| geneid | 55748 |
|---|---|
| ensemblid | ENSG00000133313.15 |
| hgncid | 24437 |
| symbol | CNDP2 |
| name | carnosine dipeptidase 2 |
| refseq_nuc | NM_018235.3 |
| refseq_prot | NP_060705.2 |
| ensembl_nuc | ENST00000324262.9 |
| ensembl_prot | ENSP00000325548.4 |
| mane_status | MANE Select |
| chr | chr18 |
| start | 74496363 |
| end | 74523454 |
| strand | + |
| ver | v1.2 |
| region | chr18:74496363-74523454 |
| region5000 | chr18:74491363-74528454 |
| regionname0 | CNDP2_chr18_74496363_74523454 |
| regionname5000 | CNDP2_chr18_74491363_74528454 |
| chr:pos | ref | alt | af | annotation | impact | samples | AHAPIDS | ACHAPIDS | ACTHAPIDS | ACTGHAPIDS | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr18:74501373
|
G | A | 0.2712 | synonymous_variant | LOW | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(112): Show |
a0001a0002a0006others(2): Show | a0001c0003a0001c0005a0002c0002others(4): Show | a0001c0003t0002a0001c0003t0006a0001c0003t0007others(22): Show | a0001c0003t0002g0036a0001c0003t0002g0116a0001c0003t0002g0122others(90): Show | 115 | 424 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/12 | c.105G>A | p.Pro35Pro | 266/4975 | 105/1428 | 35/475 |
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr18:74499889
|
C | G | 0.3797 | 5_prime_UTR_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(158): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0003a0001c0005others(9): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006others(36): Show | a0001c0001t0002g0025a0001c0001t0002g0026a0001c0001t0002g0037others(127): Show | 161 | 424 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 2/12 | c.-85C>G | 85 | |||||
|
chr18:74520377
|
C | T | 0.8797 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(370): Show |
a0001a0002a0004others(6): Show | a0001c0001a0001c0003a0001c0005others(14): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(54): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(269): Show | 373 | 424 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 12/12 | c.*309C>T | 309 | |||||
|
chr18:74521016
|
C | T | 0.8679 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(365): Show |
a0001a0002a0003others(6): Show | a0001c0001a0001c0003a0001c0005others(15): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(55): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(264): Show | 368 | 424 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 12/12 | c.*948C>T | 948 | |||||
|
chr18:74521017
|
A | G | 0.9127 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(384): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0003a0001c0005others(16): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(63): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(283): Show | 387 | 424 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 12/12 | c.*949A>G | 949 | |||||
|
chr18:74521136
|
A | G | 0.9127 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(384): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0003a0001c0005others(16): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(63): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(283): Show | 387 | 424 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 12/12 | c.*1068A>G | 1068 | |||||
|
chr18:74521339
|
TA | T | 0.9127 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(384): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0003a0001c0005others(16): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(63): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(283): Show | 387 | 424 | -1 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 12/12 | c.*1273delA | 1273 | INFO_REALIGN_3_PRIME | ||||
|
chr18:74522015
|
C | A | 0.9080 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(382): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0003a0001c0005others(16): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(62): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(281): Show | 385 | 424 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 12/12 | c.*1947C>A | 1947 | |||||
|
chr18:74522075
|
T | C | 0.9127 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(384): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0003a0001c0005others(16): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(63): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(283): Show | 387 | 424 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 12/12 | c.*2007T>C | 2007 |
| chr:pos | ref | alt | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | af | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr18:74500411
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(384): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0003a0001c0005others(15): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(67): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(281): Show | 387 | 424 | 0.9127 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 2/11 | c.60+378A>G | ||||||
|
chr18:74500471
|
G | A | intron_variant | MODIFIER | HG02258.hp2 HG02809.hp1 HG02818.hp1 others(5): Show |
a0001a0008 | a0001c0003a0008c0012 | a0001c0003t0002a0001c0003t0006a0001c0003t0007others(1): Show | a0001c0003t0002g0192a0001c0003t0002g0193a0001c0003t0002g0194others(4): Show | 8 | 424 | 0.0189 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 2/11 | c.60+438G>A | ||||||
|
chr18:74500567
|
G | A | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(111): Show |
a0001a0002a0006others(2): Show | a0001c0001a0001c0003a0001c0005others(5): Show | a0001c0001t0018a0001c0003t0002a0001c0003t0006others(23): Show | a0001c0001t0018g0175a0001c0003t0002g0036a0001c0003t0002g0116others(89): Show | 114 | 424 | 0.2689 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 2/11 | c.60+534G>A | ||||||
|
chr18:74501077
|
T | A | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(159): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0003a0001c0005others(9): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006others(37): Show | a0001c0001t0002g0025a0001c0001t0002g0026a0001c0001t0002g0037others(128): Show | 162 | 424 | 0.3821 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 2/11 | c.61-252T>A | ||||||
|
chr18:74501251
|
T | C | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(161): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0003a0001c0005others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0005others(38): Show | a0001c0001t0001g0196a0001c0001t0001g0198a0001c0001t0002g0025others(130): Show | 164 | 424 | 0.3868 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 2/11 | c.61-78T>C | ||||||
|
chr18:74501894
|
T | A | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(158): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0003a0001c0005others(9): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006others(37): Show | a0001c0001t0002g0025a0001c0001t0002g0026a0001c0001t0002g0037others(127): Show | 161 | 424 | 0.3797 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.204+422T>A | ||||||
|
chr18:74502032
|
A | T | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(158): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0003a0001c0005others(9): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006others(36): Show | a0001c0001t0002g0025a0001c0001t0002g0026a0001c0001t0002g0037others(127): Show | 161 | 424 | 0.3797 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.204+560A>T | ||||||
|
chr18:74502472
|
G | GTTT | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(106): Show |
a0001a0002a0006others(2): Show | a0001c0003a0001c0005a0002c0002others(4): Show | a0001c0003t0002a0001c0003t0006a0001c0003t0007others(22): Show | a0001c0003t0002g0036a0001c0003t0002g0116a0001c0003t0002g0122others(84): Show | 109 | 424 | 0.2571 | 3 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.204+1000_204+1001insTTT | ||||||
|
chr18:74502473
|
G | T | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(112): Show |
a0001a0002a0006others(2): Show | a0001c0003a0001c0005a0002c0002others(4): Show | a0001c0003t0002a0001c0003t0006a0001c0003t0007others(22): Show | a0001c0003t0002g0036a0001c0003t0002g0116a0001c0003t0002g0122others(90): Show | 115 | 424 | 0.2712 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.204+1001G>T | ||||||
|
chr18:74502488
|
G | A | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(112): Show |
a0001a0002a0006others(2): Show | a0001c0003a0001c0005a0002c0002others(4): Show | a0001c0003t0002a0001c0003t0006a0001c0003t0007others(22): Show | a0001c0003t0002g0036a0001c0003t0002g0116a0001c0003t0002g0122others(90): Show | 115 | 424 | 0.2712 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.204+1016G>A | ||||||
|
chr18:74502491
|
A | T | intron_variant | MODIFIER | HG02258.hp2 HG02723.hp2 HG02809.hp1 others(10): Show |
a0001a0008 | a0001c0003a0001c0005a0008c0012 | a0001c0003t0002a0001c0003t0006a0001c0003t0007others(3): Show | a0001c0003t0002g0192a0001c0003t0002g0193a0001c0003t0002g0194others(8): Show | 13 | 424 | 0.0307 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.204+1019A>T | ||||||
|
chr18:74502771
|
A | G | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(159): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0003a0001c0005others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0005others(37): Show | a0001c0001t0001g0196a0001c0001t0002g0025a0001c0001t0002g0026others(128): Show | 162 | 424 | 0.3821 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.204+1299A>G | ||||||
|
chr18:74503073
|
G | GTTTT | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(109): Show |
a0001a0002a0007others(1): Show | a0001c0001a0001c0003a0001c0005others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0009others(23): Show | a0001c0001t0001g0196a0001c0001t0002g0169a0001c0001t0002g0172others(87): Show | 112 | 424 | 0.2642 | 4 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.204+1611_204+1614dupTTTT | INFO_REALIGN_3_PRIME | |||||
|
chr18:74503162
|
G | A | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(159): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0003a0001c0005others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0005others(37): Show | a0001c0001t0001g0196a0001c0001t0002g0025a0001c0001t0002g0026others(128): Show | 162 | 424 | 0.3821 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.204+1690G>A | ||||||
|
chr18:74503904
|
A | ACACACGC others(47): Show |
intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(355): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0003a0001c0005others(15): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(63): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(256): Show | 358 | 424 | 0.8443 | 54 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.205-1912_205-1911insTGGGCGTCAGGCCATACACTGCACACGCAGCCACACTGCCGCTGGGACAAATGA | INFO_REALIGN_3_PRIME | |||||
|
chr18:74504071
|
C | T | intron_variant | MODIFIER | HG02258.hp2 HG02723.hp2 HG02809.hp1 others(10): Show |
a0001a0008 | a0001c0003a0001c0005a0008c0012 | a0001c0003t0002a0001c0003t0006a0001c0003t0007others(3): Show | a0001c0003t0002g0192a0001c0003t0002g0193a0001c0003t0002g0194others(8): Show | 13 | 424 | 0.0307 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.205-1778C>T | ||||||
|
chr18:74505564
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(414): Show |
a0001a0002a0003others(8): Show | a0001c0001a0001c0003a0001c0005others(17): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(73): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(305): Show | 417 | 424 | 0.9835 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.205-285G>A | ||||||
|
chr18:74505598
|
CA | C | intron_variant | MODIFIER | HG01175.hp1 HG01243.hp1 HG01257.hp1 others(61): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0003a0001c0016others(5): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004others(18): Show | a0001c0001t0001g0057a0001c0001t0001g0257a0001c0001t0001g0261others(48): Show | 64 | 424 | 0.1509 | -1 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.205-233delA | INFO_REALIGN_3_PRIME | |||||
|
chr18:74507221
|
C | T | intron_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00642.hp2 others(17): Show |
a0001 | a0001c0001a0001c0003 | a0001c0001t0001a0001c0001t0003a0001c0001t0016others(3): Show | a0001c0001t0001g0156a0001c0001t0001g0158a0001c0001t0001g0179others(14): Show | 20 | 424 | 0.0472 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 4/11 | c.367+1210C>T | ||||||
|
chr18:74507917
|
A | G | intron_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00323.hp1 others(157): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0003a0001c0005others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(37): Show | a0001c0001t0001g0156a0001c0001t0001g0158a0001c0001t0001g0179others(126): Show | 160 | 424 | 0.3774 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 4/11 | c.368-923A>G | ||||||
|
chr18:74507935
|
A | G | intron_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00639.hp2 others(30): Show |
a0001a0008 | a0001c0001a0001c0003a0001c0005others(2): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0010others(9): Show | a0001c0001t0001g0156a0001c0001t0001g0158a0001c0001t0001g0179others(26): Show | 33 | 424 | 0.0778 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 4/11 | c.368-905A>G | ||||||
|
chr18:74509632
|
CA | C | intron_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00323.hp1 others(124): Show |
a0001a0002a0007others(1): Show | a0001c0001a0001c0003a0001c0005others(7): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0009others(27): Show | a0001c0001t0001g0156a0001c0001t0001g0158a0001c0001t0001g0179others(100): Show | 127 | 424 | 0.2995 | -1 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 5/11 | c.456+719delA | INFO_REALIGN_3_PRIME | |||||
|
chr18:74510230
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(268): Show |
a0001a0003a0004others(5): Show | a0001c0001a0001c0003a0001c0005others(10): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(46): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(187): Show | 271 | 424 | 0.6392 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 5/11 | c.457-583A>G | ||||||
|
chr18:74511175
|
C | T | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(390): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0003a0001c0005others(15): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(68): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(285): Show | 393 | 424 | 0.9269 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 6/11 | c.657+162C>T | ||||||
|
chr18:74513306
|
G | A | intron_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00639.hp2 others(24): Show |
a0001 | a0001c0001a0001c0003a0001c0005others(1): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0010others(7): Show | a0001c0001t0001g0156a0001c0001t0001g0158a0001c0001t0001g0179others(20): Show | 27 | 424 | 0.0637 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 7/11 | c.743-253G>A | ||||||
|
chr18:74514572
|
C | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(99): Show |
a0001a0011 | a0001c0001a0001c0003a0001c0005others(2): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0008others(18): Show | a0001c0001t0001g0001a0001c0001t0001g0004a0001c0001t0001g0017others(70): Show | 102 | 424 | 0.2406 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 8/11 | c.903+853C>G | ||||||
|
chr18:74514577
|
G | A | intron_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00639.hp2 others(25): Show |
a0001 | a0001c0001a0001c0003a0001c0005others(1): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0008others(8): Show | a0001c0001t0001g0156a0001c0001t0001g0158a0001c0001t0001g0179others(21): Show | 28 | 424 | 0.0660 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 8/11 | c.903+858G>A | ||||||
|
chr18:74514580
|
C | G | intron_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00639.hp2 others(25): Show |
a0001 | a0001c0001a0001c0003a0001c0005others(1): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0008others(8): Show | a0001c0001t0001g0156a0001c0001t0001g0158a0001c0001t0001g0179others(21): Show | 28 | 424 | 0.0660 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 8/11 | c.903+861C>G | ||||||
|
chr18:74514584
|
C | T | intron_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00639.hp2 others(25): Show |
a0001 | a0001c0001a0001c0003a0001c0005others(1): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0008others(8): Show | a0001c0001t0001g0156a0001c0001t0001g0158a0001c0001t0001g0179others(21): Show | 28 | 424 | 0.0660 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 8/11 | c.903+865C>T | ||||||
|
chr18:74514591
|
C | T | intron_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00639.hp2 others(25): Show |
a0001 | a0001c0001a0001c0003a0001c0005others(1): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0008others(8): Show | a0001c0001t0001g0156a0001c0001t0001g0158a0001c0001t0001g0179others(21): Show | 28 | 424 | 0.0660 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 8/11 | c.903+872C>T | ||||||
|
chr18:74514593
|
T | G | intron_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00639.hp2 others(25): Show |
a0001 | a0001c0001a0001c0003a0001c0005others(1): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0008others(8): Show | a0001c0001t0001g0156a0001c0001t0001g0158a0001c0001t0001g0179others(21): Show | 28 | 424 | 0.0660 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 8/11 | c.903+874T>G | ||||||
|
chr18:74514629
|
G | GGATGTAA others(30): Show |
intron_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00639.hp2 others(25): Show |
a0001 | a0001c0001a0001c0003a0001c0005others(1): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0008others(8): Show | a0001c0001t0001g0156a0001c0001t0001g0158a0001c0001t0001g0179others(21): Show | 28 | 424 | 0.0660 | 37 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 8/11 | c.903+921_903+922insCGCAGGCTGTGGGTTTATGCGGTACAGATGTAAGTTC | INFO_REALIGN_3_PRIME | |||||
|
chr18:74514649
|
G | A | intron_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00639.hp2 others(25): Show |
a0001 | a0001c0001a0001c0003a0001c0005others(1): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0008others(8): Show | a0001c0001t0001g0156a0001c0001t0001g0158a0001c0001t0001g0179others(21): Show | 28 | 424 | 0.0660 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 8/11 | c.903+930G>A | ||||||
|
chr18:74514654
|
G | T | intron_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00639.hp2 others(25): Show |
a0001 | a0001c0001a0001c0003a0001c0005others(1): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0008others(8): Show | a0001c0001t0001g0156a0001c0001t0001g0158a0001c0001t0001g0179others(21): Show | 28 | 424 | 0.0660 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 8/11 | c.903+935G>T | ||||||
|
chr18:74516460
|
T | A | intron_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00323.hp1 others(145): Show |
a0001a0002a0003others(1): Show | a0001c0001a0001c0003a0001c0005others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(35): Show | a0001c0001t0001g0039a0001c0001t0001g0156a0001c0001t0001g0158others(114): Show | 148 | 424 | 0.3491 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 9/11 | c.1068+68T>A | ||||||
|
chr18:74516623
|
CCTCA | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(367): Show |
a0001a0002a0003others(6): Show | a0001c0001a0001c0003a0001c0005others(14): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(66): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(265): Show | 370 | 424 | 0.8726 | -4 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 9/11 | c.1068+237_1068+240delTCAC | INFO_REALIGN_3_PRIME | |||||
|
chr18:74516972
|
A | ACAGACGC others(14): Show |
intron_variant | MODIFIER | HG03471.hp2 | a0001 | a0001c0003 | a0001c0003t0002 | a0001c0003t0002g0193 | 1 | 424 | 0.0024 | 21 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 9/11 | c.1068+589_1068+609dupGTAGCTTACGTGGCAGACGCG | INFO_REALIGN_3_PRIME | |||||
|
chr18:74517002
|
A | G | intron_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00544.hp1 others(158): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0003a0001c0005others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(37): Show | a0001c0001t0001g0039a0001c0001t0001g0042a0001c0001t0001g0156others(124): Show | 161 | 424 | 0.3797 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 9/11 | c.1068+610A>G | ||||||
|
chr18:74518003
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(397): Show |
a0001a0002a0003others(8): Show | a0001c0001a0001c0003a0001c0009others(15): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(67): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(289): Show | 400 | 424 | 0.9434 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 9/11 | c.1069-496G>A | ||||||
|
chr18:74518128
|
G | A | intron_variant | MODIFIER | HG03471.hp2 NA18612.hp2 |
a0001a0002 | a0001c0003a0002c0002 | a0001c0003t0002a0002c0002t0002 | a0001c0003t0002g0193a0002c0002t0002g0111 | 2 | 424 | 0.0047 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 9/11 | c.1069-371G>A | ||||||
|
chr18:74518737
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(371): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0003a0001c0005others(14): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(58): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(267): Show | 374 | 424 | 0.8821 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 10/11 | c.1210+97G>A | ||||||
|
chr18:74518824
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(408): Show |
a0001a0002a0003others(8): Show | a0001c0001a0001c0003a0001c0005others(17): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(71): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(302): Show | 411 | 424 | 0.9693 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 10/11 | c.1211-125G>A | ||||||
|
chr18:74518940
|
T | TC | splice_acceptor_variant others(1): Show |
HIGH | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(352): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0003a0001c0005others(16): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0005others(56): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(255): Show | 355 | 424 | 0.8373 | 1 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 10/11 | c.1211-3dupC | INFO_REALIGN_3_PRIME | |||||
|
chr18:74519169
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(278): Show |
a0001a0002a0004others(5): Show | a0001c0001a0001c0003a0001c0009others(11): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0005others(37): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(193): Show | 281 | 424 | 0.6627 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 11/11 | c.1358+73G>A |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
ahapid | alen | total | AFR | AMR | EAS | EUR | SAS | aseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CNDP2 | 1/1 | a0001 | 475 | 313 | 82 | 56 | 124 | 16 | 33 | subcellular location copy fasta | chr18 | 74491363 | 74528454 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
chapid | clen | total | AFR | AMR | EAS | EUR | SAS | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CNDP2 | 0/0 | c0003 | 1428 | 19 | 15 | 1 | 1 | 0 | 2 | copy fasta | chr18 | 74491363 | 74528454 |
| genename | grch38/chm13v2 | thapid | tlen | total | AFR | AMR | EAS | EUR | SAS | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CNDP2 | 0/0 | t0002 | 3547 | 103 | 24 | 21 | 45 | 1 | 12 | copy fasta | chr18 | 74491363 | 74528454 |
| genename | grch38/chm13v2 | ghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| CNDP2 | 0/0 | g0193 | 1 | 1 | 0 | 0 | 0 | 0 | chr18 | 74491363 | 74528454 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
achapid | total | AFR | AMR | EAS | EUR | SAS | clen | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CNDP2 | 0/0 | a0001c0003 | 19 | 15 | 1 | 1 | 0 | 2 | 1428 | copy fasta | chr18 | 74491363 | 74528454 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
acthapid | total | AFR | AMR | EAS | EUR | SAS | tlen | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CNDP2 | 0/0 | a0001c0003t0002 | 8 | 6 | 0 | 1 | 0 | 1 | 4974 | copy fasta | chr18 | 74491363 | 74528454 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
actghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| CNDP2 | 0/0 | a0001c0003t0002g0193 | 1 | 1 | 0 | 0 | 0 | 0 | chr18 | 74491363 | 74528454 |
Click to load Haplotype QTL data...
| pos | S. Strand |
E# Exon Number |
max | median | min | diff | type | haplotypeid | max_hap_list | min_hap_list | symbol | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 74496431 | + | 1 | -0.5558 | -0.5558 | -0.5558 | 0.0000 | acceptor | a0001c0003t0002g0193 | HG03471.hp2 | HG03471.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74499882 | + | 2 | 0.9677 | 0.9677 | 0.9677 | 0.0000 | donor | a0001c0003t0002g0193 | HG03471.hp2 | HG03471.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74500033 | + | 2 | -0.9658 | -0.9658 | -0.9658 | 0.0000 | acceptor | a0001c0003t0002g0193 | HG03471.hp2 | HG03471.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74501329 | + | 3 | 0.8729 | 0.8729 | 0.8729 | 0.0000 | donor | a0001c0003t0002g0193 | HG03471.hp2 | HG03471.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74501472 | + | 3 | -0.9479 | -0.9479 | -0.9479 | 0.0000 | acceptor | a0001c0003t0002g0193 | HG03471.hp2 | HG03471.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74505849 | + | 4 | 0.9563 | 0.9563 | 0.9563 | 0.0000 | donor | a0001c0003t0002g0193 | HG03471.hp2 | HG03471.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74506011 | + | 4 | -0.9890 | -0.9890 | -0.9890 | 0.0000 | acceptor | a0001c0003t0002g0193 | HG03471.hp2 | HG03471.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74508840 | + | 5 | 0.9273 | 0.9273 | 0.9273 | 0.0000 | donor | a0001c0003t0002g0193 | HG03471.hp2 | HG03471.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74508928 | + | 5 | -0.9673 | -0.9673 | -0.9673 | 0.0000 | acceptor | a0001c0003t0002g0193 | HG03471.hp2 | HG03471.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74510813 | + | 6 | 0.9942 | 0.9941 | 0.9942 | 0.0000 | donor | a0001c0003t0002g0193 | HG03471.hp2 | HG03471.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74511013 | + | 6 | -0.9962 | -0.9962 | -0.9962 | 0.0000 | acceptor | a0001c0003t0002g0193 | HG03471.hp2 | HG03471.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74512448 | + | 7 | 0.9906 | 0.9906 | 0.9906 | 0.0000 | donor | a0001c0003t0002g0193 | HG03471.hp2 | HG03471.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74512532 | + | 7 | -0.9947 | -0.9947 | -0.9947 | 0.0000 | acceptor | a0001c0003t0002g0193 | HG03471.hp2 | HG03471.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74513559 | + | 8 | 0.9958 | 0.9958 | 0.9958 | 0.0000 | donor | a0001c0003t0002g0193 | HG03471.hp2 | HG03471.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74513719 | + | 8 | -0.9931 | -0.9931 | -0.9931 | 0.0000 | acceptor | a0001c0003t0002g0193 | HG03471.hp2 | HG03471.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74516228 | + | 9 | 0.9950 | 0.9950 | 0.9950 | 0.0000 | donor | a0001c0003t0002g0193 | HG03471.hp2 | HG03471.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74516392 | + | 9 | -0.9581 | -0.9581 | -0.9581 | 0.0000 | acceptor | a0001c0003t0002g0193 | HG03471.hp2 | HG03471.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74518499 | + | 10 | 0.9062 | 0.9062 | 0.9062 | 0.0000 | donor | a0001c0003t0002g0193 | HG03471.hp2 | HG03471.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74518640 | + | 10 | -0.9364 | -0.9364 | -0.9364 | 0.0000 | acceptor | a0001c0003t0002g0193 | HG03471.hp2 | HG03471.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74518949 | + | 11 | 0.9950 | 0.9950 | 0.9950 | 0.0000 | donor | a0001c0003t0002g0193 | HG03471.hp2 | HG03471.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74519096 | + | 11 | -0.9978 | -0.9978 | -0.9978 | 0.0000 | acceptor | a0001c0003t0002g0193 | HG03471.hp2 | HG03471.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74519999 | + | 12 | 0.7652 | 0.7652 | 0.7652 | 0.0000 | donor | a0001c0003t0002g0193 | HG03471.hp2 | HG03471.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| pos | annotationhgvs_chgvs_p | clinvarid | clnsig | geneinfo | mc | clndisdb | strand strand
|
ahapid ahapid_count
|
chapid chapid count
|
thapid thapid_count
|
ghapid ghapid_count
|
AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
impact | chr | ref | alt | external |
|---|
| CHR:POS | annotationhgvs_chgvs_p | disease trait-log10podds or beta | AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
study | initial sample size/replication sample size | report genes | mapped gene | strongest snp risk allele | strand strand
|
impact | chr | ref | alt |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr18:74511175
|
c.657+162C>T | Height | a0001a0002a0003a0004a0005others(5): Show | a0001c0001a0001c0003a0001c0005a0001c0009a0001c0016others(13): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(66): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004a0001c0001t0001g0005a0001c0001t0001g0007others(283): Show | HG00099.hp1 HG00099.hp2 HG00140.hp1 HG00140.hp2 HG00280.hp1 others(388): Show |
Leveraging Polygenic Functional Enrichment to Impr others(15): Show |
approximately 458,000 European ancestry individual others(2): Show |
CNDP2 | rs8088885-? | + | MODIFIER | chr18 | C | T | |
|
chr18:74510230
|
c.457-583A>G | Spherical equivalent0.0844 | a0001a0003a0004a0005a0006others(3): Show | a0001c0001a0001c0003a0001c0005a0001c0009a0001c0016others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(44): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004a0001c0001t0001g0005a0001c0001t0001g0007others(185): Show | HG00099.hp1 HG00099.hp2 HG00140.hp1 HG00140.hp2 HG00280.hp1 others(266): Show |
Genome-wide association meta-analysis highlights l others(56): Show |
41,073 European ancestry individuals, 2,610 Erasmu others(243): Show |
NR | CNDP2 | rs8084058-A | + | MODIFIER | chr18 | A | G |
|
chr18:74510230
|
c.457-583A>G | Beta-Ala-His dipeptidase levels0.12 | a0001a0003a0004a0005a0006others(3): Show | a0001c0001a0001c0003a0001c0005a0001c0009a0001c0016others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(44): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004a0001c0001t0001g0005a0001c0001t0001g0007others(185): Show | HG00099.hp1 HG00099.hp2 HG00140.hp1 HG00140.hp2 HG00280.hp1 others(266): Show |
Mapping the proteo-genomic convergence of human di others(7): Show |
10,708 European ancestry individuals/ | CNDP2 | rs8084058-A | + | MODIFIER | chr18 | A | G | |
|
chr18:74513306
|
c.743-253G>A | Height0.0053 | a0001 | a0001c0001a0001c0003a0001c0005a0001c0017 | a0001c0001t0001a0001c0001t0003a0001c0001t0010a0001c0001t0016a0001c0001t0029others(5): Show | a0001c0001t0001g0156a0001c0001t0001g0158a0001c0001t0001g0179a0001c0001t0001g0282a0001c0001t0003g0013others(18): Show | HG00099.hp2 HG00280.hp2 HG00639.hp2 HG00642.hp2 HG00735.hp2 others(22): Show |
A saturated map of common genetic variants associa others(22): Show |
5,314,291 European ancestry, Hispanic or Latin Ame others(79): Show |
CNDP2 | rs17816304-A | + | MODIFIER | chr18 | G | A | |
|
chr18:74510230
|
c.457-583A>G | N-acetylserine levels0.057304062 | a0001a0003a0004a0005a0006others(3): Show | a0001c0001a0001c0003a0001c0005a0001c0009a0001c0016others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(44): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004a0001c0001t0001g0005a0001c0001t0001g0007others(185): Show | HG00099.hp1 HG00099.hp2 HG00140.hp1 HG00140.hp2 HG00280.hp1 others(266): Show |
Rare and common genetic determinants of metabolic others(48): Show |
14,296 European ancestry individuals/5,698 Europea others(22): Show |
CNDP2 | rs8084058-A | + | MODIFIER | chr18 | A | G | |
|
chr18:74510230
|
c.457-583A>G | N-formylmethionine levels0.055290055 | a0001a0003a0004a0005a0006others(3): Show | a0001c0001a0001c0003a0001c0005a0001c0009a0001c0016others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(44): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004a0001c0001t0001g0005a0001c0001t0001g0007others(185): Show | HG00099.hp1 HG00099.hp2 HG00140.hp1 HG00140.hp2 HG00280.hp1 others(266): Show |
Rare and common genetic determinants of metabolic others(48): Show |
14,296 European ancestry individuals/5,698 Europea others(22): Show |
CNDP2 | rs8084058-A | + | MODIFIER | chr18 | A | G | |
|
chr18:74501373
|
c.105G>Ap.Pro35Pro | Valylleucine levels (advanced age)0.2368 | a0001a0002a0006a0007a0008 | a0001c0003a0001c0005a0002c0002a0002c0007a0006c0013others(2): Show | a0001c0003t0002a0001c0003t0006a0001c0003t0007a0001c0003t0009a0001c0003t0021others(20): Show | a0001c0003t0002g0036a0001c0003t0002g0116a0001c0003t0002g0122a0001c0003t0002g0151a0001c0003t0002g0192others(88): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00735.hp1 others(110): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
116 Han Chinese ancestry individuals/ | CNDP2 | rs2303463-? | + | LOW | chr18 | G | A | |
|
chr18:74499889
|
c.-85C>G | Valylleucine levels (advanced age)0.2368 | a0001a0002a0003a0006a0007others(1): Show | a0001c0001a0001c0003a0001c0005a0001c0016a0001c0017others(7): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006a0001c0001t0007a0001c0001t0009others(34): Show | a0001c0001t0002g0025a0001c0001t0002g0026a0001c0001t0002g0037a0001c0001t0002g0038a0001c0001t0002g0063others(125): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00639.hp2 others(156): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
116 Han Chinese ancestry individuals/ | CNDP2 | rs3764509-? | + | MODIFIER | chr18 | C | G | |
|
chr18:74501373
|
c.105G>Ap.Pro35Pro | Gamma-glutamyl-2-aminobutyrate levels (advanced age)others(18): Show | a0001a0002a0006a0007a0008 | a0001c0003a0001c0005a0002c0002a0002c0007a0006c0013others(2): Show | a0001c0003t0002a0001c0003t0006a0001c0003t0007a0001c0003t0009a0001c0003t0021others(20): Show | a0001c0003t0002g0036a0001c0003t0002g0116a0001c0003t0002g0122a0001c0003t0002g0151a0001c0003t0002g0192others(88): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00735.hp1 others(110): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
116 Han Chinese ancestry individuals/ | CNDP2 | rs2303463-? | + | LOW | chr18 | G | A | |
|
chr18:74499889
|
c.-85C>G | Gamma-glutamyl-2-aminobutyrate levels (advanced age)others(18): Show | a0001a0002a0003a0006a0007others(1): Show | a0001c0001a0001c0003a0001c0005a0001c0016a0001c0017others(7): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006a0001c0001t0007a0001c0001t0009others(34): Show | a0001c0001t0002g0025a0001c0001t0002g0026a0001c0001t0002g0037a0001c0001t0002g0038a0001c0001t0002g0063others(125): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00639.hp2 others(156): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
116 Han Chinese ancestry individuals/ | CNDP2 | rs3764509-? | + | MODIFIER | chr18 | C | G | |
|
chr18:74516460
|
c.1068+68T>A |
Leucylglycine levels (advanced age)0.177 others(1): Show |
a0001a0002a0003a0007 | a0001c0001a0001c0003a0001c0005a0001c0016a0001c0017others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0005a0001c0001t0006others(33): Show | a0001c0001t0001g0039a0001c0001t0001g0156a0001c0001t0001g0158a0001c0001t0001g0179a0001c0001t0001g0282others(112): Show | HG00099.hp2 HG00280.hp2 HG00323.hp1 HG00544.hp1 HG00597.hp2 others(143): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
116 Han Chinese ancestry individuals/ | CNDP2 | rs2241509-? | + | MODIFIER | chr18 | T | A | |
|
chr18:74501373
|
c.105G>Ap.Pro35Pro |
Leucylglycine levels (advanced age)0.177 others(1): Show |
a0001a0002a0006a0007a0008 | a0001c0003a0001c0005a0002c0002a0002c0007a0006c0013others(2): Show | a0001c0003t0002a0001c0003t0006a0001c0003t0007a0001c0003t0009a0001c0003t0021others(20): Show | a0001c0003t0002g0036a0001c0003t0002g0116a0001c0003t0002g0122a0001c0003t0002g0151a0001c0003t0002g0192others(88): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00735.hp1 others(110): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
116 Han Chinese ancestry individuals/ | CNDP2 | rs2303463-? | + | LOW | chr18 | G | A | |
|
chr18:74499889
|
c.-85C>G |
Leucylglycine levels (advanced age)0.177 others(1): Show |
a0001a0002a0003a0006a0007others(1): Show | a0001c0001a0001c0003a0001c0005a0001c0016a0001c0017others(7): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006a0001c0001t0007a0001c0001t0009others(34): Show | a0001c0001t0002g0025a0001c0001t0002g0026a0001c0001t0002g0037a0001c0001t0002g0038a0001c0001t0002g0063others(125): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00639.hp2 others(156): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
116 Han Chinese ancestry individuals/ | CNDP2 | rs3764509-? | + | MODIFIER | chr18 | C | G | |
|
chr18:74516460
|
c.1068+68T>A | Valylglycine levels (advanced age)0.1752 | a0001a0002a0003a0007 | a0001c0001a0001c0003a0001c0005a0001c0016a0001c0017others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0005a0001c0001t0006others(33): Show | a0001c0001t0001g0039a0001c0001t0001g0156a0001c0001t0001g0158a0001c0001t0001g0179a0001c0001t0001g0282others(112): Show | HG00099.hp2 HG00280.hp2 HG00323.hp1 HG00544.hp1 HG00597.hp2 others(143): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
116 Han Chinese ancestry individuals/ | CNDP2 | rs2241509-? | + | MODIFIER | chr18 | T | A | |
|
chr18:74501373
|
c.105G>Ap.Pro35Pro | Valylglycine levels (advanced age)0.1885 | a0001a0002a0006a0007a0008 | a0001c0003a0001c0005a0002c0002a0002c0007a0006c0013others(2): Show | a0001c0003t0002a0001c0003t0006a0001c0003t0007a0001c0003t0009a0001c0003t0021others(20): Show | a0001c0003t0002g0036a0001c0003t0002g0116a0001c0003t0002g0122a0001c0003t0002g0151a0001c0003t0002g0192others(88): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00735.hp1 others(110): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
116 Han Chinese ancestry individuals/ | CNDP2 | rs2303463-? | + | LOW | chr18 | G | A | |
|
chr18:74499889
|
c.-85C>G | Valylglycine levels (advanced age)0.1885 | a0001a0002a0003a0006a0007others(1): Show | a0001c0001a0001c0003a0001c0005a0001c0016a0001c0017others(7): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006a0001c0001t0007a0001c0001t0009others(34): Show | a0001c0001t0002g0025a0001c0001t0002g0026a0001c0001t0002g0037a0001c0001t0002g0038a0001c0001t0002g0063others(125): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00639.hp2 others(156): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
116 Han Chinese ancestry individuals/ | CNDP2 | rs3764509-? | + | MODIFIER | chr18 | C | G | |
|
chr18:74516460
|
c.1068+68T>A | Valylleucine levels (advanced age)0.2353 | a0001a0002a0003a0007 | a0001c0001a0001c0003a0001c0005a0001c0016a0001c0017others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0005a0001c0001t0006others(33): Show | a0001c0001t0001g0039a0001c0001t0001g0156a0001c0001t0001g0158a0001c0001t0001g0179a0001c0001t0001g0282others(112): Show | HG00099.hp2 HG00280.hp2 HG00323.hp1 HG00544.hp1 HG00597.hp2 others(143): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
116 Han Chinese ancestry individuals/ | CNDP2 | rs2241509-? | + | MODIFIER | chr18 | T | A | |
|
chr18:74501373
|
c.105G>Ap.Pro35Pro | Gamma-glutamyl-2-aminobutyrate levels (elderly offspring)others(23): Show | a0001a0002a0006a0007a0008 | a0001c0003a0001c0005a0002c0002a0002c0007a0006c0013others(2): Show | a0001c0003t0002a0001c0003t0006a0001c0003t0007a0001c0003t0009a0001c0003t0021others(20): Show | a0001c0003t0002g0036a0001c0003t0002g0116a0001c0003t0002g0122a0001c0003t0002g0151a0001c0003t0002g0192others(88): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00735.hp1 others(110): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
232 Han Chinese ancestry individuals/ | CNDP2 | rs2303463-? | + | LOW | chr18 | G | A | |
|
chr18:74499889
|
c.-85C>G | Gamma-glutamyl-2-aminobutyrate levels (elderly offspring)others(23): Show | a0001a0002a0003a0006a0007others(1): Show | a0001c0001a0001c0003a0001c0005a0001c0016a0001c0017others(7): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006a0001c0001t0007a0001c0001t0009others(34): Show | a0001c0001t0002g0025a0001c0001t0002g0026a0001c0001t0002g0037a0001c0001t0002g0038a0001c0001t0002g0063others(125): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00639.hp2 others(156): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
232 Han Chinese ancestry individuals/ | CNDP2 | rs3764509-? | + | MODIFIER | chr18 | C | G | |
|
chr18:74516460
|
c.1068+68T>A |
Leucylglycine levels (elderly offspring) others(6): Show |
a0001a0002a0003a0007 | a0001c0001a0001c0003a0001c0005a0001c0016a0001c0017others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0005a0001c0001t0006others(33): Show | a0001c0001t0001g0039a0001c0001t0001g0156a0001c0001t0001g0158a0001c0001t0001g0179a0001c0001t0001g0282others(112): Show | HG00099.hp2 HG00280.hp2 HG00323.hp1 HG00544.hp1 HG00597.hp2 others(143): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
232 Han Chinese ancestry individuals/ | CNDP2 | rs2241509-? | + | MODIFIER | chr18 | T | A | |
|
chr18:74501373
|
c.105G>Ap.Pro35Pro |
Leucylglycine levels (elderly offspring) others(6): Show |
a0001a0002a0006a0007a0008 | a0001c0003a0001c0005a0002c0002a0002c0007a0006c0013others(2): Show | a0001c0003t0002a0001c0003t0006a0001c0003t0007a0001c0003t0009a0001c0003t0021others(20): Show | a0001c0003t0002g0036a0001c0003t0002g0116a0001c0003t0002g0122a0001c0003t0002g0151a0001c0003t0002g0192others(88): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00735.hp1 others(110): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
232 Han Chinese ancestry individuals/ | CNDP2 | rs2303463-? | + | LOW | chr18 | G | A | |
|
chr18:74499889
|
c.-85C>G |
Leucylglycine levels (elderly offspring) others(6): Show |
a0001a0002a0003a0006a0007others(1): Show | a0001c0001a0001c0003a0001c0005a0001c0016a0001c0017others(7): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006a0001c0001t0007a0001c0001t0009others(34): Show | a0001c0001t0002g0025a0001c0001t0002g0026a0001c0001t0002g0037a0001c0001t0002g0038a0001c0001t0002g0063others(125): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00639.hp2 others(156): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
232 Han Chinese ancestry individuals/ | CNDP2 | rs3764509-? | + | MODIFIER | chr18 | C | G | |
|
chr18:74516460
|
c.1068+68T>A |
Valylglycine levels (elderly offspring)0 others(4): Show |
a0001a0002a0003a0007 | a0001c0001a0001c0003a0001c0005a0001c0016a0001c0017others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0005a0001c0001t0006others(33): Show | a0001c0001t0001g0039a0001c0001t0001g0156a0001c0001t0001g0158a0001c0001t0001g0179a0001c0001t0001g0282others(112): Show | HG00099.hp2 HG00280.hp2 HG00323.hp1 HG00544.hp1 HG00597.hp2 others(143): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
232 Han Chinese ancestry individuals/ | CNDP2 | rs2241509-? | + | MODIFIER | chr18 | T | A | |
|
chr18:74501373
|
c.105G>Ap.Pro35Pro |
Valylglycine levels (elderly offspring)0 others(4): Show |
a0001a0002a0006a0007a0008 | a0001c0003a0001c0005a0002c0002a0002c0007a0006c0013others(2): Show | a0001c0003t0002a0001c0003t0006a0001c0003t0007a0001c0003t0009a0001c0003t0021others(20): Show | a0001c0003t0002g0036a0001c0003t0002g0116a0001c0003t0002g0122a0001c0003t0002g0151a0001c0003t0002g0192others(88): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00735.hp1 others(110): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
232 Han Chinese ancestry individuals/ | CNDP2 | rs2303463-? | + | LOW | chr18 | G | A | |
|
chr18:74499889
|
c.-85C>G |
Valylglycine levels (elderly offspring)0 others(4): Show |
a0001a0002a0003a0006a0007others(1): Show | a0001c0001a0001c0003a0001c0005a0001c0016a0001c0017others(7): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006a0001c0001t0007a0001c0001t0009others(34): Show | a0001c0001t0002g0025a0001c0001t0002g0026a0001c0001t0002g0037a0001c0001t0002g0038a0001c0001t0002g0063others(125): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00639.hp2 others(156): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
232 Han Chinese ancestry individuals/ | CNDP2 | rs3764509-? | + | MODIFIER | chr18 | C | G | |
|
chr18:74516460
|
c.1068+68T>A |
Valylleucine levels (elderly offspring)0 others(5): Show |
a0001a0002a0003a0007 | a0001c0001a0001c0003a0001c0005a0001c0016a0001c0017others(6): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0005a0001c0001t0006others(33): Show | a0001c0001t0001g0039a0001c0001t0001g0156a0001c0001t0001g0158a0001c0001t0001g0179a0001c0001t0001g0282others(112): Show | HG00099.hp2 HG00280.hp2 HG00323.hp1 HG00544.hp1 HG00597.hp2 others(143): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
232 Han Chinese ancestry individuals/ | CNDP2 | rs2241509-? | + | MODIFIER | chr18 | T | A | |
|
chr18:74501373
|
c.105G>Ap.Pro35Pro |
Valylleucine levels (elderly offspring)0 others(5): Show |
a0001a0002a0006a0007a0008 | a0001c0003a0001c0005a0002c0002a0002c0007a0006c0013others(2): Show | a0001c0003t0002a0001c0003t0006a0001c0003t0007a0001c0003t0009a0001c0003t0021others(20): Show | a0001c0003t0002g0036a0001c0003t0002g0116a0001c0003t0002g0122a0001c0003t0002g0151a0001c0003t0002g0192others(88): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00735.hp1 others(110): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
232 Han Chinese ancestry individuals/ | CNDP2 | rs2303463-? | + | LOW | chr18 | G | A | |
|
chr18:74499889
|
c.-85C>G |
Valylleucine levels (elderly offspring)0 others(5): Show |
a0001a0002a0003a0006a0007others(1): Show | a0001c0001a0001c0003a0001c0005a0001c0016a0001c0017others(7): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006a0001c0001t0007a0001c0001t0009others(34): Show | a0001c0001t0002g0025a0001c0001t0002g0026a0001c0001t0002g0037a0001c0001t0002g0038a0001c0001t0002g0063others(125): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00639.hp2 others(156): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
232 Han Chinese ancestry individuals/ | CNDP2 | rs3764509-? | + | MODIFIER | chr18 | C | G |