| geneid | 2046 |
|---|---|
| ensemblid | ENSG00000070886.12 |
| hgncid | 3391 |
| symbol | EPHA8 |
| name | EPH receptor A8 |
| refseq_nuc | NM_020526.5 |
| refseq_prot | NP_065387.1 |
| ensembl_nuc | ENST00000166244.8 |
| ensembl_prot | ENSP00000166244.3 |
| mane_status | MANE Select |
| chr | chr1 |
| start | 22563489 |
| end | 22603595 |
| strand | + |
| ver | v1.2 |
| region | chr1:22563489-22603595 |
| region5000 | chr1:22558489-22608595 |
| regionname0 | EPHA8_chr1_22563489_22603595 |
| regionname5000 | EPHA8_chr1_22558489_22608595 |
| chr:pos | ref | alt | af | annotation | impact | samples | AHAPIDS | ACHAPIDS | ACTHAPIDS | ACTGHAPIDS | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr1:22563617
|
CGCCCG | C | 0.4269 | start_retained_variant | MODIFIER | HG00099.hp1 HG00140.hp2 HG00438.hp2 others(143): Show |
a0000a0001a0002others(11): Show | a0000c0007a0001c0001a0001c0002others(27): Show | a0000c0007t0010a0001c0001t0002a0001c0001t0007others(54): Show | a0000c0007t0010g0158a0001c0001t0002g0011a0001c0001t0002g0070others(135): Show | 146 | 342 | -5 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 1/17 | c.-5_-1delCGGCC | INFO_REALIGN_3_PRIME | |||||
|
chr1:22598984
|
GGTGTCTG others(5): Show |
G | 0.0029 | disruptive_inframe_deletion | MODERATE | NA18985.hp2 | a0000 | a0000c0041 | a0000c0041t0001 | a0000c0041t0001g0031 | 1 | 342 | -12 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 13/17 | c.2327_2338delTGTCTGACTTCG | p.Val776_Phe779del | 2474/5019 | 2327/3018 | 776/1005 | INFO_REALIGN_3_PRIME | |
|
chr1:22601406
|
C | CG | 0.0234 | frameshift_variant | HIGH | HG00735.hp1 HG01099.hp2 HG02071.hp1 others(5): Show |
a0000 | a0000c0007a0000c0041a0000c0042 | a0000c0007t0001a0000c0007t0003a0000c0007t0010others(3): Show | a0000c0007t0001g0005a0000c0007t0001g0218a0000c0007t0001g0269others(5): Show | 8 | 342 | 1 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 16/17 | c.2838dupG | p.Tyr947fs | 2986/5019 | 2839/3018 | 947/1005 | INFO_REALIGN_3_PRIME |
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|
| chr:pos | ref | alt | af | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr1:22563582
|
A | C | 0.4298 | 5_prime_UTR_variant | MODIFIER | HG00099.hp1 HG00140.hp2 HG00438.hp2 others(144): Show |
a0000a0001a0002others(11): Show | a0000c0007a0001c0001a0001c0002others(27): Show | a0000c0007t0010a0000c0007t0035a0001c0001t0002others(55): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0001c0001t0002g0011others(136): Show | 147 | 342 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 1/17 | c.-54A>C | 54 | |||||
|
chr1:22563632
|
G | C | 0.0351 | 5_prime_UTR_variant | MODIFIER | HG00735.hp1 HG01243.hp2 HG02559.hp1 others(9): Show |
a0000a0001a0002 | a0000c0007a0001c0001a0001c0002others(2): Show | a0000c0007t0010a0001c0001t0010a0001c0001t0016others(5): Show | a0000c0007t0010g0158a0001c0001t0010g0168a0001c0001t0010g0170others(9): Show | 12 | 342 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 1/17 | c.-4G>C | 4 | |||||
|
chr1:22601772
|
A | G | 0.6784 | 3_prime_UTR_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(229): Show |
a0000a0001a0002others(14): Show | a0000c0007a0000c0042a0001c0001others(41): Show | a0000c0007t0003a0000c0007t0010a0000c0007t0035others(88): Show | a0000c0007t0003g0197a0000c0007t0010g0158a0000c0007t0035g0006others(214): Show | 232 | 342 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 17/17 | c.*31A>G | 31 |
| chr:pos | ref | alt | annotation | impact | samples | ahapids | achapids | acthapids | actghapids | ac | an | af | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr1:22564916
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00140.hp2 HG00438.hp2 others(175): Show |
a0000a0001a0002others(12): Show | a0000c0007a0000c0041a0000c0042others(31): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(73): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(165): Show | 178 | 342 | 0.5205 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 1/16 | c.94+1187T>C | ||||||
|
chr1:22565472
|
C | T | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(323): Show |
a0000a0001a0002others(16): Show | a0000c0007a0000c0041a0000c0042others(44): Show | a0000c0007t0001a0000c0007t0010a0000c0007t0035others(98): Show | a0000c0007t0001g0005a0000c0007t0001g0218a0000c0007t0001g0269others(295): Show | 326 | 342 | 0.9532 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 1/16 | c.94+1743C>T | ||||||
|
chr1:22567415
|
C | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(105): Show |
a0000a0001a0002others(9): Show | a0000c0007a0001c0001a0001c0002others(19): Show | a0000c0007t0010a0000c0007t0035a0001c0001t0002others(49): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0001c0001t0002g0070others(96): Show | 108 | 342 | 0.3158 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 1/16 | c.95-1874C>G | ||||||
|
chr1:22567443
|
C | A | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(100): Show |
a0000a0001a0002others(9): Show | a0000c0007a0001c0001a0001c0002others(16): Show | a0000c0007t0010a0000c0007t0035a0001c0001t0002others(46): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0001c0001t0002g0070others(91): Show | 103 | 342 | 0.3012 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 1/16 | c.95-1846C>A | ||||||
|
chr1:22568159
|
A | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(101): Show |
a0000a0001a0002others(7): Show | a0000c0007a0001c0001a0001c0002others(16): Show | a0000c0007t0010a0000c0007t0035a0001c0001t0002others(45): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0001c0001t0002g0070others(92): Show | 104 | 342 | 0.3041 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 1/16 | c.95-1130A>C | ||||||
|
chr1:22568301
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(96): Show |
a0000a0001a0002others(7): Show | a0000c0007a0001c0001a0001c0002others(14): Show | a0000c0007t0010a0000c0007t0035a0001c0001t0002others(43): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0001c0001t0002g0070others(87): Show | 99 | 342 | 0.2895 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 1/16 | c.95-988A>G | ||||||
|
chr1:22568445
|
C | T | intron_variant | MODIFIER | HG00735.hp1 HG01106.hp2 HG02615.hp2 others(1): Show |
a0000a0001 | a0000c0007a0001c0001a0001c0002 | a0000c0007t0010a0001c0001t0025a0001c0002t0022 | a0000c0007t0010g0158a0001c0001t0025g0157a0001c0002t0022g0156others(1): Show | 4 | 342 | 0.0117 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 1/16 | c.95-844C>T | ||||||
|
chr1:22568585
|
C | T | intron_variant | MODIFIER | HG00735.hp1 HG01106.hp2 HG02615.hp2 others(1): Show |
a0000a0001 | a0000c0007a0001c0001a0001c0002 | a0000c0007t0010a0001c0001t0025a0001c0002t0022 | a0000c0007t0010g0158a0001c0001t0025g0157a0001c0002t0022g0156others(1): Show | 4 | 342 | 0.0117 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 1/16 | c.95-704C>T | ||||||
|
chr1:22568994
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00323.hp1 HG00639.hp2 others(14): Show |
a0000a0001a0002others(2): Show | a0000c0007a0001c0001a0001c0002others(4): Show | a0000c0007t0010a0001c0001t0025a0001c0002t0007others(9): Show | a0000c0007t0010g0158a0001c0001t0025g0157a0001c0002t0007g0173others(14): Show | 17 | 342 | 0.0497 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 1/16 | c.95-295A>G | ||||||
|
chr1:22570330
|
G | GCA | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(183): Show |
a0000a0001a0002others(10): Show | a0000c0007a0000c0041a0000c0042others(34): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(77): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(171): Show | 186 | 342 | 0.5439 | 2 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 2/16 | c.159+980_159+981dupCA | INFO_REALIGN_3_PRIME | |||||
|
chr1:22570341
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(141): Show |
a0000a0001a0002others(9): Show | a0000c0007a0000c0041a0000c0042others(32): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(68): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(130): Show | 144 | 342 | 0.4211 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 2/16 | c.159+988T>C | ||||||
|
chr1:22570440
|
G | GCATACTT others(86): Show |
intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(124): Show |
a0000a0001a0002others(7): Show | a0000c0007a0000c0041a0000c0042others(28): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(61): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(114): Show | 127 | 342 | 0.3714 | 93 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 2/16 | c.159+1142_159+1143insGATAATAATATTAATAATGATGATGATAACGACACCAACATACTTGAGTTCTTTCATGTCCACGTTCAGCTTCTATGGCTCTGAGGACAGAAG | INFO_REALIGN_3_PRIME | |||||
|
chr1:22570496
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(128): Show |
a0000a0001a0002others(7): Show | a0000c0007a0000c0041a0000c0042others(29): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(64): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(118): Show | 131 | 342 | 0.3830 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 2/16 | c.159+1143A>G | ||||||
|
chr1:22571835
|
G | A | intron_variant | MODIFIER | HG00735.hp1 HG01106.hp2 HG02615.hp2 others(1): Show |
a0000a0001 | a0000c0007a0001c0001a0001c0002 | a0000c0007t0010a0001c0001t0025a0001c0002t0022 | a0000c0007t0010g0158a0001c0001t0025g0157a0001c0002t0022g0156others(1): Show | 4 | 342 | 0.0117 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 2/16 | c.159+2482G>A | ||||||
|
chr1:22571900
|
G | A | intron_variant | MODIFIER | HG00735.hp1 HG01106.hp2 HG02615.hp2 others(1): Show |
a0000a0001 | a0000c0007a0001c0001a0001c0002 | a0000c0007t0010a0001c0001t0025a0001c0002t0022 | a0000c0007t0010g0158a0001c0001t0025g0157a0001c0002t0022g0156others(1): Show | 4 | 342 | 0.0117 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 2/16 | c.159+2547G>A | ||||||
|
chr1:22572518
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(187): Show |
a0000a0001a0002others(12): Show | a0000c0007a0000c0041a0000c0042others(36): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(80): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(175): Show | 190 | 342 | 0.5556 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 2/16 | c.159+3165T>C | ||||||
|
chr1:22575250
|
CTTATTA | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(71): Show |
a0000a0001a0002others(4): Show | a0000c0007a0001c0001a0001c0002others(11): Show | a0000c0007t0010a0001c0001t0002a0001c0001t0010others(33): Show | a0000c0007t0010g0158a0001c0001t0002g0070a0001c0001t0010g0168others(65): Show | 74 | 342 | 0.2164 | -6 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 2/16 | c.160-961_160-956delATTATT | INFO_REALIGN_3_PRIME | |||||
|
chr1:22577857
|
T | TGTGC | intron_variant | MODIFIER | HG00140.hp1 HG00323.hp1 HG00639.hp2 others(13): Show |
a0000a0001a0002others(1): Show | a0000c0007a0001c0001a0001c0002others(3): Show | a0000c0007t0010a0001c0001t0025a0001c0002t0007others(8): Show | a0000c0007t0010g0158a0001c0001t0025g0157a0001c0002t0007g0173others(13): Show | 16 | 342 | 0.0468 | 4 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.823+977_823+978insGTGC | ||||||
|
chr1:22577861
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00323.hp1 HG00639.hp2 others(13): Show |
a0000a0001a0002others(1): Show | a0000c0007a0001c0001a0001c0002others(3): Show | a0000c0007t0010a0001c0001t0025a0001c0002t0007others(8): Show | a0000c0007t0010g0158a0001c0001t0025g0157a0001c0002t0007g0173others(13): Show | 16 | 342 | 0.0468 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.823+981T>C | ||||||
|
chr1:22577937
|
GTA | G | intron_variant | MODIFIER | HG00735.hp1 HG01106.hp2 HG02559.hp1 others(2): Show |
a0000a0001a0002 | a0000c0007a0001c0001a0001c0002others(1): Show | a0000c0007t0010a0001c0001t0025a0001c0002t0022others(1): Show | a0000c0007t0010g0158a0001c0001t0025g0157a0001c0002t0022g0156others(2): Show | 5 | 342 | 0.0146 | -2 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.823+1059_823+1060delAT | INFO_REALIGN_3_PRIME | |||||
|
chr1:22577990
|
C | CGTGTGTG others(1235): Show |
intron_variant | MODIFIER | HG00735.hp1 | a0000 | a0000c0007 | a0000c0007t0010 | a0000c0007t0010g0158 | 1 | 342 | 0.0029 | 1242 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.823+1110_823+1111insGTGTGTGCGTGCATGTGTGCGTGAGTGTATGTATGCATGTGTGTGCATGTGCGTAAGTATGTGTGCATGTGTGCGTGAGTGTATGTGTGTATGTATGCGTGTGTGTGCATGTGTGCGTGAGTATGTGCATTGAGTGCATGCACATGTGTGCATGAGTATGTATGCGTGTATTCGTGTGTGCATGTGCGTGAGTGTATGTGCATGTGTGCATGTATGCGTATGTATGCATGCGTGTGCATGTGTGACTATGTATGCATGTGTGTATGTGCATGTGTGTGAGCGTATGTATGCATGTGTGTGCCTGTGTGCGAGTGTACGCATATGTGCGCATGTGTGCATGTGTGCATTTTTGTATGCATGTGTTTGCGCATGTGTGCGTTGAGTATTGTGCATGTGTGCATGAGTGTATATGTGCATGTGTACGTGTGCATGTGTGCGTGGGTGTATGCATGTGCGTGTGCATGAGTGTATGTGTGCGTTTGTGTGCGTGTGCGTGAGTGTACCAATGTGTGTGCATGAGTGTGTGCATATGTGTGCATGAGTGTGTGTATGTGCATCTGTGCAGTTGTGTGCATCTGCGTATGTGCATGTGTGCGTGAGTGTATGTATGCATGTCTATGTATACGTGTGCATGTGTGTATGTGTGCGTGTGTGCATATGTGCGTGAGTGTGCATGTGTGCATGAGTGTATGTATGCATGTATGTGTGTGCCTGTGCATGTGTATGTGTGCCTGTGTGTGTGCATGTGTGCATGTGCGTGAGTGTATGTGTGCGTGTGTGTGTGCAATGTGCGTGTGCATGTGTGTGAGTGTATGCATGTGTGCGTGCACATGTGTGCGAGTGTATGTGTGCATGTGTGCATGAGTGTTCATGTGTGTGCATGTGCATGAGTGTATATATGCGTGAGTGTATGCATGTGTGCGTGTGTGCATGTATGTGCATGTGTGCGTGAGTGTACGCATGTGTGCATGAATGTGTGCATGTGTGCATTTTTGTATGCATGTTTGCGCATGTGTGCGTTTATTGTGCATGTGTGCATGTTTGTGTGCATGTGTATGTGTGCATGTGTGCGTGAGTGTATGCATGTGTGTGCATGTGCCAGTGTAGTGTGCTTGTGTGTGCATGTGTGCATGAGTGTGTGTGCATGTGTGTATGTGTGCATATGTATGCATGTGCATGTGTGCATCTGTGTGTGTGCATGTGTGTGCATGTGTGCGTATGTATGCATGTGTGCGTGAATGT | ||||||
|
chr1:22578079
|
ATG | A | intron_variant | MODIFIER | HG00642.hp1 HG00735.hp1 HG01081.hp2 others(10): Show |
a0000a0001a0003 | a0000c0007a0001c0001a0001c0002others(1): Show | a0000c0007t0010a0001c0001t0001a0001c0001t0025others(2): Show | a0000c0007t0010g0158a0001c0001t0001g0015a0001c0001t0001g0199others(8): Show | 13 | 342 | 0.0380 | -2 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.823+1206_823+1207delTG | INFO_REALIGN_3_PRIME | |||||
|
chr1:22578182
|
G | A | intron_variant | MODIFIER | HG00140.hp1 HG00323.hp1 HG00639.hp2 others(80): Show |
a0000a0001a0002others(4): Show | a0000c0007a0000c0041a0000c0042others(21): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(43): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(75): Show | 83 | 342 | 0.2427 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.823+1302G>A | ||||||
|
chr1:22578185
|
C | T | intron_variant | MODIFIER | HG00140.hp1 HG00323.hp1 HG00639.hp2 others(80): Show |
a0000a0001a0002others(4): Show | a0000c0007a0000c0041a0000c0042others(21): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(43): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(75): Show | 83 | 342 | 0.2427 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.823+1305C>T | ||||||
|
chr1:22578203
|
C | CAT | intron_variant | MODIFIER | HG00140.hp1 HG00323.hp1 HG00639.hp2 others(84): Show |
a0000a0001a0002others(5): Show | a0000c0007a0000c0041a0000c0042others(22): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(45): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(78): Show | 87 | 342 | 0.2544 | 2 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.823+1323_823+1324insAT | ||||||
|
chr1:22578213
|
CGTGT | C | intron_variant | MODIFIER | HG00140.hp1 HG00323.hp1 HG00639.hp2 others(15): Show |
a0000a0001a0002others(2): Show | a0000c0007a0001c0001a0001c0002others(4): Show | a0000c0007t0010a0001c0001t0025a0001c0002t0007others(10): Show | a0000c0007t0010g0158a0001c0001t0025g0157a0001c0002t0007g0173others(15): Show | 18 | 342 | 0.0526 | -4 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.823+1335_823+1338delTGTG | INFO_REALIGN_3_PRIME | |||||
|
chr1:22578364
|
G | A | intron_variant | MODIFIER | HG00140.hp1 HG00323.hp1 HG00639.hp2 others(38): Show |
a0000a0001a0002others(3): Show | a0000c0007a0001c0001a0001c0002others(6): Show | a0000c0007t0010a0001c0001t0002a0001c0001t0010others(22): Show | a0000c0007t0010g0158a0001c0001t0002g0070a0001c0001t0010g0168others(36): Show | 41 | 342 | 0.1199 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.823+1484G>A | ||||||
|
chr1:22578394
|
C | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(117): Show |
a0000a0001a0002others(7): Show | a0000c0007a0000c0041a0000c0042others(28): Show | a0000c0007t0010a0000c0041t0001a0000c0042t0003others(60): Show | a0000c0007t0010g0158a0000c0041t0001g0031a0000c0042t0003g0106others(109): Show | 120 | 342 | 0.3509 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.823+1514C>G | ||||||
|
chr1:22578645
|
ATG | A | intron_variant | MODIFIER | HG00140.hp1 HG00323.hp1 HG00639.hp2 others(43): Show |
a0000a0001a0002others(2): Show | a0000c0007a0001c0001a0001c0002others(5): Show | a0000c0007t0010a0001c0001t0002a0001c0001t0010others(22): Show | a0000c0007t0010g0158a0001c0001t0002g0070a0001c0001t0010g0168others(41): Show | 46 | 342 | 0.1345 | -2 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.823+1772_823+1773delTG | INFO_REALIGN_3_PRIME | |||||
|
chr1:22578697
|
CTG | C | intron_variant | MODIFIER | HG00642.hp2 HG00733.hp1 HG00735.hp1 others(28): Show |
a0000a0001a0002others(1): Show | a0000c0007a0001c0001a0001c0002others(4): Show | a0000c0007t0010a0001c0001t0002a0001c0001t0010others(14): Show | a0000c0007t0010g0158a0001c0001t0002g0070a0001c0001t0010g0168others(24): Show | 31 | 342 | 0.0906 | -2 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.823+1825_823+1826delGT | INFO_REALIGN_3_PRIME | |||||
|
chr1:22578870
|
C | T | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(113): Show |
a0000a0001a0002others(8): Show | a0000c0007a0000c0041a0000c0042others(29): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(56): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(105): Show | 116 | 342 | 0.3392 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.823+1990C>T | ||||||
|
chr1:22578923
|
T | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(124): Show |
a0000a0001a0002others(7): Show | a0000c0007a0000c0041a0000c0042others(29): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(63): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(114): Show | 127 | 342 | 0.3714 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.823+2043T>G | ||||||
|
chr1:22578957
|
C | A | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(121): Show |
a0000a0001a0002others(7): Show | a0000c0007a0000c0041a0000c0042others(28): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(62): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(112): Show | 124 | 342 | 0.3626 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.823+2077C>A | ||||||
|
chr1:22578976
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(138): Show |
a0000a0001a0002others(9): Show | a0000c0007a0000c0041a0000c0042others(32): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(67): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(127): Show | 141 | 342 | 0.4123 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.823+2096T>C | ||||||
|
chr1:22578993
|
A | G | intron_variant | MODIFIER | HG00735.hp1 HG01106.hp2 HG02615.hp2 others(1): Show |
a0000a0001 | a0000c0007a0001c0001a0001c0002 | a0000c0007t0010a0001c0001t0025a0001c0002t0022 | a0000c0007t0010g0158a0001c0001t0025g0157a0001c0002t0022g0156others(1): Show | 4 | 342 | 0.0117 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.823+2113A>G | ||||||
|
chr1:22579084
|
CGTGCATG others(15): Show |
C | intron_variant | MODIFIER | HG00140.hp1 HG00323.hp1 HG00639.hp2 others(37): Show |
a0000a0001a0002others(3): Show | a0000c0007a0001c0001a0001c0002others(6): Show | a0000c0007t0010a0001c0001t0002a0001c0001t0010others(21): Show | a0000c0007t0010g0158a0001c0001t0002g0070a0001c0001t0010g0168others(35): Show | 40 | 342 | 0.1170 | -22 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.823+2215_823+2236delGCATGTGTATGTGTGCATGTGT | INFO_REALIGN_3_PRIME | |||||
|
chr1:22579131
|
A | ATG | intron_variant | MODIFIER | HG00140.hp1 HG00323.hp1 HG00639.hp2 others(20): Show |
a0000a0001a0002others(2): Show | a0000c0007a0001c0001a0001c0002others(5): Show | a0000c0007t0010a0000c0007t0035a0001c0001t0008others(13): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0001c0001t0008g0006others(19): Show | 23 | 342 | 0.0673 | 2 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.823+2260_823+2261dupTG | INFO_REALIGN_3_PRIME | |||||
|
chr1:22579354
|
C | CGT | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(96): Show |
a0000a0001a0002others(6): Show | a0000c0007a0000c0041a0000c0042others(25): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(49): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(88): Show | 99 | 342 | 0.2895 | 2 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.823+2481_823+2482dupGT | INFO_REALIGN_3_PRIME | |||||
|
chr1:22579754
|
A | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(139): Show |
a0000a0001a0002others(9): Show | a0000c0007a0000c0041a0000c0042others(32): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(68): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(128): Show | 142 | 342 | 0.4152 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.823+2874A>C | ||||||
|
chr1:22579761
|
G | A | intron_variant | MODIFIER | HG00735.hp1 HG02615.hp2 NA18522.hp2 |
a0000a0001 | a0000c0007a0001c0002 | a0000c0007t0010a0001c0002t0022 | a0000c0007t0010g0158a0001c0002t0022g0156a0001c0002t0022g0159 | 3 | 342 | 0.0088 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.823+2881G>A | ||||||
|
chr1:22580989
|
A | G | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(323): Show |
a0000a0001a0002others(16): Show | a0000c0007a0000c0041a0000c0042others(44): Show | a0000c0007t0001a0000c0007t0010a0000c0007t0035others(98): Show | a0000c0007t0001g0005a0000c0007t0001g0218a0000c0007t0001g0269others(295): Show | 326 | 342 | 0.9532 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.823+4109A>G | ||||||
|
chr1:22582221
|
C | T | intron_variant | MODIFIER | HG00140.hp1 HG00323.hp1 HG00639.hp2 others(49): Show |
a0000a0001a0002others(3): Show | a0000c0007a0000c0041a0000c0042others(17): Show | a0000c0007t0010a0000c0041t0001a0000c0042t0003others(28): Show | a0000c0007t0010g0158a0000c0041t0001g0031a0000c0042t0003g0106others(47): Show | 52 | 342 | 0.1521 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.824-4259C>T | ||||||
|
chr1:22582228
|
G | A | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(139): Show |
a0000a0001a0002others(9): Show | a0000c0007a0000c0041a0000c0042others(32): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(68): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(128): Show | 142 | 342 | 0.4152 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.824-4252G>A | ||||||
|
chr1:22582525
|
CA | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(139): Show |
a0000a0001a0002others(9): Show | a0000c0007a0000c0041a0000c0042others(32): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(68): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(128): Show | 142 | 342 | 0.4152 | -1 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.824-3953delA | INFO_REALIGN_3_PRIME | |||||
|
chr1:22583224
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(139): Show |
a0000a0001a0002others(9): Show | a0000c0007a0000c0041a0000c0042others(32): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(68): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(128): Show | 142 | 342 | 0.4152 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.824-3256A>G | ||||||
|
chr1:22583376
|
C | T | intron_variant | MODIFIER | HG00140.hp1 HG00639.hp2 HG00735.hp1 others(12): Show |
a0000a0001a0002others(1): Show | a0000c0007a0001c0001a0001c0002others(3): Show | a0000c0007t0010a0001c0001t0025a0001c0002t0007others(8): Show | a0000c0007t0010g0158a0001c0001t0025g0157a0001c0002t0007g0173others(12): Show | 15 | 342 | 0.0439 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.824-3104C>T | ||||||
|
chr1:22583682
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00323.hp1 HG00639.hp2 others(72): Show |
a0000a0001a0002others(6): Show | a0000c0007a0000c0041a0000c0042others(21): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(39): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(69): Show | 75 | 342 | 0.2193 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.824-2798T>C | ||||||
|
chr1:22584670
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(134): Show |
a0000a0001a0002others(9): Show | a0000c0007a0000c0041a0000c0042others(30): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(67): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(123): Show | 137 | 342 | 0.4006 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.824-1810A>G | ||||||
|
chr1:22584885
|
G | A | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(125): Show |
a0000a0001a0002others(8): Show | a0000c0007a0000c0041a0000c0042others(29): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(64): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(114): Show | 128 | 342 | 0.3743 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.824-1595G>A | ||||||
|
chr1:22585050
|
T | TGTGTGTG others(5): Show |
intron_variant | MODIFIER | HG00735.hp1 HG02615.hp2 HG02895.hp2 |
a0000a0001 | a0000c0007a0001c0002 | a0000c0007t0010a0001c0002t0002a0001c0002t0022 | a0000c0007t0010g0158a0001c0002t0002g0152a0001c0002t0022g0156 | 3 | 342 | 0.0088 | 12 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.824-1429_824-1428insTGTGTGTGTGCG | INFO_REALIGN_3_PRIME | |||||
|
chr1:22585912
|
A | G | intron_variant | MODIFIER | HG00438.hp2 HG00597.hp2 HG00733.hp2 others(69): Show |
a0000a0001a0002others(3): Show | a0000c0007a0000c0041a0000c0042others(14): Show | a0000c0007t0010a0000c0041t0001a0000c0042t0003others(27): Show | a0000c0007t0010g0158a0000c0041t0001g0031a0000c0042t0003g0106others(67): Show | 72 | 342 | 0.2105 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.824-568A>G | ||||||
|
chr1:22585947
|
C | T | intron_variant | MODIFIER | HG00438.hp2 HG00597.hp2 HG00733.hp2 others(87): Show |
a0000a0001a0002others(4): Show | a0000c0007a0000c0041a0000c0042others(17): Show | a0000c0007t0010a0000c0041t0001a0000c0042t0003others(33): Show | a0000c0007t0010g0158a0000c0041t0001g0031a0000c0042t0003g0106others(81): Show | 90 | 342 | 0.2632 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.824-533C>T | ||||||
|
chr1:22585948
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(178): Show |
a0000a0001a0002others(12): Show | a0000c0007a0000c0041a0000c0042others(33): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(75): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(165): Show | 181 | 342 | 0.5292 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.824-532A>G | ||||||
|
chr1:22586326
|
T | C | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(335): Show |
a0000a0001a0002others(16): Show | a0000c0007a0000c0041a0000c0042others(44): Show | a0000c0007t0001a0000c0007t0003a0000c0007t0010others(100): Show | a0000c0007t0001g0005a0000c0007t0001g0218a0000c0007t0001g0269others(307): Show | 338 | 342 | 0.9883 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.824-154T>C | ||||||
|
chr1:22586372
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(178): Show |
a0000a0001a0002others(12): Show | a0000c0007a0000c0041a0000c0042others(33): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(75): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(165): Show | 181 | 342 | 0.5292 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.824-108A>G | ||||||
|
chr1:22586417
|
C | T | intron_variant | MODIFIER | HG00438.hp2 HG00597.hp2 HG00735.hp1 others(40): Show |
a0000a0001a0015others(1): Show | a0000c0007a0001c0001a0001c0002others(4): Show | a0000c0007t0010a0001c0001t0002a0001c0001t0007others(11): Show | a0000c0007t0010g0158a0001c0001t0002g0011a0001c0001t0002g0133others(39): Show | 43 | 342 | 0.1257 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 3/16 | c.824-63C>T | ||||||
|
chr1:22586660
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(184): Show |
a0000a0001a0002others(12): Show | a0000c0007a0000c0041a0000c0042others(35): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(78): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(171): Show | 187 | 342 | 0.5468 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 4/16 | c.979+25T>C | ||||||
|
chr1:22586780
|
T | TGG | intron_variant | MODIFIER | HG00733.hp2 HG00735.hp1 HG00735.hp2 others(55): Show |
a0000a0001a0002others(3): Show | a0000c0007a0001c0001a0001c0002others(12): Show | a0000c0007t0010a0001c0001t0002a0001c0001t0007others(22): Show | a0000c0007t0010g0158a0001c0001t0002g0011a0001c0001t0002g0133others(53): Show | 58 | 342 | 0.1696 | 2 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 4/16 | c.979+152_979+153dupGG | INFO_REALIGN_3_PRIME | |||||
|
chr1:22587500
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(182): Show |
a0000a0001a0002others(12): Show | a0000c0007a0000c0041a0000c0042others(33): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(77): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(169): Show | 185 | 342 | 0.5409 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 4/16 | c.979+865A>G | ||||||
|
chr1:22587614
|
G | T | intron_variant | MODIFIER | HG00438.hp2 HG00597.hp2 HG00733.hp2 others(69): Show |
a0000a0001a0002others(3): Show | a0000c0007a0000c0041a0000c0042others(14): Show | a0000c0007t0010a0000c0041t0001a0000c0042t0003others(27): Show | a0000c0007t0010g0158a0000c0041t0001g0031a0000c0042t0003g0106others(67): Show | 72 | 342 | 0.2105 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 4/16 | c.979+979G>T | ||||||
|
chr1:22588266
|
A | G | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(195): Show |
a0000a0001a0002others(12): Show | a0000c0007a0000c0041a0000c0042others(35): Show | a0000c0007t0003a0000c0007t0010a0000c0007t0035others(82): Show | a0000c0007t0003g0197a0000c0007t0010g0158a0000c0007t0035g0006others(182): Show | 198 | 342 | 0.5790 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 4/16 | c.980-605A>G | ||||||
|
chr1:22588280
|
G | A | intron_variant | MODIFIER | HG00438.hp2 HG00597.hp2 HG00733.hp2 others(71): Show |
a0000a0001a0002others(4): Show | a0000c0007a0000c0041a0000c0042others(14): Show | a0000c0007t0010a0000c0041t0001a0000c0042t0003others(27): Show | a0000c0007t0010g0158a0000c0041t0001g0031a0000c0042t0003g0106others(68): Show | 74 | 342 | 0.2164 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 4/16 | c.980-591G>A | ||||||
|
chr1:22588358
|
G | A | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(178): Show |
a0000a0001a0002others(12): Show | a0000c0007a0000c0041a0000c0042others(33): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(76): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(165): Show | 181 | 342 | 0.5292 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 4/16 | c.980-513G>A | ||||||
|
chr1:22588537
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00280.hp1 others(185): Show |
a0000a0001a0002others(13): Show | a0000c0007a0000c0041a0000c0042others(36): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(79): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(172): Show | 188 | 342 | 0.5497 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 4/16 | c.980-334T>C | ||||||
|
chr1:22588588
|
G | A | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(175): Show |
a0000a0001a0002others(12): Show | a0000c0007a0000c0041a0000c0042others(33): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(74): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(162): Show | 178 | 342 | 0.5205 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 4/16 | c.980-283G>A | ||||||
|
chr1:22589260
|
T | C | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(182): Show |
a0000a0001a0002others(13): Show | a0000c0007a0000c0041a0000c0042others(36): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(79): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(170): Show | 185 | 342 | 0.5409 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 5/16 | c.1315+54T>C | ||||||
|
chr1:22589485
|
A | T | intron_variant | MODIFIER | HG00140.hp1 HG00140.hp2 HG00323.hp1 others(184): Show |
a0000a0001a0002others(12): Show | a0000c0007a0000c0041a0000c0042others(35): Show | a0000c0007t0010a0000c0007t0035a0000c0041t0001others(78): Show | a0000c0007t0010g0158a0000c0007t0035g0006a0000c0041t0001g0031others(171): Show | 187 | 342 | 0.5468 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 5/16 | c.1315+279A>T | ||||||
|
chr1:22591161
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp2 others(276): Show |
a0000a0001a0002others(13): Show | a0000c0007a0000c0041a0000c0042others(38): Show | a0000c0007t0001a0000c0007t0003a0000c0007t0010others(89): Show | a0000c0007t0001g0005a0000c0007t0001g0218a0000c0007t0001g0269others(248): Show | 279 | 342 | 0.8158 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 5/16 | c.1315+1955G>A | ||||||
|
chr1:22591984
|
A | T | intron_variant | MODIFIER | HG00735.hp1 NA19030.hp1 |
a0000a0001 | a0000c0007a0001c0001 | a0000c0007t0010a0001c0001t0008 | a0000c0007t0010g0158a0001c0001t0008g0145 | 2 | 342 | 0.0059 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 5/16 | c.1316-1342A>T | ||||||
|
chr1:22599736
|
G | GA | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00280.hp1 others(183): Show |
a0000a0001a0003others(4): Show | a0000c0007a0000c0041a0000c0042others(21): Show | a0000c0007t0001a0000c0007t0003a0000c0007t0010others(46): Show | a0000c0007t0001g0005a0000c0007t0001g0218a0000c0007t0001g0269others(167): Show | 186 | 342 | 0.5439 | 1 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 13/16 | c.2388+690dupA | INFO_REALIGN_3_PRIME | |||||
|
chr1:22599827
|
G | GA | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(312): Show |
a0000a0001a0002others(16): Show | a0000c0007a0000c0041a0000c0042others(42): Show | a0000c0007t0001a0000c0007t0010a0000c0007t0035others(94): Show | a0000c0007t0001g0218a0000c0007t0001g0269a0000c0007t0010g0158others(286): Show | 315 | 342 | 0.9211 | 1 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 13/16 | c.2388+781dupA | INFO_REALIGN_3_PRIME | |||||
|
chr1:22599922
|
G | A | intron_variant | MODIFIER | HG00099.hp1 HG00099.hp2 HG00140.hp1 others(338): Show |
a0000a0001a0002others(16): Show | a0000c0007a0000c0041a0000c0042others(44): Show | a0000c0007t0001a0000c0007t0003a0000c0007t0010others(100): Show | a0000c0007t0001g0005a0000c0007t0001g0218a0000c0007t0001g0269others(310): Show | 341 | 342 | 0.9971 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 13/16 | c.2389-739G>A | ||||||
|
chr1:22601274
|
A | C | intron_variant | MODIFIER | HG00735.hp1 | a0000 | a0000c0007 | a0000c0007t0010 | a0000c0007t0010g0158 | 1 | 342 | 0.0029 | 0 | EPHA8 | ENSG00000070886.12 | transcript | ENST00000166244.8 | protein_coding | 15/16 | c.2730-26A>C |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
ahapid | alen | total | AFR | AMR | EAS | EUR | SAS | aseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| EPHA8 | 0/0 | a0000 | 0 | 8 | 0 | 2 | 6 | 0 | 0 | subcellular location copy fasta | chr1 | 22558489 | 22608595 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
chapid | clen | total | AFR | AMR | EAS | EUR | SAS | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| EPHA8 | 0/0 | c0007 | 3019 | 6 | 0 | 2 | 4 | 0 | 0 | copy fasta | chr1 | 22558489 | 22608595 |
| genename | grch38/chm13v2 | thapid | tlen | total | AFR | AMR | EAS | EUR | SAS | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| EPHA8 | 0/0 | t0010 | 1997 | 5 | 4 | 1 | 0 | 0 | 0 | copy fasta | chr1 | 22558489 | 22608595 |
| genename | grch38/chm13v2 | ghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| EPHA8 | 0/0 | g0158 | 1 | 0 | 1 | 0 | 0 | 0 | chr1 | 22558489 | 22608595 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
achapid | total | AFR | AMR | EAS | EUR | SAS | clen | cseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| EPHA8 | 0/0 | a0000c0007 | 6 | 0 | 2 | 4 | 0 | 0 | 3019 | copy fasta | chr1 | 22558489 | 22608595 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
acthapid | total | AFR | AMR | EAS | EUR | SAS | tlen | tseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| EPHA8 | 0/0 | a0000c0007t0010 | 1 | 0 | 1 | 0 | 0 | 0 | 5015 | copy fasta | chr1 | 22558489 | 22608595 |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2 |
actghapid | total | AFR | AMR | EAS | EUR | SAS | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|
| EPHA8 | 0/0 | a0000c0007t0010g0158 | 1 | 0 | 1 | 0 | 0 | 0 | chr1 | 22558489 | 22608595 |
Click to load Haplotype QTL data...
| pos | S. Strand |
E# Exon Number |
max | median | min | diff | type | haplotypeid | max_hap_list | min_hap_list | symbol | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 22563729 | + | 1 | -0.7889 | -0.7889 | -0.7889 | 0.0000 | acceptor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22569289 | + | 2 | 0.9066 | 0.9066 | 0.9066 | 0.0000 | donor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22569353 | + | 2 | -0.9371 | -0.9371 | -0.9371 | 0.0000 | acceptor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22576217 | + | 3 | 0.9674 | 0.9674 | 0.9674 | 0.0000 | donor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22576880 | + | 3 | -0.7917 | -0.7917 | -0.7917 | 0.0000 | acceptor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22586480 | + | 4 | 0.9712 | 0.9712 | 0.9712 | 0.0000 | donor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22586635 | + | 4 | -0.9852 | -0.9852 | -0.9852 | 0.0000 | acceptor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22588871 | + | 5 | 0.9953 | 0.9953 | 0.9953 | 0.0000 | donor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22589206 | + | 5 | -0.9978 | -0.9978 | -0.9978 | 0.0000 | acceptor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22593326 | + | 6 | 0.9787 | 0.9787 | 0.9787 | 0.0000 | donor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22593450 | + | 6 | -0.9950 | -0.9950 | -0.9950 | 0.0000 | acceptor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22593524 | + | 7 | 0.9922 | 0.9922 | 0.9922 | 0.0000 | donor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22593686 | + | 7 | -0.9856 | -0.9856 | -0.9856 | 0.0000 | acceptor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22595230 | + | 8 | 0.9959 | 0.9959 | 0.9959 | 0.0000 | donor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22595323 | + | 8 | -0.9974 | -0.9973 | -0.9974 | 0.0000 | acceptor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22596106 | + | 9 | 0.9842 | 0.9841 | 0.9842 | 0.0000 | donor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22596173 | + | 9 | -0.9984 | -0.9984 | -0.9984 | 0.0000 | acceptor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22597312 | + | 10 | 0.9864 | 0.9864 | 0.9864 | 0.0000 | donor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22597476 | + | 10 | -0.9989 | -0.9989 | -0.9989 | 0.0000 | acceptor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22597676 | + | 11 | 0.9951 | 0.9951 | 0.9951 | 0.0000 | donor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22597861 | + | 11 | -0.9912 | -0.9912 | -0.9912 | 0.0000 | acceptor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22598151 | + | 12 | 0.7920 | 0.7920 | 0.7920 | 0.0000 | donor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22598212 | + | 12 | -0.9865 | -0.9865 | -0.9865 | 0.0000 | acceptor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22598838 | + | 13 | 0.9710 | 0.9710 | 0.9710 | 0.0000 | donor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22599047 | + | 13 | -0.9972 | -0.9972 | -0.9972 | 0.0000 | acceptor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22600661 | + | 14 | 0.9986 | 0.9986 | 0.9986 | 0.0000 | donor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22600810 | + | 14 | -0.9975 | -0.9975 | -0.9975 | 0.0000 | acceptor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22600898 | + | 15 | 0.9672 | 0.9672 | 0.9672 | 0.0000 | donor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22601088 | + | 15 | -0.9249 | -0.9249 | -0.9249 | 0.0000 | acceptor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22601300 | + | 16 | 0.9089 | 0.9089 | 0.9089 | 0.0000 | donor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22601473 | + | 16 | -0.9433 | -0.9433 | -0.9433 | 0.0000 | acceptor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| 22601627 | + | 17 | 0.8853 | 0.8853 | 0.8853 | 0.0000 | donor | a0000c0007t0010g0158 | HG00735.hp1 | HG00735.hp1 | EPHA8 | chr1 | 22558489 | 22608595 |
| pos | annotationhgvs_chgvs_p | clinvarid | clnsig | geneinfo | mc | clndisdb | strand strand
|
ahapid ahapid_count
|
chapid chapid count
|
thapid thapid_count
|
ghapid ghapid_count
|
AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
impact | chr | ref | alt | external |
|---|
| CHR:POS | annotationhgvs_chgvs_p | disease trait-log10podds or beta | AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
study | initial sample size/replication sample size | report genes | mapped gene | strongest snp risk allele | strand strand
|
impact | chr | ref | alt |
|---|