| geneid | 55748 |
|---|---|
| ensemblid | ENSG00000133313.15 |
| hgncid | 24437 |
| symbol | CNDP2 |
| name | carnosine dipeptidase 2 |
| refseq_nuc | NM_018235.3 |
| refseq_prot | NP_060705.2 |
| ensembl_nuc | ENST00000324262.9 |
| ensembl_prot | ENSP00000325548.4 |
| mane_status | MANE Select |
| chr | chr18 |
| start | 74496363 |
| end | 74523454 |
| strand | + |
| ver | v1.2 |
| region | chr18:74496363-74523454 |
| region5000 | chr18:74491363-74528454 |
| regionname0 | CNDP2_chr18_74496363_74523454 |
| regionname5000 | CNDP2_chr18_74491363_74528454 |
| chr:pos | ref | alt | af | annotation | impact | samples | AHAPIDS | ACHAPIDS | ACTHAPIDS | ACTGHAPIDS | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr18:74501373
|
G | A | 0.2712 | synonymous_variant | LOW | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(112): Show |
a0001a0002a0006others(2): Show | a0001c0003a0001c0005a0002c0002others(4): Show | a0001c0003t0002a0001c0003t0006a0001c0003t0007others(22): Show | a0001c0003t0002g0036a0001c0003t0002g0116a0001c0003t0002g0122others(90): Show | 115 | 424 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/12 | c.105G>A | p.Pro35Pro | 266/4975 | 105/1428 | 35/475 |
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr18:74499889
|
C | G | 0.3797 | 5_prime_UTR_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(158): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0003a0001c0005others(9): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006others(36): Show | a0001c0001t0002g0025a0001c0001t0002g0026a0001c0001t0002g0037others(127): Show | 161 | 424 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 2/12 | c.-85C>G | 85 | |||||
|
chr18:74520377
|
C | T | 0.8797 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(370): Show |
a0001a0002a0004others(6): Show | a0001c0001a0001c0003a0001c0005others(14): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(54): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(269): Show | 373 | 424 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 12/12 | c.*309C>T | 309 | |||||
|
chr18:74521017
|
A | G | 0.9127 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(384): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0003a0001c0005others(16): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(63): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(283): Show | 387 | 424 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 12/12 | c.*949A>G | 949 | |||||
|
chr18:74521136
|
A | G | 0.9127 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(384): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0003a0001c0005others(16): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(63): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(283): Show | 387 | 424 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 12/12 | c.*1068A>G | 1068 | |||||
|
chr18:74521145
|
G | A | 0.0425 | 3_prime_UTR_variant | MODIFIER | HG01074.hp1 HG01891.hp2 HG01981.hp1 others(15): Show |
a0001a0002a0008 | a0001c0001a0001c0003a0002c0002others(1): Show | a0001c0001t0007a0001c0001t0008a0001c0001t0017others(4): Show | a0001c0001t0007g0076a0001c0001t0008g0174a0001c0001t0008g0239others(15): Show | 18 | 424 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 12/12 | c.*1077G>A | 1077 | |||||
|
chr18:74521339
|
TA | T | 0.9127 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(384): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0003a0001c0005others(16): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(63): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(283): Show | 387 | 424 | -1 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 12/12 | c.*1273delA | 1273 | INFO_REALIGN_3_PRIME | ||||
|
chr18:74522015
|
C | A | 0.9080 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(382): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0003a0001c0005others(16): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(62): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(281): Show | 385 | 424 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 12/12 | c.*1947C>A | 1947 | |||||
|
chr18:74522075
|
T | C | 0.9127 | 3_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(384): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0003a0001c0005others(16): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(63): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(283): Show | 387 | 424 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 12/12 | c.*2007T>C | 2007 | |||||
|
chr18:74523320
|
A | G | 0.0448 | 3_prime_UTR_variant | MODIFIER | HG01074.hp1 HG01891.hp2 HG01981.hp1 others(16): Show |
a0001a0002a0008 | a0001c0001a0001c0003a0002c0002others(1): Show | a0001c0001t0007a0001c0001t0008a0001c0001t0017others(5): Show | a0001c0001t0007g0076a0001c0001t0008g0174a0001c0001t0008g0239others(16): Show | 19 | 424 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 12/12 | c.*3252A>G | 3252 |
| chr:pos | ref | alt | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | af | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr18:74496862
|
G | A | intron_variant | MODIFIER | HG00280.hp2 HG00323.hp1 HG00544.hp1 others(153): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0003a0001c0005others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(38): Show | a0001c0001t0001g0156a0001c0001t0001g0158a0001c0001t0001g0282others(123): Show | 156 | 424 | 0.3679 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 1/11 | c.-93+431G>A | ||||||
|
chr18:74497823
|
T | C | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(143): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0003a0001c0005others(8): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006others(35): Show | a0001c0001t0002g0025a0001c0001t0002g0026a0001c0001t0002g0037others(114): Show | 146 | 424 | 0.3443 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 1/11 | c.-93+1392T>C | ||||||
|
chr18:74498960
|
C | G | intron_variant | MODIFIER | HG01255.hp2 HG02647.hp2 HG03041.hp2 others(1): Show |
a0001a0002 | a0001c0003a0002c0002 | a0001c0003t0007a0002c0002t0006a0002c0002t0039others(1): Show | a0001c0003t0007g0138a0002c0002t0006g0139a0002c0002t0039g0065others(1): Show | 4 | 424 | 0.0094 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 1/11 | c.-92-922C>G | ||||||
|
chr18:74499611
|
A | G | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(98): Show |
a0001a0002a0006others(1): Show | a0001c0003a0002c0002a0002c0007others(2): Show | a0001c0003t0002a0001c0003t0007a0001c0003t0021others(17): Show | a0001c0003t0002g0036a0001c0003t0002g0116a0001c0003t0002g0122others(78): Show | 101 | 424 | 0.2382 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 1/11 | c.-92-271A>G | ||||||
|
chr18:74500411
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(384): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0003a0001c0005others(15): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(67): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(281): Show | 387 | 424 | 0.9127 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 2/11 | c.60+378A>G | ||||||
|
chr18:74500567
|
G | A | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(111): Show |
a0001a0002a0006others(2): Show | a0001c0001a0001c0003a0001c0005others(5): Show | a0001c0001t0018a0001c0003t0002a0001c0003t0006others(23): Show | a0001c0001t0018g0175a0001c0003t0002g0036a0001c0003t0002g0116others(89): Show | 114 | 424 | 0.2689 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 2/11 | c.60+534G>A | ||||||
|
chr18:74501077
|
T | A | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(159): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0003a0001c0005others(9): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006others(37): Show | a0001c0001t0002g0025a0001c0001t0002g0026a0001c0001t0002g0037others(128): Show | 162 | 424 | 0.3821 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 2/11 | c.61-252T>A | ||||||
|
chr18:74501251
|
T | C | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(161): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0003a0001c0005others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0005others(38): Show | a0001c0001t0001g0196a0001c0001t0001g0198a0001c0001t0002g0025others(130): Show | 164 | 424 | 0.3868 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 2/11 | c.61-78T>C | ||||||
|
chr18:74501894
|
T | A | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(158): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0003a0001c0005others(9): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006others(37): Show | a0001c0001t0002g0025a0001c0001t0002g0026a0001c0001t0002g0037others(127): Show | 161 | 424 | 0.3797 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.204+422T>A | ||||||
|
chr18:74502032
|
A | T | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(158): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0003a0001c0005others(9): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006others(36): Show | a0001c0001t0002g0025a0001c0001t0002g0026a0001c0001t0002g0037others(127): Show | 161 | 424 | 0.3797 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.204+560A>T | ||||||
|
chr18:74502160
|
A | G | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(99): Show |
a0001a0002a0006others(1): Show | a0001c0003a0002c0002a0002c0007others(2): Show | a0001c0003t0002a0001c0003t0007a0001c0003t0021others(18): Show | a0001c0003t0002g0036a0001c0003t0002g0116a0001c0003t0002g0122others(79): Show | 102 | 424 | 0.2406 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.204+688A>G | ||||||
|
chr18:74502472
|
G | GTTT | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(106): Show |
a0001a0002a0006others(2): Show | a0001c0003a0001c0005a0002c0002others(4): Show | a0001c0003t0002a0001c0003t0006a0001c0003t0007others(22): Show | a0001c0003t0002g0036a0001c0003t0002g0116a0001c0003t0002g0122others(84): Show | 109 | 424 | 0.2571 | 3 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.204+1000_204+1001insTTT | ||||||
|
chr18:74502473
|
G | T | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(112): Show |
a0001a0002a0006others(2): Show | a0001c0003a0001c0005a0002c0002others(4): Show | a0001c0003t0002a0001c0003t0006a0001c0003t0007others(22): Show | a0001c0003t0002g0036a0001c0003t0002g0116a0001c0003t0002g0122others(90): Show | 115 | 424 | 0.2712 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.204+1001G>T | ||||||
|
chr18:74502488
|
G | A | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(112): Show |
a0001a0002a0006others(2): Show | a0001c0003a0001c0005a0002c0002others(4): Show | a0001c0003t0002a0001c0003t0006a0001c0003t0007others(22): Show | a0001c0003t0002g0036a0001c0003t0002g0116a0001c0003t0002g0122others(90): Show | 115 | 424 | 0.2712 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.204+1016G>A | ||||||
|
chr18:74502771
|
A | G | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(159): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0003a0001c0005others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0005others(37): Show | a0001c0001t0001g0196a0001c0001t0002g0025a0001c0001t0002g0026others(128): Show | 162 | 424 | 0.3821 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.204+1299A>G | ||||||
|
chr18:74502804
|
G | A | intron_variant | MODIFIER | HG02647.hp2 HG03041.hp2 |
a0001a0002 | a0001c0003a0002c0002 | a0001c0003t0007a0002c0002t0006 | a0001c0003t0007g0138a0002c0002t0006g0139 | 2 | 424 | 0.0047 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.204+1332G>A | ||||||
|
chr18:74503064
|
C | T | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(99): Show |
a0001a0002a0006others(1): Show | a0001c0003a0002c0002a0002c0007others(2): Show | a0001c0003t0002a0001c0003t0007a0001c0003t0021others(18): Show | a0001c0003t0002g0036a0001c0003t0002g0116a0001c0003t0002g0122others(79): Show | 102 | 424 | 0.2406 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.204+1592C>T | ||||||
|
chr18:74503073
|
G | GTTTT | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(109): Show |
a0001a0002a0007others(1): Show | a0001c0001a0001c0003a0001c0005others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0009others(23): Show | a0001c0001t0001g0196a0001c0001t0002g0169a0001c0001t0002g0172others(87): Show | 112 | 424 | 0.2642 | 4 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.204+1611_204+1614dupTTTT | INFO_REALIGN_3_PRIME | |||||
|
chr18:74503162
|
G | A | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(159): Show |
a0001a0002a0003others(3): Show | a0001c0001a0001c0003a0001c0005others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0005others(37): Show | a0001c0001t0001g0196a0001c0001t0002g0025a0001c0001t0002g0026others(128): Show | 162 | 424 | 0.3821 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.204+1690G>A | ||||||
|
chr18:74503820
|
G | C | intron_variant | MODIFIER | HG01255.hp2 HG02647.hp2 HG03041.hp2 others(1): Show |
a0001a0002 | a0001c0003a0002c0002 | a0001c0003t0007a0002c0002t0006a0002c0002t0039others(1): Show | a0001c0003t0007g0138a0002c0002t0006g0139a0002c0002t0039g0065others(1): Show | 4 | 424 | 0.0094 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.205-2029G>C | ||||||
|
chr18:74503904
|
A | ACACACGC others(47): Show |
intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(355): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0003a0001c0005others(15): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(63): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(256): Show | 358 | 424 | 0.8443 | 54 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.205-1912_205-1911insTGGGCGTCAGGCCATACACTGCACACGCAGCCACACTGCCGCTGGGACAAATGA | INFO_REALIGN_3_PRIME | |||||
|
chr18:74505564
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(414): Show |
a0001a0002a0003others(8): Show | a0001c0001a0001c0003a0001c0005others(17): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(73): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(305): Show | 417 | 424 | 0.9835 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 3/11 | c.205-285G>A | ||||||
|
chr18:74507592
|
C | T | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(92): Show |
a0001a0002a0007 | a0001c0003a0002c0002a0002c0007others(2): Show | a0001c0003t0007a0002c0002t0001a0002c0002t0002others(14): Show | a0001c0003t0007g0123a0001c0003t0007g0138a0002c0002t0001g0167others(72): Show | 95 | 424 | 0.2241 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 4/11 | c.368-1248C>T | ||||||
|
chr18:74507745
|
A | G | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(95): Show |
a0001a0002a0007 | a0001c0003a0002c0002a0002c0006others(3): Show | a0001c0003t0007a0002c0002t0001a0002c0002t0002others(16): Show | a0001c0003t0007g0123a0001c0003t0007g0138a0002c0002t0001g0167others(75): Show | 98 | 424 | 0.2311 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 4/11 | c.368-1095A>G | ||||||
|
chr18:74507917
|
A | G | intron_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00323.hp1 others(157): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0003a0001c0005others(9): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(37): Show | a0001c0001t0001g0156a0001c0001t0001g0158a0001c0001t0001g0179others(126): Show | 160 | 424 | 0.3774 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 4/11 | c.368-923A>G | ||||||
|
chr18:74508579
|
A | G | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(94): Show |
a0001a0002a0007 | a0001c0003a0002c0002a0002c0006others(3): Show | a0001c0003t0007a0002c0002t0001a0002c0002t0002others(16): Show | a0001c0003t0007g0138a0002c0002t0001g0167a0002c0002t0002g0002others(74): Show | 97 | 424 | 0.2288 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 4/11 | c.368-261A>G | ||||||
|
chr18:74509632
|
CA | C | intron_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00323.hp1 others(124): Show |
a0001a0002a0007others(1): Show | a0001c0001a0001c0003a0001c0005others(7): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0009others(27): Show | a0001c0001t0001g0156a0001c0001t0001g0158a0001c0001t0001g0179others(100): Show | 127 | 424 | 0.2995 | -1 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 5/11 | c.456+719delA | INFO_REALIGN_3_PRIME | |||||
|
chr18:74509986
|
G | C | intron_variant | MODIFIER | HG01255.hp2 HG02647.hp2 HG03041.hp2 others(2): Show |
a0001a0002 | a0001c0003a0002c0002 | a0001c0003t0007a0002c0002t0006a0002c0002t0007others(2): Show | a0001c0003t0007g0138a0002c0002t0006g0139a0002c0002t0007g0121others(2): Show | 5 | 424 | 0.0118 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 5/11 | c.457-827G>C | ||||||
|
chr18:74509997
|
G | A | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(91): Show |
a0001a0002a0007 | a0001c0003a0002c0002a0002c0007others(2): Show | a0001c0003t0007a0002c0002t0001a0002c0002t0002others(14): Show | a0001c0003t0007g0138a0002c0002t0001g0167a0002c0002t0002g0002others(71): Show | 94 | 424 | 0.2217 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 5/11 | c.457-816G>A | ||||||
|
chr18:74511175
|
C | T | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(390): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0003a0001c0005others(15): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(68): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(285): Show | 393 | 424 | 0.9269 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 6/11 | c.657+162C>T | ||||||
|
chr18:74511707
|
C | CA | intron_variant | MODIFIER | HG00323.hp1 HG00544.hp1 HG00597.hp2 others(95): Show |
a0001a0002a0003others(1): Show | a0001c0003a0002c0002a0002c0006others(4): Show | a0001c0003t0007a0002c0002t0001a0002c0002t0002others(17): Show | a0001c0003t0007g0138a0002c0002t0001g0167a0002c0002t0002g0002others(74): Show | 98 | 424 | 0.2311 | 1 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 6/11 | c.657+709dupA | INFO_REALIGN_3_PRIME | |||||
|
chr18:74514445
|
GATGTAAG others(67): Show |
G | intron_variant | MODIFIER | HG00140.hp2 HG00323.hp2 HG00408.hp2 others(164): Show |
a0001a0002a0004others(4): Show | a0001c0001a0001c0003a0001c0009others(7): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(32): Show | a0001c0001t0001g0003a0001c0001t0001g0005a0001c0001t0001g0007others(116): Show | 167 | 424 | 0.3939 | -74 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 8/11 | c.903+853_903+926delCCTGTGGGCTTACGTGGTACGTATGTAAGTTCTGCAGGCTATAGGTTTATGTGGTATGGATGTAAGTTCTGCAG | INFO_REALIGN_3_PRIME | |||||
|
chr18:74514802
|
G | C | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(263): Show |
a0001a0003a0004others(5): Show | a0001c0001a0001c0003a0001c0009others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(43): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(183): Show | 266 | 424 | 0.6274 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 8/11 | c.903+1083G>C | ||||||
|
chr18:74515956
|
T | C | intron_variant | MODIFIER | HG01358.hp2 HG02109.hp1 HG02257.hp2 others(16): Show |
a0001a0008 | a0001c0001a0001c0003a0008c0012 | a0001c0001t0002a0001c0001t0005a0001c0001t0008others(4): Show | a0001c0001t0002g0037a0001c0001t0002g0038a0001c0001t0002g0142others(14): Show | 19 | 424 | 0.0448 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 8/11 | c.904-272T>C | ||||||
|
chr18:74517002
|
A | G | intron_variant | MODIFIER | HG00099.hp2 HG00280.hp2 HG00544.hp1 others(158): Show |
a0001a0002a0003others(2): Show | a0001c0001a0001c0003a0001c0005others(8): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(37): Show | a0001c0001t0001g0039a0001c0001t0001g0042a0001c0001t0001g0156others(124): Show | 161 | 424 | 0.3797 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 9/11 | c.1068+610A>G | ||||||
|
chr18:74518003
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(397): Show |
a0001a0002a0003others(8): Show | a0001c0001a0001c0003a0001c0009others(15): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(67): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(289): Show | 400 | 424 | 0.9434 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 9/11 | c.1069-496G>A | ||||||
|
chr18:74518121
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(126): Show |
a0001a0002a0008 | a0001c0001a0001c0003a0001c0020others(4): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(22): Show | a0001c0001t0001g0001a0001c0001t0001g0009a0001c0001t0001g0011others(92): Show | 129 | 424 | 0.3043 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 9/11 | c.1069-378T>C | ||||||
|
chr18:74518124
|
G | A | intron_variant | MODIFIER | HG01074.hp1 HG02572.hp1 HG02809.hp1 others(4): Show |
a0001a0008 | a0001c0001a0001c0003a0008c0012 | a0001c0001t0008a0001c0003t0007a0008c0012t0007 | a0001c0001t0008g0174a0001c0001t0008g0243a0001c0003t0007g0044others(4): Show | 7 | 424 | 0.0165 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 9/11 | c.1069-375G>A | ||||||
|
chr18:74518824
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(408): Show |
a0001a0002a0003others(8): Show | a0001c0001a0001c0003a0001c0005others(17): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003others(71): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(302): Show | 411 | 424 | 0.9693 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 10/11 | c.1211-125G>A | ||||||
|
chr18:74518940
|
T | TC | splice_acceptor_variant others(1): Show |
HIGH | HG00099.hp1 HG00140.hp1 HG00140.hp2 others(352): Show |
a0001a0002a0003others(7): Show | a0001c0001a0001c0003a0001c0005others(16): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0005others(56): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004others(255): Show | 355 | 424 | 0.8373 | 1 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 10/11 | c.1211-3dupC | INFO_REALIGN_3_PRIME | |||||
|
chr18:74519925
|
C | T | intron_variant | MODIFIER | HG01074.hp1 HG01891.hp2 HG02145.hp1 others(14): Show |
a0001a0002a0008 | a0001c0001a0001c0003a0002c0002others(1): Show | a0001c0001t0007a0001c0001t0008a0001c0001t0042others(4): Show | a0001c0001t0007g0076a0001c0001t0008g0174a0001c0001t0008g0239others(14): Show | 17 | 424 | 0.0401 | 0 | CNDP2 | ENSG00000133313.15 | transcript | ENST00000324262.9 | protein_coding | 11/11 | c.1359-74C>T |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
ahapid | alen | total | AFR | AMR | EAS | EUR | SAS | aseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CNDP2 | 1/1 | a0001 | 475 | 313 | 82 | 56 | 124 | 16 | 33 | subcellular location copy fasta | chr18 | 74491363 | 74528454 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
chapid | clen | total | AFR | AMR | EAS | EUR | SAS | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CNDP2 | 0/0 | c0003 | 1428 | 19 | 15 | 1 | 1 | 0 | 2 | copy fasta | chr18 | 74491363 | 74528454 |
| genename | grch38/chm13v2 | thapid | tlen | total | AFR | AMR | EAS | EUR | SAS | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CNDP2 | 0/0 | t0007 | 3547 | 8 | 7 | 1 | 0 | 0 | 0 | copy fasta | chr18 | 74491363 | 74528454 |
| genename | grch38/chm13v2 | ghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| CNDP2 | 0/0 | g0138 | 1 | 1 | 0 | 0 | 0 | 0 | chr18 | 74491363 | 74528454 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
achapid | total | AFR | AMR | EAS | EUR | SAS | clen | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CNDP2 | 0/0 | a0001c0003 | 19 | 15 | 1 | 1 | 0 | 2 | 1428 | copy fasta | chr18 | 74491363 | 74528454 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
acthapid | total | AFR | AMR | EAS | EUR | SAS | tlen | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CNDP2 | 0/0 | a0001c0003t0007 | 4 | 3 | 1 | 0 | 0 | 0 | 4974 | copy fasta | chr18 | 74491363 | 74528454 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
actghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| CNDP2 | 0/0 | a0001c0003t0007g0138 | 1 | 1 | 0 | 0 | 0 | 0 | chr18 | 74491363 | 74528454 |
Click to load Haplotype QTL data...
| pos | S. Strand |
E# Exon Number |
max | median | min | diff | type | haplotypeid | max_hap_list | min_hap_list | symbol | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 74496431 | + | 1 | -0.5652 | -0.5652 | -0.5652 | 0.0000 | acceptor | a0001c0003t0007g0138 | HG03041.hp2 | HG03041.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74499882 | + | 2 | 0.9675 | 0.9675 | 0.9675 | 0.0000 | donor | a0001c0003t0007g0138 | HG03041.hp2 | HG03041.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74500033 | + | 2 | -0.9632 | -0.9631 | -0.9632 | 0.0000 | acceptor | a0001c0003t0007g0138 | HG03041.hp2 | HG03041.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74501329 | + | 3 | 0.8758 | 0.8758 | 0.8758 | 0.0000 | donor | a0001c0003t0007g0138 | HG03041.hp2 | HG03041.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74501472 | + | 3 | -0.9450 | -0.9450 | -0.9450 | 0.0000 | acceptor | a0001c0003t0007g0138 | HG03041.hp2 | HG03041.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74505849 | + | 4 | 0.9521 | 0.9520 | 0.9521 | 0.0000 | donor | a0001c0003t0007g0138 | HG03041.hp2 | HG03041.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74506011 | + | 4 | -0.9882 | -0.9882 | -0.9882 | 0.0000 | acceptor | a0001c0003t0007g0138 | HG03041.hp2 | HG03041.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74508840 | + | 5 | 0.9218 | 0.9218 | 0.9218 | 0.0000 | donor | a0001c0003t0007g0138 | HG03041.hp2 | HG03041.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74508928 | + | 5 | -0.9641 | -0.9641 | -0.9641 | 0.0000 | acceptor | a0001c0003t0007g0138 | HG03041.hp2 | HG03041.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74510813 | + | 6 | 0.9940 | 0.9940 | 0.9940 | 0.0000 | donor | a0001c0003t0007g0138 | HG03041.hp2 | HG03041.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74511013 | + | 6 | -0.9961 | -0.9961 | -0.9961 | 0.0000 | acceptor | a0001c0003t0007g0138 | HG03041.hp2 | HG03041.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74512448 | + | 7 | 0.9922 | 0.9922 | 0.9922 | 0.0000 | donor | a0001c0003t0007g0138 | HG03041.hp2 | HG03041.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74512532 | + | 7 | -0.9950 | -0.9950 | -0.9950 | 0.0000 | acceptor | a0001c0003t0007g0138 | HG03041.hp2 | HG03041.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74513559 | + | 8 | 0.9956 | 0.9956 | 0.9956 | 0.0000 | donor | a0001c0003t0007g0138 | HG03041.hp2 | HG03041.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74513719 | + | 8 | -0.9922 | -0.9921 | -0.9922 | 0.0000 | acceptor | a0001c0003t0007g0138 | HG03041.hp2 | HG03041.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74516228 | + | 9 | 0.9953 | 0.9953 | 0.9953 | 0.0000 | donor | a0001c0003t0007g0138 | HG03041.hp2 | HG03041.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74516392 | + | 9 | -0.9630 | -0.9630 | -0.9630 | 0.0000 | acceptor | a0001c0003t0007g0138 | HG03041.hp2 | HG03041.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74518499 | + | 10 | 0.9040 | 0.9040 | 0.9040 | 0.0000 | donor | a0001c0003t0007g0138 | HG03041.hp2 | HG03041.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74518640 | + | 10 | -0.9416 | -0.9416 | -0.9416 | 0.0000 | acceptor | a0001c0003t0007g0138 | HG03041.hp2 | HG03041.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74518949 | + | 11 | 0.9951 | 0.9951 | 0.9951 | 0.0000 | donor | a0001c0003t0007g0138 | HG03041.hp2 | HG03041.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74519096 | + | 11 | -0.9977 | -0.9977 | -0.9977 | 0.0000 | acceptor | a0001c0003t0007g0138 | HG03041.hp2 | HG03041.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| 74519999 | + | 12 | 0.7787 | 0.7787 | 0.7787 | 0.0000 | donor | a0001c0003t0007g0138 | HG03041.hp2 | HG03041.hp2 | CNDP2 | chr18 | 74491363 | 74528454 |
| pos | annotationhgvs_chgvs_p | clinvarid | clnsig | geneinfo | mc | clndisdb | strand strand
|
ahapid ahapid_count
|
chapid chapid count
|
thapid thapid_count
|
ghapid ghapid_count
|
AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
impact | chr | ref | alt | external |
|---|
| CHR:POS | annotationhgvs_chgvs_p | disease trait-log10podds or beta | AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
study | initial sample size/replication sample size | report genes | mapped gene | strongest snp risk allele | strand strand
|
impact | chr | ref | alt |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr18:74511175
|
c.657+162C>T | Height | a0001a0002a0003a0004a0005others(5): Show | a0001c0001a0001c0003a0001c0005a0001c0009a0001c0016others(13): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(66): Show | a0001c0001t0001g0001a0001c0001t0001g0003a0001c0001t0001g0004a0001c0001t0001g0005a0001c0001t0001g0007others(283): Show | HG00099.hp1 HG00099.hp2 HG00140.hp1 HG00140.hp2 HG00280.hp1 others(388): Show |
Leveraging Polygenic Functional Enrichment to Impr others(15): Show |
approximately 458,000 European ancestry individual others(2): Show |
CNDP2 | rs8088885-? | + | MODIFIER | chr18 | C | T | |
|
chr18:74507745
|
c.368-1095A>G | Spherical equivalent0.09 | a0001a0002a0007 | a0001c0003a0002c0002a0002c0006a0002c0007a0002c0008others(1): Show | a0001c0003t0007a0002c0002t0001a0002c0002t0002a0002c0002t0006a0002c0002t0007others(14): Show | a0001c0003t0007g0123a0001c0003t0007g0138a0002c0002t0001g0167a0002c0002t0002g0002a0002c0002t0002g0006others(73): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00735.hp1 others(93): Show |
Association of Myopia and Intraocular Pressure Wit others(112): Show |
95,827 European ancestry individuals/ | NR | CNDP2 | rs3829640-G | + | MODIFIER | chr18 | A | G |
|
chr18:74507745
|
c.368-1095A>G | Serum metabolite levels0.245 | a0001a0002a0007 | a0001c0003a0002c0002a0002c0006a0002c0007a0002c0008others(1): Show | a0001c0003t0007a0002c0002t0001a0002c0002t0002a0002c0002t0006a0002c0002t0007others(14): Show | a0001c0003t0007g0123a0001c0003t0007g0138a0002c0002t0001g0167a0002c0002t0002g0002a0002c0002t0002g0006others(73): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00735.hp1 others(93): Show |
A Genome-wide Association Study Discovers 46 Loci others(80): Show |
3,926 Hispanic/Latino individuals/1,509 European a others(19): Show |
AX747775 | CNDP2 | rs3829640-A | + | MODIFIER | chr18 | A | G |
|
chr18:74507745
|
c.368-1095A>G | Serum metabolite levels0.245 | a0001a0002a0007 | a0001c0003a0002c0002a0002c0006a0002c0007a0002c0008others(1): Show | a0001c0003t0007a0002c0002t0001a0002c0002t0002a0002c0002t0006a0002c0002t0007others(14): Show | a0001c0003t0007g0123a0001c0003t0007g0138a0002c0002t0001g0167a0002c0002t0002g0002a0002c0002t0002g0006others(73): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00735.hp1 others(93): Show |
A Genome-wide Association Study Discovers 46 Loci others(80): Show |
3,926 Hispanic/Latino individuals/ | AX747775 | CNDP2 | rs3829640-A | + | MODIFIER | chr18 | A | G |
|
chr18:74501373
|
c.105G>Ap.Pro35Pro | Valylleucine levels (advanced age)0.2368 | a0001a0002a0006a0007a0008 | a0001c0003a0001c0005a0002c0002a0002c0007a0006c0013others(2): Show | a0001c0003t0002a0001c0003t0006a0001c0003t0007a0001c0003t0009a0001c0003t0021others(20): Show | a0001c0003t0002g0036a0001c0003t0002g0116a0001c0003t0002g0122a0001c0003t0002g0151a0001c0003t0002g0192others(88): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00735.hp1 others(110): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
116 Han Chinese ancestry individuals/ | CNDP2 | rs2303463-? | + | LOW | chr18 | G | A | |
|
chr18:74499889
|
c.-85C>G | Valylleucine levels (advanced age)0.2368 | a0001a0002a0003a0006a0007others(1): Show | a0001c0001a0001c0003a0001c0005a0001c0016a0001c0017others(7): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006a0001c0001t0007a0001c0001t0009others(34): Show | a0001c0001t0002g0025a0001c0001t0002g0026a0001c0001t0002g0037a0001c0001t0002g0038a0001c0001t0002g0063others(125): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00639.hp2 others(156): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
116 Han Chinese ancestry individuals/ | CNDP2 | rs3764509-? | + | MODIFIER | chr18 | C | G | |
|
chr18:74496175
|
c.-349G>A | Gamma-glutamyl-2-aminobutyrate levels (advanced age)others(18): Show | a0001a0002a0006a0007 | a0001c0001a0001c0003a0002c0002a0002c0007a0006c0013others(1): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0016a0001c0001t0029a0001c0003t0002others(19): Show | a0001c0001t0001g0156a0001c0001t0001g0158a0001c0001t0001g0282a0001c0001t0003g0013a0001c0001t0003g0153others(85): Show | HG00280.hp2 HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 others(106): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
116 Han Chinese ancestry individuals/ | CNDP2 | rs12964619-? | + | MODIFIER | chr18 | G | A | |
|
chr18:74501373
|
c.105G>Ap.Pro35Pro | Gamma-glutamyl-2-aminobutyrate levels (advanced age)others(18): Show | a0001a0002a0006a0007a0008 | a0001c0003a0001c0005a0002c0002a0002c0007a0006c0013others(2): Show | a0001c0003t0002a0001c0003t0006a0001c0003t0007a0001c0003t0009a0001c0003t0021others(20): Show | a0001c0003t0002g0036a0001c0003t0002g0116a0001c0003t0002g0122a0001c0003t0002g0151a0001c0003t0002g0192others(88): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00735.hp1 others(110): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
116 Han Chinese ancestry individuals/ | CNDP2 | rs2303463-? | + | LOW | chr18 | G | A | |
|
chr18:74499889
|
c.-85C>G | Gamma-glutamyl-2-aminobutyrate levels (advanced age)others(18): Show | a0001a0002a0003a0006a0007others(1): Show | a0001c0001a0001c0003a0001c0005a0001c0016a0001c0017others(7): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006a0001c0001t0007a0001c0001t0009others(34): Show | a0001c0001t0002g0025a0001c0001t0002g0026a0001c0001t0002g0037a0001c0001t0002g0038a0001c0001t0002g0063others(125): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00639.hp2 others(156): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
116 Han Chinese ancestry individuals/ | CNDP2 | rs3764509-? | + | MODIFIER | chr18 | C | G | |
|
chr18:74501373
|
c.105G>Ap.Pro35Pro |
Leucylglycine levels (advanced age)0.177 others(1): Show |
a0001a0002a0006a0007a0008 | a0001c0003a0001c0005a0002c0002a0002c0007a0006c0013others(2): Show | a0001c0003t0002a0001c0003t0006a0001c0003t0007a0001c0003t0009a0001c0003t0021others(20): Show | a0001c0003t0002g0036a0001c0003t0002g0116a0001c0003t0002g0122a0001c0003t0002g0151a0001c0003t0002g0192others(88): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00735.hp1 others(110): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
116 Han Chinese ancestry individuals/ | CNDP2 | rs2303463-? | + | LOW | chr18 | G | A | |
|
chr18:74499889
|
c.-85C>G |
Leucylglycine levels (advanced age)0.177 others(1): Show |
a0001a0002a0003a0006a0007others(1): Show | a0001c0001a0001c0003a0001c0005a0001c0016a0001c0017others(7): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006a0001c0001t0007a0001c0001t0009others(34): Show | a0001c0001t0002g0025a0001c0001t0002g0026a0001c0001t0002g0037a0001c0001t0002g0038a0001c0001t0002g0063others(125): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00639.hp2 others(156): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
116 Han Chinese ancestry individuals/ | CNDP2 | rs3764509-? | + | MODIFIER | chr18 | C | G | |
|
chr18:74496175
|
c.-349G>A | Valylglycine levels (advanced age)0.1717 | a0001a0002a0006a0007 | a0001c0001a0001c0003a0002c0002a0002c0007a0006c0013others(1): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0016a0001c0001t0029a0001c0003t0002others(19): Show | a0001c0001t0001g0156a0001c0001t0001g0158a0001c0001t0001g0282a0001c0001t0003g0013a0001c0001t0003g0153others(85): Show | HG00280.hp2 HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 others(106): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
116 Han Chinese ancestry individuals/ | CNDP2 | rs12964619-? | + | MODIFIER | chr18 | G | A | |
|
chr18:74501373
|
c.105G>Ap.Pro35Pro | Valylglycine levels (advanced age)0.1885 | a0001a0002a0006a0007a0008 | a0001c0003a0001c0005a0002c0002a0002c0007a0006c0013others(2): Show | a0001c0003t0002a0001c0003t0006a0001c0003t0007a0001c0003t0009a0001c0003t0021others(20): Show | a0001c0003t0002g0036a0001c0003t0002g0116a0001c0003t0002g0122a0001c0003t0002g0151a0001c0003t0002g0192others(88): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00735.hp1 others(110): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
116 Han Chinese ancestry individuals/ | CNDP2 | rs2303463-? | + | LOW | chr18 | G | A | |
|
chr18:74499889
|
c.-85C>G | Valylglycine levels (advanced age)0.1885 | a0001a0002a0003a0006a0007others(1): Show | a0001c0001a0001c0003a0001c0005a0001c0016a0001c0017others(7): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006a0001c0001t0007a0001c0001t0009others(34): Show | a0001c0001t0002g0025a0001c0001t0002g0026a0001c0001t0002g0037a0001c0001t0002g0038a0001c0001t0002g0063others(125): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00639.hp2 others(156): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
116 Han Chinese ancestry individuals/ | CNDP2 | rs3764509-? | + | MODIFIER | chr18 | C | G | |
|
chr18:74496175
|
c.-349G>A | Gamma-glutamyl-2-aminobutyrate levels (elderly offspring)others(24): Show | a0001a0002a0006a0007 | a0001c0001a0001c0003a0002c0002a0002c0007a0006c0013others(1): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0016a0001c0001t0029a0001c0003t0002others(19): Show | a0001c0001t0001g0156a0001c0001t0001g0158a0001c0001t0001g0282a0001c0001t0003g0013a0001c0001t0003g0153others(85): Show | HG00280.hp2 HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 others(106): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
232 Han Chinese ancestry individuals/ | CNDP2 | rs12964619-? | + | MODIFIER | chr18 | G | A | |
|
chr18:74501373
|
c.105G>Ap.Pro35Pro | Gamma-glutamyl-2-aminobutyrate levels (elderly offspring)others(23): Show | a0001a0002a0006a0007a0008 | a0001c0003a0001c0005a0002c0002a0002c0007a0006c0013others(2): Show | a0001c0003t0002a0001c0003t0006a0001c0003t0007a0001c0003t0009a0001c0003t0021others(20): Show | a0001c0003t0002g0036a0001c0003t0002g0116a0001c0003t0002g0122a0001c0003t0002g0151a0001c0003t0002g0192others(88): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00735.hp1 others(110): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
232 Han Chinese ancestry individuals/ | CNDP2 | rs2303463-? | + | LOW | chr18 | G | A | |
|
chr18:74499889
|
c.-85C>G | Gamma-glutamyl-2-aminobutyrate levels (elderly offspring)others(23): Show | a0001a0002a0003a0006a0007others(1): Show | a0001c0001a0001c0003a0001c0005a0001c0016a0001c0017others(7): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006a0001c0001t0007a0001c0001t0009others(34): Show | a0001c0001t0002g0025a0001c0001t0002g0026a0001c0001t0002g0037a0001c0001t0002g0038a0001c0001t0002g0063others(125): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00639.hp2 others(156): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
232 Han Chinese ancestry individuals/ | CNDP2 | rs3764509-? | + | MODIFIER | chr18 | C | G | |
|
chr18:74501373
|
c.105G>Ap.Pro35Pro |
Leucylglycine levels (elderly offspring) others(6): Show |
a0001a0002a0006a0007a0008 | a0001c0003a0001c0005a0002c0002a0002c0007a0006c0013others(2): Show | a0001c0003t0002a0001c0003t0006a0001c0003t0007a0001c0003t0009a0001c0003t0021others(20): Show | a0001c0003t0002g0036a0001c0003t0002g0116a0001c0003t0002g0122a0001c0003t0002g0151a0001c0003t0002g0192others(88): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00735.hp1 others(110): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
232 Han Chinese ancestry individuals/ | CNDP2 | rs2303463-? | + | LOW | chr18 | G | A | |
|
chr18:74499889
|
c.-85C>G |
Leucylglycine levels (elderly offspring) others(6): Show |
a0001a0002a0003a0006a0007others(1): Show | a0001c0001a0001c0003a0001c0005a0001c0016a0001c0017others(7): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006a0001c0001t0007a0001c0001t0009others(34): Show | a0001c0001t0002g0025a0001c0001t0002g0026a0001c0001t0002g0037a0001c0001t0002g0038a0001c0001t0002g0063others(125): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00639.hp2 others(156): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
232 Han Chinese ancestry individuals/ | CNDP2 | rs3764509-? | + | MODIFIER | chr18 | C | G | |
|
chr18:74496175
|
c.-349G>A |
Valylglycine levels (elderly offspring)0 others(5): Show |
a0001a0002a0006a0007 | a0001c0001a0001c0003a0002c0002a0002c0007a0006c0013others(1): Show | a0001c0001t0001a0001c0001t0003a0001c0001t0016a0001c0001t0029a0001c0003t0002others(19): Show | a0001c0001t0001g0156a0001c0001t0001g0158a0001c0001t0001g0282a0001c0001t0003g0013a0001c0001t0003g0153others(85): Show | HG00280.hp2 HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 others(106): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
232 Han Chinese ancestry individuals/ | CNDP2 | rs12964619-? | + | MODIFIER | chr18 | G | A | |
|
chr18:74501373
|
c.105G>Ap.Pro35Pro |
Valylglycine levels (elderly offspring)0 others(4): Show |
a0001a0002a0006a0007a0008 | a0001c0003a0001c0005a0002c0002a0002c0007a0006c0013others(2): Show | a0001c0003t0002a0001c0003t0006a0001c0003t0007a0001c0003t0009a0001c0003t0021others(20): Show | a0001c0003t0002g0036a0001c0003t0002g0116a0001c0003t0002g0122a0001c0003t0002g0151a0001c0003t0002g0192others(88): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00735.hp1 others(110): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
232 Han Chinese ancestry individuals/ | CNDP2 | rs2303463-? | + | LOW | chr18 | G | A | |
|
chr18:74499889
|
c.-85C>G |
Valylglycine levels (elderly offspring)0 others(4): Show |
a0001a0002a0003a0006a0007others(1): Show | a0001c0001a0001c0003a0001c0005a0001c0016a0001c0017others(7): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006a0001c0001t0007a0001c0001t0009others(34): Show | a0001c0001t0002g0025a0001c0001t0002g0026a0001c0001t0002g0037a0001c0001t0002g0038a0001c0001t0002g0063others(125): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00639.hp2 others(156): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
232 Han Chinese ancestry individuals/ | CNDP2 | rs3764509-? | + | MODIFIER | chr18 | C | G | |
|
chr18:74501373
|
c.105G>Ap.Pro35Pro |
Valylleucine levels (elderly offspring)0 others(5): Show |
a0001a0002a0006a0007a0008 | a0001c0003a0001c0005a0002c0002a0002c0007a0006c0013others(2): Show | a0001c0003t0002a0001c0003t0006a0001c0003t0007a0001c0003t0009a0001c0003t0021others(20): Show | a0001c0003t0002g0036a0001c0003t0002g0116a0001c0003t0002g0122a0001c0003t0002g0151a0001c0003t0002g0192others(88): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00735.hp1 others(110): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
232 Han Chinese ancestry individuals/ | CNDP2 | rs2303463-? | + | LOW | chr18 | G | A | |
|
chr18:74499889
|
c.-85C>G |
Valylleucine levels (elderly offspring)0 others(5): Show |
a0001a0002a0003a0006a0007others(1): Show | a0001c0001a0001c0003a0001c0005a0001c0016a0001c0017others(7): Show | a0001c0001t0002a0001c0001t0005a0001c0001t0006a0001c0001t0007a0001c0001t0009others(34): Show | a0001c0001t0002g0025a0001c0001t0002g0026a0001c0001t0002g0037a0001c0001t0002g0038a0001c0001t0002g0063others(125): Show | HG00323.hp1 HG00544.hp1 HG00597.hp2 HG00609.hp2 HG00639.hp2 others(156): Show |
Metagenomic and metabolomic remodeling in nonagena others(82): Show |
232 Han Chinese ancestry individuals/ | CNDP2 | rs3764509-? | + | MODIFIER | chr18 | C | G |