31): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(147): Show | 222 | 424 | 0.5236 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 4/11 | c.367+1355C>T | ||||||
|
chr18:74507466
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(219): Show |
a0001a0004a0005others(3): Show | a0001c0001a0001c0003a0001c0009others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(31): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(147): Show | 222 | 424 | 0.5236 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 4/11 | c.368-1374G>A | ||||||
|
chr18:74509632
|
C | CA | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(208): Show |
a0001a0003a0004others(4): Show | a0001c0001a0001c0003a0001c0009others(7): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(33): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(136): Show | 211 | 424 | 0.4976 | 1 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 5/11 | c.456+719dupA | INFO_REALIGN_3_PRIME | |||||
|
chr18:74509741
|
CAGTT | C | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(220): Show |
a0001a0004a0005others(3): Show | a0001c0001a0001c0003a0001c0009others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(32): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(148): Show | 223 | 424 | 0.5259 | -4 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 5/11 | c.456+817_456+820delTAGT | INFO_REALIGN_3_PRIME | |||||
|
chr18:74509925
|
G | C | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(220): Show |
a0001a0004a0005others(3): Show | a0001c0001a0001c0003a0001c0009others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(32): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(148): Show | 223 | 424 | 0.5259 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 5/11 | c.457-888G>C | ||||||
|
chr18:74510230
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(268): Show |
a0001a0003a0004others(5): Show | a0001c0001a0001c0003a0001c0005others(10): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(46): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(187): Show | 271 | 424 | 0.6392 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 5/11 | c.457-583A>G | ||||||
|
chr18:74511133
|
A | T | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(220): Show |
a0001a0004a0005others(3): Show | a0001c0001a0001c0003a0001c0009others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(32): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(148): Show | 223 | 424 | 0.5259 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 6/11 | c.657+120A>T | ||||||
|
chr18:74511175
|
C | T | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(390): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0003a0001c0005others(15): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(68): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(285): Show | 393 | 424 | 0.9269 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 6/11 | c.657+162C>T | ||||||
|
chr18:74513488
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(212): Show |
a0001a0004a0005others(3): Show | a0001c0001a0001c0003a0001c0009others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(31): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(141): Show | 215 | 424 | 0.5071 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 7/11 | c.743-71G>A | ||||||
|
chr18:74514248
|
T | A | intron_variant | MODIFIER | HG01099.hp1 NA20752.hp2 |
a0001 | a0001c0001 | a0001c0001t0001a0001c0001t0011 | a0001c0001t0001g0213a0001c0001t0011g0214 | 2 | 424 | 0.0047 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 8/11 | c.903+529T>A | ||||||
|
chr18:74514572
|
C | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(99): Show |
a0001a0011 | a0001c0001a0001c0003a0001c0005others(2): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0008others(18): Show | a0001c0001t0001g0001a0001c0001t0001g0004a0001c0001t0001g0017others(70): Show | 102 | 424 | 0.2406 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 8/11 | c.903+853C>G | ||||||
|
chr18:74514577
|
GGGCTTAC others(30): Show |
G | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00280.hp1 others(71): Show |
a0001a0011 | a0001c0001a0001c0003a0011c0018 | a0001c0001t0001a0001c0001t0003a0001c0001t0011others(10): Show | a0001c0001t0001g0001a0001c0001t0001g0004a0001c0001t0001g0017others(46): Show | 74 | 424 | 0.1745 | -37 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 8/11 | c.903+861_903+897delCTTACGTGGTACGTATGTAAGTTCTGCAGGCTATAGG | INFO_REALIGN_3_PRIME | |||||
|
chr18:74514802
|
G | C | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(263): Show |
a0001a0003a0004others(5): Show | a0001c0001a0001c0003a0001c0009others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(43): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(183): Show | 266 | 424 | 0.6274 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 8/11 | c.903+1083G>C | ||||||
|
chr18:74516623
|
CCTCA | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(367): Show |
a0001a0002a0003others(6): Show | a0001c0001a0001c0003a0001c0005others(14): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(66): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(265): Show | 370 | 424 | 0.8726 | -4 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 9/11 | c.1068+237_1068+240delTCAC | INFO_REALIGN_3_PRIME | |||||
|
chr18:74516981
|
GTAGCTTA others(14): Show |
G | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(226): Show |
a0001a0002a0004others(4): Show | a0001c0001a0001c0003a0001c0009others(7): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(36): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(155): Show | 229 | 424 | 0.5401 | -21 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 9/11 | c.1068+606_1068+626delCGCGATAGCTTACGTGGCAGA | INFO_REALIGN_3_PRIME | |||||
|
chr18:74518003
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(397): Show |
a0001a0002a0003others(8): Show | a0001c0001a0001c0003a0001c0009others(15): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(67): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(289): Show | 400 | 424 | 0.9434 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 9/11 | c.1069-496G>A | ||||||
|
chr18:74518121
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(126): Show |
a0001a0002a0008 | a0001c0001a0001c0003a0001c0020others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(22): Show | a0001c0001t0001g0001a0001c0001t0001g0009a0001c0001t0001g0011others(92): Show | 129 | 424 | 0.3043 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 9/11 | c.1069-378T>C | ||||||
|
chr18:74518737
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(371): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0003a0001c0005others(14): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(58): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(267): Show | 374 | 424 | 0.8821 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 10/11 | c.1210+97G>A | ||||||
|
chr18:74518824
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(408): Show |
a0001a0002a0003others(8): Show | a0001c0001a0001c0003a0001c0005others(17): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(71): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(302): Show | 411 | 424 | 0.9693 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 10/11 | c.1211-125G>A | ||||||
|
chr18:74518940
|
T | TC | splice_acceptor_variant others(1): Show |
HIGH | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(352): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0003a0001c0005others(16): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0005others(56): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(255): Show | 355 | 424 | 0.8373 | 1 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 10/11 | c.1211-3dupC | INFO_REALIGN_3_PRIME | |||||
|
chr18:74519169
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(278): Show |
a0001a0002a0004others(5): Show | a0001c0001a0001c0003a0001c0009others(11): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0005others(37): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(193): Show | 281 | 424 | 0.6627 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 11/11 | c.1358+73G>A |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
ahapid | alen | total | AFR | AMR | EAS | EUR | SAS | aseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CNDP2 | 1/1 | a0001 | 475 | 313 | 82 | 56 | 124 | 16 | 33 | subcellular location copy fasta | chr18 | 74491363 | 74528454 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
chapid | clen | total | AFR | AMR | EAS | EUR | SAS | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CNDP2 | 1/1 | c0001 | 1428 | 286 | 62 | 55 | 121 | 16 | 30 | copy fasta | chr18 | 74491363 | 74528454 |
| genename | grch38/chm13v2 | thapid | tlen | total | AFR | AMR | EAS | EUR | SAS | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CNDP2 | 0/1 | t0001 | 3547 | 183 | 21 | 35 | 98 | 10 | 18 | copy fasta | chr18 | 74491363 | 74528454 |
| genename | grch38/chm13v2 | ghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| CNDP2 | 0/0 | g0213 | 1 | 0 | 0 | 0 | 1 | 0 | chr18 | 74491363 | 74528454 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
achapid | total | AFR | AMR | EAS | EUR | SAS | clen | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CNDP2 | 1/1 | a0001c0001 | 286 | 62 | 55 | 121 | 16 | 30 | 1428 | copy fasta | chr18 | 74491363 | 74528454 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
acthapid | total | AFR | AMR | EAS | EUR | SAS | tlen | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CNDP2 | 0/1 | a0001c0001t0001 | 174 | 21 | 34 | 91 | 10 | 17 | 4974 | copy fasta | chr18 | 74491363 | 74528454 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
actghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| CNDP2 | 0/0 | a0001c0001t0001g0213 | 1 | 0 | 0 | 0 | 1 | 0 | chr18 | 74491363 | 74528454 |
Click to load Haplotype QTL data...
| pos | S. Strand |
E# Exon Number |
max | median | min | diff | type | haplotypeid | max_hap_list | min_hap_list | symbol | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 74496431 | + | 1 | -0.5667 | -0.5667 | -0.5667 | 0.0000 | acceptor | a0001c0001t0001g0213 | NA20752.hp2 | NA20752.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74499882 | + | 2 | 0.9509 | 0.9509 | 0.9509 | 0.0000 | donor | a0001c0001t0001g0213 | NA20752.hp2 | NA20752.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74500033 | + | 2 | -0.9171 | -0.9171 | -0.9171 | 0.0000 | acceptor | a0001c0001t0001g0213 | NA20752.hp2 | NA20752.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74501329 | + | 3 | 0.8935 | 0.8935 | 0.8935 | 0.0000 | donor | a0001c0001t0001g0213 | NA20752.hp2 | NA20752.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74501472 | + | 3 | -0.9605 | -0.9605 | -0.9605 | 0.0000 | acceptor | a0001c0001t0001g0213 | NA20752.hp2 | NA20752.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74505849 | + | 4 | 0.9495 | 0.9495 | 0.9495 | 0.0000 | donor | a0001c0001t0001g0213 | NA20752.hp2 | NA20752.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74506011 | + | 4 | -0.9891 | -0.9891 | -0.9891 | 0.0000 | acceptor | a0001c0001t0001g0213 | NA20752.hp2 | NA20752.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74508840 | + | 5 | 0.9316 | 0.9316 | 0.9316 | 0.0000 | donor | a0001c0001t0001g0213 | NA20752.hp2 | NA20752.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74508928 | + | 5 | -0.9682 | -0.9682 | -0.9682 | 0.0000 | acceptor | a0001c0001t0001g0213 | NA20752.hp2 | NA20752.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74510813 | + | 6 | 0.9941 | 0.9941 | 0.9941 | 0.0000 | donor | a0001c0001t0001g0213 | NA20752.hp2 | NA20752.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74511013 | + | 6 | -0.9960 | -0.9960 | -0.9960 | 0.0000 | acceptor | a0001c0001t0001g0213 | NA20752.hp2 | NA20752.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74512448 | + | 7 | 0.9917 | 0.9917 | 0.9917 | 0.0000 | donor | a0001c0001t0001g0213 | NA20752.hp2 | NA20752.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74512532 | + | 7 | -0.9951 | -0.9951 | -0.9951 | 0.0000 | acceptor | a0001c0001t0001g0213 | NA20752.hp2 | NA20752.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74513559 | + | 8 | 0.9959 | 0.9959 | 0.9959 | 0.0000 | donor | a0001c0001t0001g0213 | NA20752.hp2 | NA20752.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74513719 | + | 8 | -0.9929 | -0.9929 | -0.9929 | 0.0000 | acceptor | a0001c0001t0001g0213 | NA20752.hp2 | NA20752.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74516228 | + | 9 | 0.9955 | 0.9955 | 0.9955 | 0.0000 | donor | a0001c0001t0001g0213 | NA20752.hp2 | NA20752.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74516392 | + | 9 | -0.9679 | -0.9679 | -0.9679 | 0.0000 | acceptor | a0001c0001t0001g0213 | NA20752.hp2 | NA20752.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74518499 | + | 10 | 0.9129 | 0.9129 | 0.9129 | 0.0000 | donor | a0001c0001t0001g0213 | NA20752.hp2 | NA20752.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74518640 | + | 10 | -0.9457 | -0.9457 | -0.9457 | 0.0000 | acceptor | a0001c0001t0001g0213 | NA20752.hp2 | NA20752.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74518949 | + | 11 | 0.9951 | 0.9951 | 0.9951 | 0.0000 | donor | a0001c0001t0001g0213 | NA20752.hp2 | NA20752.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74519096 | + | 11 | -0.9977 | -0.9977 | -0.9977 | 0.0000 | acceptor | a0001c0001t0001g0213 | NA20752.hp2 | NA20752.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74519999 | + | 12 | 0.7659 | 0.7659 | 0.7659 | 0.0000 | donor | a0001c0001t0001g0213 | NA20752.hp2 | NA20752.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| pos | annotationhgvs_chgvs_p | clinvarid | clnsig | geneinfo | mc | clndisdb | strand strand
|
ahapid ahapid_count
|
chapid chapid count
|
thapid thapid_count
|
ghapid ghapid_count
|
AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
impact | chr | ref | alt | external |
|---|
| CHR:POS | annotationhgvs_chgvs_p | disease trait-log10podds or beta | AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
study | initial sample size/replication sample size | report genes | mapped gene | strongest snp risk allele | strand strand
|
impact | chr | ref | alt |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr18:74511175
|
c.657+162C>T | Height | a0001a0002a0003a0004a0005others(5): Show | a0001c0001a0001c0003a0001c0005a0001c0009a0001c0016others(13): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(66): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004a0001c0001t0001g0005a0001c0001t0001g0007others(283): Show | HG00099.hp1 HG00099.hp2 HG00140.hp1 HG00140.hp2 HG00280.hp1 others(388): Show |
Leveraging Polygenic Functional Enrichment to Impr others(15): Show |
approximately 458,000 European ancestry individual others(2): Show |
CNDP2 | rs8088885-? | + | MODIFIER | chr18 | C | T | |
|
chr18:74510230
|
c.457-583A>G | Spherical equivalent0.0844 | a0001a0003a0004a0005a0006others(3): Show | a0001c0001a0001c0003a0001c0005a0001c0009a0001c0016others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(44): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004a0001c0001t0001g0005a0001c0001t0001g0007others(185): Show | HG00099.hp1 HG00099.hp2 HG00140.hp1 HG00140.hp2 HG00280.hp1 others(266): Show |
Genome-wide association meta-analysis highlights l others(56): Show |
41,073 European ancestry individuals, 2,610 Erasmu others(243): Show |
NR | CNDP2 | rs8084058-A | + | MODIFIER | chr18 | A | G |
|
chr18:74510230
|
c.457-583A>G | Beta-Ala-His dipeptidase levels0.12 | a0001a0003a0004a0005a0006others(3): Show | a0001c0001a0001c0003a0001c0005a0001c0009a0001c0016others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(44): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004a0001c0001t0001g0005a0001c0001t0001g0007others(185): Show | HG00099.hp1 HG00099.hp2 HG00140.hp1 HG00140.hp2 HG00280.hp1 others(266): Show |
Mapping the proteo-genomic convergence of human di others(7): Show |
10,708 European ancestry individuals/ | CNDP2 | rs8084058-A | + | MODIFIER | chr18 | A | G | |
|
chr18:74510230
|
c.457-583A>G | N-acetylserine levels0.057304062 | a0001a0003a0004a0005a0006others(3): Show | a0001c0001a0001c0003a0001c0005a0001c0009a0001c0016others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(44): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004a0001c0001t0001g0005a0001c0001t0001g0007others(185): Show | HG00099.hp1 HG00099.hp2 HG00140.hp1 HG00140.hp2 HG00280.hp1 others(266): Show |
Rare and common genetic determinants of metabolic others(48): Show |
14,296 European ancestry individuals/5,698 Europea others(22): Show |
CNDP2 | rs8084058-A | + | MODIFIER | chr18 | A | G | |
|
chr18:74510230
|
c.457-583A>G | N-formylmethionine levels0.055290055 | a0001a0003a0004a0005a0006others(3): Show | a0001c0001a0001c0003a0001c0005a0001c0009a0001c0016others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(44): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004a0001c0001t0001g0005a0001c0001t0001g0007others(185): Show | HG00099.hp1 HG00099.hp2 HG00140.hp1 HG00140.hp2 HG00280.hp1 others(266): Show |
Rare and common genetic determinants of metabolic others(48): Show |
14,296 European ancestry individuals/5,698 Europea others(22): Show |
CNDP2 | rs8084058-A | + | MODIFIER | chr18 | A | G | |
|
chr18:74496357
|
c.-167G>A | Valylleucine levels (advanced age)0.233 | a0001a0002a0004a0005a0009others(1): Show | a0001c0001a0001c0003a0001c0009a0002c0002a0002c0006others(5): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004a0001c0001t0008a0001c0001t0011others(26): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004a0001c0001t0001g0005a0001c0001t0001g0007others(140): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00323.hp2 others(208): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
116 Han Chinese ancestry individuals/ | CNDP2 | rs6566811-? | + | MODIFIER | chr18 | G | A | |
|
chr18:74496357
|
c.-167G>A | Valylglycine levels (advanced age)0.1794 | a0001a0002a0004a0005a0009others(1): Show | a0001c0001a0001c0003a0001c0009a0002c0002a0002c0006others(5): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004a0001c0001t0008a0001c0001t0011others(26): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004a0001c0001t0001g0005a0001c0001t0001g0007others(140): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00323.hp2 others(208): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
116 Han Chinese ancestry individuals/ | CNDP2 | rs6566811-? | + | MODIFIER | chr18 | G | A | |
|
chr18:74496357
|
c.-167G>A |
Valylglycine levels (elderly offspring)0 others(5): Show |
a0001a0002a0004a0005a0009others(1): Show | a0001c0001a0001c0003a0001c0009a0002c0002a0002c0006others(5): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004a0001c0001t0008a0001c0001t0011others(26): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004a0001c0001t0001g0005a0001c0001t0001g0007others(140): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00323.hp2 others(208): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
232 Han Chinese ancestry individuals/ | CNDP2 | rs6566811-? | + | MODIFIER | chr18 | G | A | |
|
chr18:74496357
|
c.-167G>A |
Valylleucine levels (elderly offspring)0 others(5): Show |
a0001a0002a0004a0005a0009others(1): Show | a0001c0001a0001c0003a0001c0009a0002c0002a0002c0006others(5): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0004a0001c0001t0008a0001c0001t0011others(26): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004a0001c0001t0001g0005a0001c0001t0001g0007others(140): Show | HG00099.hp1 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00323.hp2 others(208): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
232 Han Chinese ancestry individuals/ | CNDP2 | rs6566811-? | + | MODIFIER | chr18 | G | A |