| geneid | 5151 |
|---|---|
| ensemblid | ENSG00000073417.15 |
| hgncid | 8793 |
| symbol | PDE8A |
| name | phosphodiesterase 8A |
| refseq_nuc | NM_002605.3 |
| refseq_prot | NP_002596.1 |
| ensembl_nuc | ENST00000394553.6 |
| ensembl_prot | ENSP00000378056.1 |
| mane_status | MANE Select |
| chr | chr15 |
| start | 84981856 |
| end | 85139142 |
| strand | + |
| ver | v1.2 |
| region | chr15:84981856-85139142 |
| region5000 | chr15:84976856-85144142 |
| regionname0 | PDE8A_chr15_84981856_85139142 |
| regionname5000 | PDE8A_chr15_84976856_85144142 |
| chr:pos | ref | alt | af | annotation | impact | samples | AHAPIDS | ACHAPIDS | ACTHAPIDS | ACTGHAPIDS | ac | an | len | genename | geneid | featuretype | featureid | transcript_biotype | rank | hgvs_c | hgvs_p | cdna_pos_length | cds_pos_length | aa_pos_length | distance | status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr15:84982131
|
CCCGCCAG others(16): Show |
C | 0.0029 | start_retained_variant | MODIFIER | NA18966.hp2 | a0001 | a0001c0001 | a0001c0001t0008 | a0001c0001t0008g0016 | 1 | 344 | -23 | PDE8A | ENSG00000073417.15 | transcript | ENST00000394553.6 | protein_coding | 1/22 | c.-23_-1delGTGTCCGCGGCGCCGCCGCCAGC | INFO_REALIGN_3_PRIME |
| genename | grch38/chm13v2 1/0: The haplotype type is the same as GRCh380/1: The haplotype type is the same as CHM13v20/0: The haplotype type matches neither GRCh38 nor CHM13v21/1: The haplotype type is the same on both GRCh38 and CHM13v2
|
ahapid | alen | total | AFR | AMR | EAS | EUR | SAS | aseq | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| PDE8A | 1/1 | a0001 | 829 | 326 | 86 | 53 | 139 | 15 | 31 | subcellular location copy fasta | chr15 | 84976856 | 85144142 |
Click to load Haplotype QTL data...
| pos | S. Strand |
E# Exon Number |
max | median | min | diff | type | haplotypeid | max_hap_list | min_hap_list | symbol | chr | start | end |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 84982348 | + | 1 | -0.9561 | -0.9536 | -0.9464 | 0.0097 | acceptor | a0001 | HG02109.hp1 HG02976.hp2 |
NA18981.hp2 NA18995.hp2 NA18998.hp1 NA19004.hp2 |
PDE8A | chr15 | 84976856 | 85144142 |
| 85064370 | + | 2 | 0.9963 | 0.9951 | 0.9926 | 0.0037 | donor | a0001 | HG02109.hp1 HG02145.hp2 HG02572.hp2 HG02630.hp1 HG02717.hp1 others(6): Show |
HG03490.hp1 HG03492.hp1 |
PDE8A | chr15 | 84976856 | 85144142 |
| 85064426 | + | 2 | -0.9982 | -0.9979 | -0.9972 | 0.0010 | acceptor | a0001 | HG01346.hp2 HG01884.hp1 HG01891.hp1 HG02280.hp2 HG02559.hp1 others(10): Show |
HG03490.hp1 HG03492.hp1 |
PDE8A | chr15 | 84976856 | 85144142 |
| 85067014 | + | 3 | 0.9923 | 0.9899 | 0.9873 | 0.0050 | donor | a0001 | HG01169.hp2 | HG02922.hp2 | PDE8A | chr15 | 84976856 | 85144142 |
| 85067204 | + | 3 | -0.9943 | -0.9911 | -0.9877 | 0.0066 | acceptor | a0001 | HG04204.hp2 NA20805.hp1 |
HG02717.hp1 HG02895.hp2 HG02965.hp2 HG03516.hp1 |
PDE8A | chr15 | 84976856 | 85144142 |
| 85075862 | + | 4 | 0.8588 | 0.8238 | 0.8044 | 0.0543 | donor | a0001 | HG01109.hp1 HG01256.hp2 |
NA20300.hp2 | PDE8A | chr15 | 84976856 | 85144142 |
| 85075918 | + | 4 | -0.8549 | -0.8054 | -0.7826 | 0.0723 | acceptor | a0001 | HG03139.hp1 | NA19058.hp2 NA19085.hp2 |
PDE8A | chr15 | 84976856 | 85144142 |
| 85076733 | + | 5 | 0.8352 | 0.7819 | 0.7514 | 0.0838 | donor | a0001 | HG03139.hp1 | NA18966.hp2 | PDE8A | chr15 | 84976856 | 85144142 |
| 85076787 | + | 5 | -0.9280 | -0.8923 | -0.8449 | 0.0831 | acceptor | a0001 | HG01070.hp1 HG01123.hp2 HG02683.hp2 |
NA20129.hp2 | PDE8A | chr15 | 84976856 | 85144142 |
| 85083556 | + | 6 | 0.9817 | 0.9769 | 0.9742 | 0.0076 | donor | a0001 | HG02976.hp1 HG03130.hp2 |
HG03453.hp1 | PDE8A | chr15 | 84976856 | 85144142 |
| 85083644 | + | 6 | -0.9888 | -0.9857 | -0.9828 | 0.0060 | acceptor | a0001 | HG02976.hp1 | HG04204.hp2 | PDE8A | chr15 | 84976856 | 85144142 |
| 85089338 | + | 7 | 0.9950 | 0.9944 | 0.9940 | 0.0010 | donor | a0001 | NA19086.hp1 | HG03704.hp1 | PDE8A | chr15 | 84976856 | 85144142 |
| 85089416 | + | 7 | -0.9895 | -0.9861 | -0.9845 | 0.0050 | acceptor | a0001 | HG06807.hp2 | HG01243.hp2 HG02109.hp2 HG02809.hp1 HG03540.hp2 HG06807.hp1 others(1): Show |
PDE8A | chr15 | 84976856 | 85144142 |
| 85091044 | + | 8 | 0.9328 | 0.9241 | 0.9161 | 0.0167 | donor | a0001 | HG01891.hp2 HG02145.hp1 HG02258.hp2 HG02886.hp1 HG03041.hp1 others(4): Show |
HG02738.hp1 | PDE8A | chr15 | 84976856 | 85144142 |
| 85091181 | + | 8 | -0.9591 | -0.9536 | -0.9453 | 0.0137 | acceptor | a0001 | HG00099.hp2 HG00735.hp2 HG01261.hp1 HG01978.hp2 NA19009.hp1 |
HG02738.hp1 | PDE8A | chr15 | 84976856 | 85144142 |
| 85097948 | + | 9 | 0.9494 | 0.9400 | 0.9305 | 0.0190 | donor | a0001 | HG02723.hp1 | NA19088.hp2 | PDE8A | chr15 | 84976856 | 85144142 |
| 85098036 | + | 9 | -0.9618 | -0.9560 | -0.9418 | 0.0200 | acceptor | a0001 | HG02723.hp1 NA21309.hp1 |
NA20805.hp1 | PDE8A | chr15 | 84976856 | 85144142 |
| 85100015 | + | 10 | 0.7046 | 0.6922 | 0.6666 | 0.0380 | donor | a0001 | NA18981.hp2 | NA18966.hp2 | PDE8A | chr15 | 84976856 | 85144142 |
| 85100066 | + | 10 | -0.8775 | -0.8687 | -0.8511 | 0.0265 | acceptor | a0001 | HG02723.hp1 | NA18966.hp2 | PDE8A | chr15 | 84976856 | 85144142 |
| 85100156 | + | 11 | 0.8517 | 0.8412 | 0.8177 | 0.0341 | donor | a0001 | HG01255.hp1 HG01433.hp2 HG02622.hp2 HG02647.hp1 HG02965.hp1 others(1): Show |
NA18966.hp2 | PDE8A | chr15 | 84976856 | 85144142 |
| 85100198 | + | 11 | -0.7962 | -0.7789 | -0.7659 | 0.0303 | acceptor | a0001 | HG02723.hp1 | NA18966.hp2 | PDE8A | chr15 | 84976856 | 85144142 |
| 85109053 | + | 12 | 0.9558 | 0.9371 | 0.9186 | 0.0372 | donor | a0001 | HG02015.hp1 | HG01884.hp1 HG02559.hp1 HG02922.hp1 HG02970.hp2 HG02976.hp1 others(2): Show |
PDE8A | chr15 | 84976856 | 85144142 |
| 85109130 | + | 12 | -0.9167 | -0.8799 | -0.8751 | 0.0415 | acceptor | a0001 | HG02015.hp1 | HG00639.hp1 | PDE8A | chr15 | 84976856 | 85144142 |
| 85113377 | + | 13 | 0.9743 | 0.9716 | 0.9683 | 0.0060 | donor | a0001 | HG02055.hp2 HG03130.hp2 |
HG01884.hp1 HG02559.hp1 HG02922.hp1 HG02970.hp2 HG02976.hp1 others(2): Show |
PDE8A | chr15 | 84976856 | 85144142 |
| 85113447 | + | 13 | -0.9489 | -0.9397 | -0.9220 | 0.0269 | acceptor | a0001 | HG02109.hp2 | HG02080.hp1 | PDE8A | chr15 | 84976856 | 85144142 |
| 85113873 | + | 14 | 0.9844 | 0.9790 | 0.9768 | 0.0077 | donor | a0001 | HG01243.hp2 HG02809.hp1 HG02809.hp2 HG03540.hp2 HG06807.hp1 others(1): Show |
HG03139.hp1 | PDE8A | chr15 | 84976856 | 85144142 |
| 85114037 | + | 14 | -0.9555 | -0.9443 | -0.9383 | 0.0172 | acceptor | a0001 | HG01891.hp2 HG02055.hp2 HG02145.hp1 HG02258.hp2 HG02647.hp2 others(9): Show |
HG02683.hp1 | PDE8A | chr15 | 84976856 | 85144142 |
| 85115439 | + | 15 | 0.9913 | 0.9893 | 0.9881 | 0.0032 | donor | a0001 | HG00733.hp1 HG01109.hp1 HG01175.hp1 HG01256.hp2 HG03471.hp1 others(1): Show |
HG03942.hp2 | PDE8A | chr15 | 84976856 | 85144142 |
| 85115487 | + | 15 | -0.9977 | -0.9955 | -0.9945 | 0.0032 | acceptor | a0001 | HG01243.hp2 HG02109.hp2 HG02809.hp1 HG02809.hp2 HG03540.hp2 others(2): Show |
NA19086.hp2 | PDE8A | chr15 | 84976856 | 85144142 |
| 85115984 | + | 16 | 0.9393 | 0.9290 | 0.9002 | 0.0391 | donor | a0001 | HG03209.hp1 | HG00741.hp2 HG01099.hp2 |
PDE8A | chr15 | 84976856 | 85144142 |
| 85116119 | + | 16 | -0.9121 | -0.8808 | -0.8641 | 0.0479 | acceptor | a0001 | NA18966.hp2 | HG02055.hp2 HG03130.hp2 |
PDE8A | chr15 | 84976856 | 85144142 |
| 85117641 | + | 17 | 0.9839 | 0.9706 | 0.9658 | 0.0181 | donor | a0001 | NA18966.hp2 | HG03491.hp1 | PDE8A | chr15 | 84976856 | 85144142 |
| 85117839 | + | 17 | -0.9819 | -0.9406 | -0.9171 | 0.0648 | acceptor | a0001 | NA18966.hp2 | HG01346.hp2 HG02280.hp2 HG02886.hp2 HG03041.hp2 HG03225.hp1 others(1): Show |
PDE8A | chr15 | 84976856 | 85144142 |
| 85120797 | + | 18 | 0.9958 | 0.9941 | 0.9917 | 0.0041 | donor | a0001 | HG00673.hp2 HG02165.hp2 |
HG00733.hp2 | PDE8A | chr15 | 84976856 | 85144142 |
| 85121014 | + | 18 | -0.9989 | -0.9987 | -0.9984 | 0.0004 | acceptor | a0001 | HG00621.hp2 NA18952.hp1 NA18970.hp2 NA18981.hp1 |
NA19030.hp1 | PDE8A | chr15 | 84976856 | 85144142 |
| 85123061 | + | 19 | 0.9371 | 0.9076 | 0.4961 | 0.4409 | donor | a0001 | NA19066.hp2 | HG00609.hp1 | PDE8A | chr15 | 84976856 | 85144142 |
| 85123193 | + | 19 | -0.9795 | -0.9733 | -0.9301 | 0.0495 | acceptor | a0001 | NA18942.hp1 NA18948.hp1 |
HG00609.hp1 | PDE8A | chr15 | 84976856 | 85144142 |
| 85126207 | + | 20 | 0.9939 | 0.9864 | 0.9348 | 0.0591 | donor | a0001 | NA18906.hp2 | HG02602.hp1 | PDE8A | chr15 | 84976856 | 85144142 |
| 85126374 | + | 20 | -0.9988 | -0.9983 | -0.9971 | 0.0017 | acceptor | a0001 | NA18906.hp2 | HG01255.hp1 | PDE8A | chr15 | 84976856 | 85144142 |
| 85136534 | + | 21 | 0.8888 | 0.8672 | 0.8332 | 0.0557 | donor | a0001 | HG02922.hp2 | HG00558.hp1 | PDE8A | chr15 | 84976856 | 85144142 |
| 85136663 | + | 21 | -0.9140 | -0.9053 | -0.8655 | 0.0485 | acceptor | a0001 | NA19011.hp2 | HG00621.hp2 NA18952.hp1 |
PDE8A | chr15 | 84976856 | 85144142 |
| 85137797 | + | 22 | 0.9190 | 0.9055 | 0.8472 | 0.0718 | donor | a0001 | NA20300.hp2 | HG00621.hp2 NA18952.hp1 |
PDE8A | chr15 | 84976856 | 85144142 |
| pos | annotationhgvs_chgvs_p | clinvarid | clnsig | geneinfo | mc | clndisdb | strand strand
|
ahapid ahapid_count
|
chapid chapid count
|
thapid thapid_count
|
ghapid ghapid_count
|
AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
impact | chr | ref | alt | external |
|---|
| CHR:POS | annotationhgvs_chgvs_p | disease trait-log10podds or beta | AHAPIDS ahapids
|
ACHAPIDS achapids
|
ACTHAPIDS acthapids
|
ACTGHAPIDS actghapids
|
haplotypeids haplotypeids
|
study | initial sample size/replication sample size | report genes | mapped gene | strongest snp risk allele | strand strand
|
impact | chr | ref | alt |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
chr15:85084724
|
c.635+1080G>C | Neurofibrillary tangles0.335526 | a0001a0002a0003a0005a0008 | a0001c0001a0001c0002a0002c0003a0003c0005a0005c0007others(1): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0008a0001c0002t0001others(4): Show | a0001c0001t0001g0001a0001c0001t0001g0005a0001c0001t0001g0006a0001c0001t0001g0007a0001c0001t0001g0008others(173): Show | HG00099.hp1 HG00280.hp1 HG00323.hp1 HG00423.hp1 HG00597.hp2 others(173): Show |
Sex differences in the genetic predictors of Alzhe others(17): Show |
2,701 European ancestry men/ | PDE8A | PDE8A | rs12910668-C | + | MODIFIER | chr15 | G | C |
|
chr15:85116953
|
c.1536-688T>C | Heel bone mineral density | a0001a0006 | a0001c0001a0001c0002a0006c0008 | a0001c0001t0001a0001c0001t0004a0001c0002t0001a0006c0008t0001 | a0001c0001t0001g0036a0001c0001t0001g0166a0001c0001t0001g0167a0001c0001t0001g0177a0001c0001t0001g0178others(54): Show | HG01109.hp2 HG01243.hp2 HG01255.hp1 HG01346.hp2 HG01433.hp2 others(54): Show |
Leveraging Polygenic Functional Enrichment to Impr others(15): Show |
approximately 446,000 European ancestry individual others(2): Show |
PDE8A | rs7167692-? | + | MODIFIER | chr15 | T | C | |
|
chr15:85116953
|
c.1536-688T>C | Heel bone mineral density0.0453589 | a0001a0006 | a0001c0001a0001c0002a0006c0008 | a0001c0001t0001a0001c0001t0004a0001c0002t0001a0006c0008t0001 | a0001c0001t0001g0036a0001c0001t0001g0166a0001c0001t0001g0167a0001c0001t0001g0177a0001c0001t0001g0178others(54): Show | HG01109.hp2 HG01243.hp2 HG01255.hp1 HG01346.hp2 HG01433.hp2 others(54): Show |
An atlas of genetic influences on osteoporosis in others(16): Show |
426,824 British ancestry individuals/ | PDE8A | PDE8A | rs7167692-T | + | MODIFIER | chr15 | T | C |
|
chr15:85028758
|
c.187-35612G>T | Eosinophil counts0.013995 | a0001a0003a0004a0006a0009 | a0001c0001a0001c0010a0003c0005a0004c0006a0006c0008others(1): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0005a0001c0010t0001others(4): Show | a0001c0001t0001g0005a0001c0001t0001g0006a0001c0001t0001g0007a0001c0001t0001g0008a0001c0001t0001g0010others(129): Show | HG00099.hp2 HG00323.hp1 HG00558.hp2 HG00609.hp2 HG00621.hp2 others(129): Show |
Trans-ethnic and Ancestry-Specific Blood-Cell Gene others(54): Show |
474,237 European ancestry individuals/ | NR | PDE8A | rs289394-T | + | MODIFIER | chr15 | G | T |
|
chr15:85137301
|
c.2384-496C>A | Systolic blood pressure | a0001a0002a0003a0005a0006others(1): Show | a0001c0001a0001c0002a0002c0003a0003c0005a0005c0007others(2): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0002t0001others(5): Show | a0001c0001t0001g0001a0001c0001t0001g0035a0001c0001t0001g0036a0001c0001t0001g0047a0001c0001t0001g0048others(165): Show | HG00280.hp1 HG00423.hp1 HG00597.hp2 HG00609.hp1 HG00621.hp1 others(165): Show |
Leveraging Polygenic Functional Enrichment to Impr others(15): Show |
approximately 422,000 European ancestry individual others(2): Show |
PDE8A | rs3743157-? | + | MODIFIER | chr15 | C | A | |
|
chr15:85020846
|
c.186+38498C>T | Height | a0001 | a0001c0001 | a0001c0001t0001a0001c0001t0003 | a0001c0001t0001g0005a0001c0001t0001g0006a0001c0001t0001g0007a0001c0001t0001g0008a0001c0001t0001g0010others(24): Show | HG00323.hp1 HG00639.hp2 HG00642.hp1 HG00741.hp1 HG01069.hp2 others(24): Show |
Leveraging Polygenic Functional Enrichment to Impr others(15): Show |
approximately 458,000 European ancestry individual others(2): Show |
PDE8A | rs62021203-? | + | MODIFIER | chr15 | C | T | |
|
chr15:85028758
|
c.187-35612G>T | Eosinophil counts | a0001a0003a0004a0006a0009 | a0001c0001a0001c0010a0003c0005a0004c0006a0006c0008others(1): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0005a0001c0010t0001others(4): Show | a0001c0001t0001g0005a0001c0001t0001g0006a0001c0001t0001g0007a0001c0001t0001g0008a0001c0001t0001g0010others(129): Show | HG00099.hp2 HG00323.hp1 HG00558.hp2 HG00609.hp2 HG00621.hp2 others(129): Show |
Trans-ethnic and Ancestry-Specific Blood-Cell Gene others(54): Show |
583,850 African American or Afro-Caribbean, Africa others(116): Show |
NR | PDE8A | rs289394-T | + | MODIFIER | chr15 | G | T |
|
chr15:85137301
|
c.2384-496C>A | Systolic blood pressure (MTAG)0.01602338 | a0001a0002a0003a0005a0006others(1): Show | a0001c0001a0001c0002a0002c0003a0003c0005a0005c0007others(2): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0002t0001others(5): Show | a0001c0001t0001g0001a0001c0001t0001g0035a0001c0001t0001g0036a0001c0001t0001g0047a0001c0001t0001g0048others(165): Show | HG00280.hp1 HG00423.hp1 HG00597.hp2 HG00609.hp1 HG00621.hp1 others(165): Show |
Multi-trait association analysis reveals shared ge others(65): Show |
at least 757,601 European ancestry individuals (MT others(52): Show |
PDE8A | rs3743157-A | + | MODIFIER | chr15 | C | A | |
|
chr15:85094198
|
c.852+3017C>T | Waist circumference adjusted for body mass indexothers(17): Show | a0001 | a0001c0001 | a0001c0001t0001 | a0001c0001t0001g0019 | homoSapiens_chm13v2.hp1 |
GWAS of allometric body-shape indices in UK Bioban others(109): Show |
186,825 British ancestry men/ | PDE8A | PDE8A | rs77718466-T | + | MODIFIER | chr15 | C | T |
|
chr15:85010891
|
c.186+28543C>G |
Hip circumference adjusted for BMI0.0244 others(3): Show |
a0001 | a0001c0001 | a0001c0001t0001a0001c0001t0003a0001c0001t0008 | a0001c0001t0001g0005a0001c0001t0001g0006a0001c0001t0001g0007a0001c0001t0001g0008a0001c0001t0001g0010others(25): Show | HG00323.hp1 HG00639.hp2 HG00642.hp1 HG00741.hp1 HG01069.hp2 others(25): Show |
GWAS of allometric body-shape indices in UK Bioban others(109): Show |
219,872 British ancestry women/ | PDE8A | PDE8A | rs35816571-G | + | MODIFIER | chr15 | C | G |
|
chr15:85116953
|
c.1536-688T>C | Bone density (confirmatory factor analysis Factor 19)others(13): Show | a0001a0006 | a0001c0001a0001c0002a0006c0008 | a0001c0001t0001a0001c0001t0004a0001c0002t0001a0006c0008t0001 | a0001c0001t0001g0036a0001c0001t0001g0166a0001c0001t0001g0167a0001c0001t0001g0177a0001c0001t0001g0178others(54): Show | HG01109.hp2 HG01243.hp2 HG01255.hp1 HG01346.hp2 HG01433.hp2 others(54): Show |
Principled distillation of UK Biobank phenotype da others(51): Show |
115,532 European ancestry individuals/ | PDE8A | rs7167692-? | + | MODIFIER | chr15 | T | C | |
|
chr15:85102221
|
c.1036+2023C>G | Medication use (diuretics)0.06845347 | a0001a0002a0003a0004a0005others(4): Show | a0001c0001a0001c0002a0001c0004a0001c0010a0002c0003others(7): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0005others(14): Show | a0001c0001t0001g0001a0001c0001t0001g0005a0001c0001t0001g0006a0001c0001t0001g0007a0001c0001t0001g0008others(333): Show | HG00099.hp1 HG00099.hp2 HG00280.hp1 HG00280.hp2 HG00323.hp1 others(333): Show |
Genome-wide association study of medication-use an others(39): Show |
34,453 European ancestry cases, 194,633 European a others(17): Show |
PDE8A | PDE8A | rs8041380-C | + | MODIFIER | chr15 | C | G |
|
chr15:85020330
|
c.186+37982G>A |
Bioavailable testosterone levels0.019645 others(1): Show |
a0001 | a0001c0001 | a0001c0001t0001a0001c0001t0003a0001c0001t0008 | a0001c0001t0001g0005a0001c0001t0001g0006a0001c0001t0001g0007a0001c0001t0001g0008a0001c0001t0001g0010others(26): Show | HG00323.hp1 HG00639.hp2 HG00642.hp1 HG00741.hp1 HG01069.hp2 others(26): Show |
Using human genetics to understand the disease imp others(38): Show |
188,507 European ancestry women/ | NR | PDE8A | rs71397837-G | + | MODIFIER | chr15 | G | A |
|
chr15:85137301
|
c.2384-496C>A | Systolic blood pressure0.2602 | a0001a0002a0003a0005a0006others(1): Show | a0001c0001a0001c0002a0002c0003a0003c0005a0005c0007others(2): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0002t0001others(5): Show | a0001c0001t0001g0001a0001c0001t0001g0035a0001c0001t0001g0036a0001c0001t0001g0047a0001c0001t0001g0048others(165): Show | HG00280.hp1 HG00423.hp1 HG00597.hp2 HG00609.hp1 HG00621.hp1 others(165): Show |
Genetic analysis of over 1 million people identifi others(54): Show |
757,601 European ancestry individuals/249,262 Euro others(25): Show |
PDE8A | PDE8A | rs3743157-A | + | MODIFIER | chr15 | C | A |
|
chr15:85010891
|
c.186+28543C>G | Total testosterone levels0.0140933 | a0001 | a0001c0001 | a0001c0001t0001a0001c0001t0003a0001c0001t0008 | a0001c0001t0001g0005a0001c0001t0001g0006a0001c0001t0001g0007a0001c0001t0001g0008a0001c0001t0001g0010others(25): Show | HG00323.hp1 HG00639.hp2 HG00642.hp1 HG00741.hp1 HG01069.hp2 others(25): Show |
Using human genetics to understand the disease imp others(38): Show |
425,097 European ancestry individuals/ | NR | PDE8A | rs35816571-C | + | MODIFIER | chr15 | C | G |
|
chr15:85014909
|
c.186+32561C>T | Total testosterone levels0.0397313 | a0001 | a0001c0001 | a0001c0001t0001a0001c0001t0003a0001c0001t0008 | a0001c0001t0001g0005a0001c0001t0001g0006a0001c0001t0001g0007a0001c0001t0001g0008a0001c0001t0001g0010others(26): Show | HG00323.hp1 HG00639.hp2 HG00642.hp1 HG00741.hp1 HG01069.hp2 others(26): Show |
Using human genetics to understand the disease imp others(38): Show |
230,454 European ancestry women/ | NR | PDE8A | rs12900736-C | + | MODIFIER | chr15 | C | T |
|
chr15:85116953
|
c.1536-688T>C | Heel bone mineral density0.0537914 | a0001a0006 | a0001c0001a0001c0002a0006c0008 | a0001c0001t0001a0001c0001t0004a0001c0002t0001a0006c0008t0001 | a0001c0001t0001g0036a0001c0001t0001g0166a0001c0001t0001g0167a0001c0001t0001g0177a0001c0001t0001g0178others(54): Show | HG01109.hp2 HG01243.hp2 HG01255.hp1 HG01346.hp2 HG01433.hp2 others(54): Show |
Identification of 613 new loci associated with hee others(102): Show |
394,929 European ancestry individuals/ | PDE8A | rs7167692-? | + | MODIFIER | chr15 | T | C | |
|
chr15:84997536
|
c.186+15188G>A | Heel bone mineral density0.0196378 | a0001a0009 | a0001c0001a0001c0004a0009c0012 | a0001c0001t0001a0001c0001t0005a0001c0004t0001a0009c0012t0001 | a0001c0001t0001g0056a0001c0001t0001g0060a0001c0001t0001g0075a0001c0001t0001g0077a0001c0001t0001g0084others(42): Show | HG00099.hp2 HG00558.hp2 HG00621.hp2 HG00639.hp1 HG00735.hp2 others(42): Show |
Identification of 613 new loci associated with hee others(102): Show |
394,929 European ancestry individuals/ | PDE8A | rs6496586-? | + | MODIFIER | chr15 | G | A | |
|
chr15:85062196
|
c.187-2174G>T | Testicular germ cell tumor1.17 | a0001 | a0001c0001a0001c0002 | a0001c0001t0001a0001c0001t0003a0001c0001t0008a0001c0002t0001 | a0001c0001t0001g0005a0001c0001t0001g0006a0001c0001t0001g0007a0001c0001t0001g0008a0001c0001t0001g0010others(65): Show | HG00323.hp1 HG00639.hp2 HG00642.hp1 HG00741.hp1 HG01069.hp2 others(65): Show |
Identification of 19 new risk loci and potential r others(78): Show |
5,518 European ancestry cases, 19,055 European anc others(78): Show |
SLC28A1, PDE8A | PDE8A | rs56046484-G | + | MODIFIER | chr15 | G | T |
|
chr15:85143096
|
c.*5193A>G | Extensive white matter perivascular space burdenothers(8): Show | a0001a0002a0003a0004a0005others(4): Show | a0001c0001a0001c0002a0001c0004a0001c0010a0002c0003others(7): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004a0001c0001t0005a0001c0001t0006others(13): Show | a0001c0001t0001g0001a0001c0001t0001g0005a0001c0001t0001g0006a0001c0001t0001g0009a0001c0001t0001g0012others(300): Show | HG00099.hp2 HG00280.hp1 HG00280.hp2 HG00323.hp2 HG00423.hp1 others(300): Show |
Genomics of perivascular space burden unravels ear others(47): Show |
9,317 European ancestry cases, 29,281 European anc others(15): Show |
PDE8A - NIFKP8 | rs8041189-G | + | MODIFIER | chr15 | A | G | |
|
chr15:84978503
|
c.-3660G>C | Height (standard GWA)0.14673 | a0001a0003 | a0001c0001a0001c0002a0003c0005 | a0001c0001t0001a0001c0001t0003a0001c0001t0007a0001c0001t0008a0001c0002t0001others(1): Show | a0001c0001t0001g0005a0001c0001t0001g0006a0001c0001t0001g0007a0001c0001t0001g0008a0001c0001t0001g0009others(57): Show | HG00323.hp1 HG00642.hp1 HG00741.hp1 HG01070.hp2 HG01099.hp1 others(57): Show |
Participation bias in the UK Biobank distorts gene others(41): Show |
283,749 European ancestry individuals/ | SLC28A1 - PDE8A | rs7173332-C | + | MODIFIER | chr15 | G | C | |
|
chr15:85014909
|
c.186+32561C>T |
Testosterone levels in postmenopausal women others(12): Show |
a0001 | a0001c0001 | a0001c0001t0001a0001c0001t0003a0001c0001t0008 | a0001c0001t0001g0005a0001c0001t0001g0006a0001c0001t0001g0007a0001c0001t0001g0008a0001c0001t0001g0010others(26): Show | HG00323.hp1 HG00639.hp2 HG00642.hp1 HG00741.hp1 HG01069.hp2 others(26): Show |
Cross-ancestry genome-wide association studies of others(60): Show |
84,003 European ancestry individuals/ | PDE8A | rs12900736-T | + | MODIFIER | chr15 | C | T | |
|
chr15:85014909
|
c.186+32561C>T | Testosterone levels0.0283701 | a0001 | a0001c0001 | a0001c0001t0001a0001c0001t0003a0001c0001t0008 | a0001c0001t0001g0005a0001c0001t0001g0006a0001c0001t0001g0007a0001c0001t0001g0008a0001c0001t0001g0010others(26): Show | HG00323.hp1 HG00639.hp2 HG00642.hp1 HG00741.hp1 HG01069.hp2 others(26): Show |
Cross-ancestry genome-wide association studies of others(60): Show |
182,648 European ancestry individuals/ | PDE8A | rs12900736-T | + | MODIFIER | chr15 | C | T | |
|
chr15:85014909
|
c.186+32561C>T | Testosterone levels6.402 | a0001 | a0001c0001 | a0001c0001t0001a0001c0001t0003a0001c0001t0008 | a0001c0001t0001g0005a0001c0001t0001g0006a0001c0001t0001g0007a0001c0001t0001g0008a0001c0001t0001g0010others(26): Show | HG00323.hp1 HG00639.hp2 HG00642.hp1 HG00741.hp1 HG01069.hp2 others(26): Show |
Cross-ancestry genome-wide association studies of others(60): Show |
4,229 African ancestry individuals, 182,648 Europe others(24): Show |
PDE8A | rs12900736-? | + | MODIFIER | chr15 | C | T | |
|
chr15:85020846
|
c.186+38498C>T | Height0.0238571 | a0001 | a0001c0001 | a0001c0001t0001a0001c0001t0003 | a0001c0001t0001g0005a0001c0001t0001g0006a0001c0001t0001g0007a0001c0001t0001g0008a0001c0001t0001g0010others(24): Show | HG00323.hp1 HG00639.hp2 HG00642.hp1 HG00741.hp1 HG01069.hp2 others(24): Show |
A Genomics England haplotype reference panel and i others(24): Show |
404,900 European ancestry individuals/ | PDE8A | rs62021203-? | + | MODIFIER | chr15 | C | T | |
|
chr15:85000819
|
c.186+18471C>T | Systolic blood pressure0.1511 | a0001a0004a0007a0009 | a0001c0001a0001c0004a0001c0010a0004c0006a0007c0009others(1): Show | a0001c0001t0001a0001c0001t0005a0001c0001t0006a0001c0004t0001a0001c0010t0001others(3): Show | a0001c0001t0001g0001a0001c0001t0001g0049a0001c0001t0001g0050a0001c0001t0001g0051a0001c0001t0001g0052others(125): Show | HG00099.hp2 HG00280.hp2 HG00423.hp2 HG00558.hp1 HG00558.hp2 others(125): Show |
Trans-ethnic association study of blood pressure d others(40): Show |
365,998 European ancestry individuals, 63,490 Afri others(189): Show |
PDE8A | PDE8A | rs2290273-T | + | MODIFIER | chr15 | C | T |
|
chr15:85129945
|
c.2253+3571C>A | Subcortical volume (min-P) | a0001a0002a0003a0004a0005others(4): Show | a0001c0001a0001c0002a0001c0004a0001c0010a0002c0003others(7): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004a0001c0001t0005a0001c0001t0006others(12): Show | a0001c0001t0001g0001a0001c0001t0001g0009a0001c0001t0001g0035a0001c0001t0001g0036a0001c0001t0001g0038others(292): Show | HG00099.hp2 HG00280.hp1 HG00280.hp2 HG00323.hp2 HG00423.hp1 others(292): Show |
Understanding the genetic determinants of the brai others(15): Show |
26,502 European ancestry individuals/ | EPHA4 | PDE8A | rs6496733-? | + | MODIFIER | chr15 | C | A |
|
chr15:85137301
|
c.2384-496C>A | Systolic blood pressure0.23966858 | a0001a0002a0003a0005a0006others(1): Show | a0001c0001a0001c0002a0002c0003a0003c0005a0005c0007others(2): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0002t0001others(5): Show | a0001c0001t0001g0001a0001c0001t0001g0035a0001c0001t0001g0036a0001c0001t0001g0047a0001c0001t0001g0048others(165): Show | HG00280.hp1 HG00423.hp1 HG00597.hp2 HG00609.hp1 HG00621.hp1 others(165): Show |
Discovery of rare variants associated with blood p others(68): Show |
810,865 European ancestry individuals/ | PDE8A | rs3743157-A | + | MODIFIER | chr15 | C | A | |
|
chr15:84987540
|
c.186+5192C>T | Kidney stone disease1.13 | a0001 | a0001c0001 | a0001c0001t0001a0001c0001t0003a0001c0001t0008 | a0001c0001t0001g0005a0001c0001t0001g0006a0001c0001t0001g0007a0001c0001t0001g0008a0001c0001t0001g0009others(25): Show | HG00323.hp1 HG00642.hp1 HG00741.hp1 HG01070.hp2 HG01099.hp1 others(25): Show |
Central Adiposity Increases Risk of Kidney Stone D others(51): Show |
17,101 European ancestry cases, 721,947 European a others(17): Show |
PDE8A | rs71397835-T | + | MODIFIER | chr15 | C | T | |
|
chr15:84977098
|
c.-5065C>G | Kidney stone disease1.13 | a0001 | a0001c0001 | a0001c0001t0001a0001c0001t0003a0001c0001t0008 | a0001c0001t0001g0005a0001c0001t0001g0006a0001c0001t0001g0007a0001c0001t0001g0008a0001c0001t0001g0009others(27): Show | HG00323.hp1 HG00642.hp1 HG00673.hp1 HG00741.hp1 HG01069.hp2 others(27): Show |
Central Adiposity Increases Risk of Kidney Stone D others(51): Show |
8,504 European ancestry cases, 388,819 European an others(16): Show |
SLC28A1 - PDE8A | rs12439802-G | + | MODIFIER | chr15 | C | G | |
|
chr15:85137301
|
c.2384-496C>A | Pulse pressure0.12513694 | a0001a0002a0003a0005a0006others(1): Show | a0001c0001a0001c0002a0002c0003a0003c0005a0005c0007others(2): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0002t0001others(5): Show | a0001c0001t0001g0001a0001c0001t0001g0035a0001c0001t0001g0036a0001c0001t0001g0047a0001c0001t0001g0048others(165): Show | HG00280.hp1 HG00423.hp1 HG00597.hp2 HG00609.hp1 HG00621.hp1 others(165): Show |
Discovery of rare variants associated with blood p others(68): Show |
1,164,961 European ancestry individuals/ | PDE8A | rs3743157-A | + | MODIFIER | chr15 | C | A | |
|
chr15:85092659
|
c.852+1478T>C | Systolic blood pressure0.15174907 | a0001a0002a0003a0005a0008 | a0001c0001a0001c0002a0002c0003a0003c0005a0005c0007others(1): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0008others(5): Show | a0001c0001t0001g0001a0001c0001t0001g0005a0001c0001t0001g0006a0001c0001t0001g0007a0001c0001t0001g0008others(180): Show | HG00099.hp1 HG00280.hp1 HG00323.hp1 HG00423.hp1 HG00597.hp2 others(180): Show |
Discovery of rare variants associated with blood p others(68): Show |
810,865 European ancestry individuals, 21,077 Afri others(94): Show |
PDE8A | rs8032301-T | + | MODIFIER | chr15 | T | C | |
|
chr15:85137301
|
c.2384-496C>A | Systolic blood pressure0.23310645 | a0001a0002a0003a0005a0006others(1): Show | a0001c0001a0001c0002a0002c0003a0003c0005a0005c0007others(2): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0002t0001others(5): Show | a0001c0001t0001g0001a0001c0001t0001g0035a0001c0001t0001g0036a0001c0001t0001g0047a0001c0001t0001g0048others(165): Show | HG00280.hp1 HG00423.hp1 HG00597.hp2 HG00609.hp1 HG00621.hp1 others(165): Show |
Discovery of rare variants associated with blood p others(68): Show |
1,164,961 European ancestry individuals/ | PDE8A | rs3743157-A | + | MODIFIER | chr15 | C | A | |
|
chr15:85092659
|
c.852+1478T>C | Systolic blood pressure0.12436065 | a0001a0002a0003a0005a0008 | a0001c0001a0001c0002a0002c0003a0003c0005a0005c0007others(1): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0008others(5): Show | a0001c0001t0001g0001a0001c0001t0001g0005a0001c0001t0001g0006a0001c0001t0001g0007a0001c0001t0001g0008others(180): Show | HG00099.hp1 HG00280.hp1 HG00323.hp1 HG00423.hp1 HG00597.hp2 others(180): Show |
Discovery of rare variants associated with blood p others(68): Show |
1,164,961 European ancestry individuals, 84,359 Af others(180): Show |
PDE8A | rs8032301-T | + | MODIFIER | chr15 | T | C | |
|
chr15:84980738
|
c.-1425G>A | Height0.0225 | a0001 | a0001c0001 | a0001c0001t0001a0001c0001t0003a0001c0001t0008 | a0001c0001t0001g0005a0001c0001t0001g0006a0001c0001t0001g0007a0001c0001t0001g0008a0001c0001t0001g0009others(22): Show | HG00323.hp1 HG00642.hp1 HG00741.hp1 HG01070.hp2 HG01099.hp1 others(22): Show |
A saturated map of common genetic variants associa others(22): Show |
5,314,291 European ancestry, Hispanic or Latin Ame others(79): Show |
PDE8A | rs12900078-A | + | MODIFIER | chr15 | G | A | |
|
chr15:85007425
|
c.186+25077C>T | Height0.0136 | a0001a0003a0006 | a0001c0001a0003c0005a0006c0008 | a0001c0001t0001a0001c0001t0004a0001c0001t0007a0003c0005t0002a0006c0008t0001 | a0001c0001t0001g0036a0001c0001t0001g0166a0001c0001t0001g0167a0001c0001t0001g0177a0001c0001t0001g0178others(34): Show | HG01109.hp2 HG01243.hp1 HG01243.hp2 HG01496.hp2 HG01891.hp2 others(34): Show |
A saturated map of common genetic variants associa others(22): Show |
5,314,291 European ancestry, Hispanic or Latin Ame others(79): Show |
PDE8A | rs7175477-T | + | MODIFIER | chr15 | C | T | |
|
chr15:85023042
|
c.186+40694C>T | Height0.014 | a0001a0004 | a0001c0001a0001c0010a0004c0006 | a0001c0001t0001a0001c0010t0001a0004c0006t0001 | a0001c0001t0001g0009a0001c0001t0001g0038a0001c0001t0001g0049a0001c0001t0001g0050a0001c0001t0001g0051others(25): Show | HG00609.hp2 HG00642.hp2 HG01069.hp1 HG01070.hp1 HG01123.hp2 others(25): Show |
A saturated map of common genetic variants associa others(22): Show |
5,314,291 European ancestry, Hispanic or Latin Ame others(79): Show |
PDE8A | rs289405-T | + | MODIFIER | chr15 | C | T | |
|
chr15:85137301
|
c.2384-496C>A | Diastolic blood pressure0.1161 | a0001a0002a0003a0005a0006others(1): Show | a0001c0001a0001c0002a0002c0003a0003c0005a0005c0007others(2): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0002t0001others(5): Show | a0001c0001t0001g0001a0001c0001t0001g0035a0001c0001t0001g0036a0001c0001t0001g0047a0001c0001t0001g0048others(165): Show | HG00280.hp1 HG00423.hp1 HG00597.hp2 HG00609.hp1 HG00621.hp1 others(165): Show |
Genome-wide analysis in over 1 million individuals others(86): Show |
1,028,980 European ancestry individuals/62,047 Afr others(62): Show |
PDE8A | rs3743157-A | + | MODIFIER | chr15 | C | A | |
|
chr15:84978503
|
c.-3660G>C | Psoriasis0.0807189 | a0001a0003 | a0001c0001a0001c0002a0003c0005 | a0001c0001t0001a0001c0001t0003a0001c0001t0007a0001c0001t0008a0001c0002t0001others(1): Show | a0001c0001t0001g0005a0001c0001t0001g0006a0001c0001t0001g0007a0001c0001t0001g0008a0001c0001t0001g0009others(57): Show | HG00323.hp1 HG00642.hp1 HG00741.hp1 HG01070.hp2 HG01099.hp1 others(57): Show |
Multi-ancestry genome-wide meta-analysis with 472, others(60): Show |
26,279 European ancestry cases, 442,230 European a others(88): Show |
SLC28A1 - PDE8A | rs7173332-C | + | MODIFIER | chr15 | G | C | |
|
chr15:85130465
|
c.2253+4091A>G | Psoriasis1.053 | a0001a0002a0004a0005a0006others(1): Show | a0001c0001a0001c0010a0002c0003a0004c0006a0005c0007others(2): Show | a0001c0001t0001a0001c0001t0004a0001c0010t0001a0002c0003t0001a0004c0006t0001others(3): Show | a0001c0001t0001g0001a0001c0001t0001g0009a0001c0001t0001g0012a0001c0001t0001g0035a0001c0001t0001g0036others(137): Show | HG00280.hp1 HG00423.hp1 HG00597.hp2 HG00609.hp1 HG00609.hp2 others(137): Show |
GWAS meta-analysis of psoriasis identifies new sus others(73): Show |
36,466 European ancestry cases, 458,078 European a others(17): Show |
PDE8A | rs7171410-A | + | MODIFIER | chr15 | A | G | |
|
chr15:85128148
|
c.2253+1774A>C | Height0.0174 | a0001a0002a0004a0005a0006others(3): Show | a0001c0001a0001c0004a0001c0010a0002c0003a0004c0006others(5): Show | a0001c0001t0001a0001c0001t0004a0001c0001t0005a0001c0001t0006a0001c0001t0007others(9): Show | a0001c0001t0001g0001a0001c0001t0001g0009a0001c0001t0001g0012a0001c0001t0001g0035a0001c0001t0001g0036others(243): Show | HG00099.hp1 HG00099.hp2 HG00280.hp1 HG00280.hp2 HG00323.hp2 others(243): Show |
A saturated map of common genetic variants associa others(22): Show |
455,180 Hispanic or Latin American individuals/ | PDE8A | rs1606119-A | + | MODIFIER | chr15 | A | C | |
|
chr15:85128148
|
c.2253+1774A>T | Height0.0174 | a0001 | a0001c0001 | a0001c0001t0001 | a0001c0001t0001g0125 | HG02074.hp2 |
A saturated map of common genetic variants associa others(22): Show |
455,180 Hispanic or Latin American individuals/ | PDE8A | rs1606119-A | + | MODIFIER | chr15 | A | T | |
|
chr15:85137301
|
c.2384-496C>A | Pulse pressure0.12819855 | a0001a0002a0003a0005a0006others(1): Show | a0001c0001a0001c0002a0002c0003a0003c0005a0005c0007others(2): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0002t0001others(5): Show | a0001c0001t0001g0001a0001c0001t0001g0035a0001c0001t0001g0036a0001c0001t0001g0047a0001c0001t0001g0048others(165): Show | HG00280.hp1 HG00423.hp1 HG00597.hp2 HG00609.hp1 HG00621.hp1 others(165): Show |
Discovery of rare variants associated with blood p others(68): Show |
810,865 European ancestry individuals/ | PDE8A | rs3743157-A | + | MODIFIER | chr15 | C | A | |
|
chr15:85020330
|
c.186+37982G>A | Testosterone levels0.0299 | a0001 | a0001c0001 | a0001c0001t0001a0001c0001t0003a0001c0001t0008 | a0001c0001t0001g0005a0001c0001t0001g0006a0001c0001t0001g0007a0001c0001t0001g0008a0001c0001t0001g0010others(26): Show | HG00323.hp1 HG00639.hp2 HG00642.hp1 HG00741.hp1 HG01069.hp2 others(26): Show |
Genome-wide analyses identify 25 infertility loci others(80): Show |
246,862 European and South Asian ancestry females/ | PDE8A | rs71397837-A | + | MODIFIER | chr15 | G | A | |
|
chr15:85006491
|
c.186+24143C>T | Putamen iron levels (R2* MRI)0.04059 | a0001a0004a0007a0009 | a0001c0001a0001c0004a0001c0010a0004c0006a0007c0009others(1): Show | a0001c0001t0001a0001c0001t0005a0001c0001t0006a0001c0004t0001a0001c0010t0001others(3): Show | a0001c0001t0001g0001a0001c0001t0001g0009a0001c0001t0001g0049a0001c0001t0001g0050a0001c0001t0001g0051others(125): Show | HG00099.hp2 HG00280.hp2 HG00423.hp2 HG00558.hp1 HG00558.hp2 others(125): Show |
MRI-derived brain iron, grey matter volume, and ri others(100): Show |
39,533 European ancestry individuals/ | PDE8A | rs12904615-C | + | MODIFIER | chr15 | C | T | |
|
chr15:85020330
|
c.186+37982G>A | Testosterone levels0.031 | a0001 | a0001c0001 | a0001c0001t0001a0001c0001t0003a0001c0001t0008 | a0001c0001t0001g0005a0001c0001t0001g0006a0001c0001t0001g0007a0001c0001t0001g0008a0001c0001t0001g0010others(26): Show | HG00323.hp1 HG00639.hp2 HG00642.hp1 HG00741.hp1 HG01069.hp2 others(26): Show |
Genome-wide analyses identify 25 infertility loci others(80): Show |
235,579 European ancestry females/ | PDE8A | rs71397837-A | + | MODIFIER | chr15 | G | A | |
|
chr15:85137301
|
c.2384-496C>A | Systolic blood pressure0.2673 | a0001a0002a0003a0005a0006others(1): Show | a0001c0001a0001c0002a0002c0003a0003c0005a0005c0007others(2): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0002t0001others(5): Show | a0001c0001t0001g0001a0001c0001t0001g0035a0001c0001t0001g0036a0001c0001t0001g0047a0001c0001t0001g0048others(165): Show | HG00280.hp1 HG00423.hp1 HG00597.hp2 HG00609.hp1 HG00621.hp1 others(165): Show |
Genome-wide analysis in over 1 million individuals others(86): Show |
1,028,980 European ancestry individuals/40,204 Afr others(62): Show |
PDE8A | rs3743157-A | + | MODIFIER | chr15 | C | A | |
|
chr15:85137301
|
c.2384-496C>A | Pulse pressure0.1572 | a0001a0002a0003a0005a0006others(1): Show | a0001c0001a0001c0002a0002c0003a0003c0005a0005c0007others(2): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0004a0001c0001t0007a0001c0002t0001others(5): Show | a0001c0001t0001g0001a0001c0001t0001g0035a0001c0001t0001g0036a0001c0001t0001g0047a0001c0001t0001g0048others(165): Show | HG00280.hp1 HG00423.hp1 HG00597.hp2 HG00609.hp1 HG00621.hp1 others(165): Show |
Genome-wide analysis in over 1 million individuals others(86): Show |
1,028,980 European ancestry individuals/62,047 Afr others(62): Show |
PDE8A | rs3743157-A | + | MODIFIER | chr15 | C | A | |
|
chr15:85064817
|
c.243+391T>C | Medication use (calcium channel blockers)others(7): Show | a0001a0003a0005a0006a0008 | a0001c0001a0001c0002a0003c0005a0005c0007a0006c0008others(1): Show | a0001c0001t0001a0001c0001t0002a0001c0001t0003a0001c0001t0004a0001c0001t0008others(5): Show | a0001c0001t0001g0001a0001c0001t0001g0005a0001c0001t0001g0006a0001c0001t0001g0007a0001c0001t0001g0008others(200): Show | HG00099.hp1 HG00280.hp1 HG00323.hp1 HG00423.hp1 HG00597.hp2 others(200): Show |
A cross-population atlas of genetic associations f others(24): Show |
31,904 European ancestry cases, 172,474 European a others(89): Show |
PDE8A | rs7402770-C | + | MODIFIER | chr15 | T | C |