Joint Open Genome and Omics Platform (JoGo)

Search by Variant

Regionname

e.g. ALDH2_chr12_111761933_111822532, HBB_chr11_5220464_5232071.

Chr

Chromosome name (e.g., chr11).

Snpeff genename

Exact SnpEff gene name.

Sampleids

Target sampleid (e.g. HG02615).

Snpeff haplotype class

Haplotype-annotation class (e.g., ahapid, ahapid+chapid).

Snpeff annotation impact

Exact impact level (e.g., HIGH, MODERATE, LOW).

Snpeff annotation impact detail

Keyword match in SnpEff annotation.

Hapid

One or more haplotype IDs (comma-separated; e.g., a0001, a01, a0001c0001, a01c02, a1c2, a0001c0001t0005, a0001c0001t0005g0018).

Samplehapid

Sample haplotype IDs to include (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

No_hapid

Haplotype IDs to exclude (comma-separated; e.g., a0001, a0002, a0001c0001, a0001c0001t0005, a1, a01).

No_samplehapid

Sample haplotype IDs to exclude (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

Start

Start position (GRCh38).

End

End position (GRCh38).

Minac

Minimum alternate allele count (≥).

Maxac

Maximum alternate allele count (≤).

Minlen

Minimum variant length (≥).

Maxlen

Maximum variant length (≤).

Sort By

Select column to sort.

Order by

Ascending or descending.

Show

Results per page.

regionname	pos	ref	alt	annotation	impact	samples	ahapids	achapids	acthapids	actghapids	ac	an	af	len	hgvs_c	hgvs_p	genename	geneid	featuretype	featureid	transcript_biotype	rank	cdna cdna pos length	cds cds pos length	aa aa pos length	status	chr	external
OCRL_chrX_129535259_129597556	129557927	AG AG	A A	frameshift_variant frameshift_variant	HIGH	NA19072.hp1 NA19072.hp1	a0005 a0005	a0005c0007 a0005c0007	a0005c0007t0003 a0005c0007t0003	a0005c0007t0003g0152 a0005c0007t0003g0152	1	278	0.0036	-1	c.418 others(4): Show c.418delG	p.Asp others(5): Show p.Asp140fs	OCRL	ENSG00000122126.18	transcript	ENST00000371113.9	protein_coding	6/24	599/5173	418/2706	140/901	INFO_REALIGN_3_PRIME	chrX	TogoVar
OCRL_chrX_129535259_129597556	129558658	T T	TA TA	frameshift_variant frameshift_variant	HIGH	NA19072.hp1 NA19072.hp1	a0005 a0005	a0005c0007 a0005c0007	a0005c0007t0003 a0005c0007t0003	a0005c0007t0003g0152 a0005c0007t0003g0152	1	278	0.0036	1	c.465 others(8): Show c.465_466insA	p.Ser others(5): Show p.Ser156fs	OCRL	ENSG00000122126.18	transcript	ENST00000371113.9	protein_coding	7/24	647/5173	466/2706	156/901		chrX	TogoVar
OCRL_chrX_129535259_129597556	129558716	CG CG	C C	frameshift_variant frameshift_variant	HIGH	NA19072.hp1 NA19072.hp1	a0005 a0005	a0005c0007 a0005c0007	a0005c0007t0003 a0005c0007t0003	a0005c0007t0003g0152 a0005c0007t0003g0152	1	278	0.0036	-1	c.526 others(4): Show c.526delG	p.Glu others(5): Show p.Glu176fs	OCRL	ENSG00000122126.18	transcript	ENST00000371113.9	protein_coding	7/24	707/5173	526/2706	176/901	INFO_REALIGN_3_PRIME	chrX	TogoVar
OCRL_chrX_129535259_129597556	129558727	AC AC	A A	frameshift_variant frameshift_variant	HIGH	NA19072.hp1 NA19072.hp1	a0005 a0005	a0005c0007 a0005c0007	a0005c0007t0003 a0005c0007t0003	a0005c0007t0003g0152 a0005c0007t0003g0152	1	278	0.0036	-1	c.536 others(4): Show c.536delC	p.Pro others(5): Show p.Pro179fs	OCRL	ENSG00000122126.18	transcript	ENST00000371113.9	protein_coding	7/24	717/5173	536/2706	179/901	INFO_REALIGN_3_PRIME	chrX	TogoVar
ODF3L2_chr19_458361_479983	464140	C C	CG CG	frameshift_variant frameshift_variant	HIGH	HG00140.hp2 HG00597.hp2 HG00673.hp1 others(24): Show HG00140.hp2 HG00597.hp2 HG00673.hp1 HG01109.hp1 HG01175.hp1 HG01243.hp1 HG01934.hp2 HG02055.hp2 HG02083.hp2 HG03491.hp2 HG03927.hp2 HG03942.hp2 HG04184.hp1 HG04199.hp1 NA18951.hp2 NA18961.hp1 NA18967.hp1 NA18967.hp2 NA18975.hp1 NA18991.hp1 NA18997.hp1 NA18999.hp2 NA19002.hp1 NA19007.hp2 NA19012.hp2 NA19055.hp2 NA19060.hp1	a0003 a0004 a0003 a0004	a0003c0004 a0004c0006 a0004c0009 a0003c0004 a0004c0006 a0004c0009	a0003c0004t0001 a0003c0004t0002 a0004c0006t0001 others(3): Show a0003c0004t0001 a0003c0004t0002 a0004c0006t0001 a0004c0006t0002 a0004c0006t0003 a0004c0009t0002	a0003c0004t0001g0014 a0003c0004t0001g0030 a0003c0004t0001g0069 others(19): Show a0003c0004t0001g0014 a0003c0004t0001g0030 a0003c0004t0001g0069 a0003c0004t0001g0071 a0003c0004t0001g0072 a0003c0004t0001g0079 a0003c0004t0001g0117 a0003c0004t0001g0118 a0003c0004t0001g0149 a0003c0004t0002g0141 a0004c0006t0001g0158 a0004c0006t0001g0163 a0004c0006t0002g0036 a0004c0006t0002g0076 a0004c0006t0002g0101 a0004c0006t0002g0104 a0004c0006t0003g0087 a0004c0009t0002g0055 a0004c0009t0002g0110 a0004c0009t0002g0133 a0004c0009t0002g0136 a0004c0009t0002g0139	27	324	0.0833	1	c.573 others(4): Show c.573dupC	p.Ala others(5): Show p.Ala192fs	ODF3L2	ENSG00000181781.10	transcript	ENST00000315489.5	protein_coding	4/4	809/1589	573/870	191/289		chr19	TogoVar
OFD1_chrX_13729748_13774357	13756599	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19089.hp1 NA19089.hp1	a0009 a0009	a0009c0007 a0009c0007	a0009c0007t0001 a0009c0007t0001	a0009c0007t0001g0070 a0009c0007t0001g0070	1	327	0.0031	-1	c.124 others(5): Show c.1246delC	p.Gln others(5): Show p.Gln416fs	OFD1	ENSG00000046651.16	transcript	ENST00000340096.11	protein_coding	13/23	1570/3612	1246/3039	416/1012	INFO_REALIGN_3_PRIME	chrX	TogoVar
OFD1_chrX_13729748_13774357	13758395	G G	GT GT	frameshift_variant frameshift_variant	HIGH	NA19089.hp1 NA19089.hp1	a0009 a0009	a0009c0007 a0009c0007	a0009c0007t0001 a0009c0007t0001	a0009c0007t0001g0070 a0009c0007t0001g0070	1	327	0.0031	1	c.160 others(5): Show c.1604dupT	p.Leu others(5): Show p.Leu535fs	OFD1	ENSG00000046651.16	transcript	ENST00000340096.11	protein_coding	15/23	1929/3612	1605/3039	535/1012	INFO_REALIGN_3_PRIME	chrX	TogoVar
OFD1_chrX_13729748_13774357	13760126	GA GA	G G	frameshift_variant frameshift_variant	HIGH	NA18992.hp2 NA18992.hp2	a0004 a0004	a0004c0012 a0004c0012	a0004c0012t0002 a0004c0012t0002	a0004c0012t0002g0155 a0004c0012t0002g0155	1	327	0.0031	-1	c.166 others(5): Show c.1668delA	p.Val others(5): Show p.Val557fs	OFD1	ENSG00000046651.16	transcript	ENST00000340096.11	protein_coding	16/23	1992/3612	1668/3039	556/1012	INFO_REALIGN_3_PRIME	chrX	TogoVar
OFD1_chrX_13729748_13774357	13760207	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0005 a0005	a0005c0008 a0005c0008	a0005c0008t0001 a0005c0008t0001	a0005c0008t0001g0120 a0005c0008t0001g0120	1	327	0.0031	1	c.174 others(10): Show c.1747_1748insC	p.Gly others(5): Show p.Gly583fs	OFD1	ENSG00000046651.16	transcript	ENST00000340096.11	protein_coding	16/23	2072/3612	1748/3039	583/1012		chrX	TogoVar
OFD1_chrX_13729748_13774357	13760422	G G	GGA GGA	frameshift_variant frameshift_variant	HIGH	NA18992.hp2 NA18992.hp2	a0004 a0004	a0004c0012 a0004c0012	a0004c0012t0002 a0004c0012t0002	a0004c0012t0002g0155 a0004c0012t0002g0155	1	327	0.0031	2	c.196 others(11): Show c.1962_1963insGA	p.Arg others(5): Show p.Arg655fs	OFD1	ENSG00000046651.16	transcript	ENST00000340096.11	protein_coding	16/23	2287/3612	1963/3039	655/1012		chrX	TogoVar
OFD1_chrX_13729748_13774357	13760424	G G	GA GA	frameshift_variant frameshift_variant	HIGH	NA18992.hp2 NA18992.hp2	a0004 a0004	a0004c0012 a0004c0012	a0004c0012t0002 a0004c0012t0002	a0004c0012t0002g0155 a0004c0012t0002g0155	1	327	0.0031	1	c.196 others(5): Show c.1965dupA	p.Val others(5): Show p.Val656fs	OFD1	ENSG00000046651.16	transcript	ENST00000340096.11	protein_coding	16/23	2290/3612	1966/3039	656/1012	INFO_REALIGN_3_PRIME	chrX	TogoVar
OFD1_chrX_13729748_13774357	13760497	C C	CA CA	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0005 a0005	a0005c0008 a0005c0008	a0005c0008t0001 a0005c0008t0001	a0005c0008t0001g0120 a0005c0008t0001g0120	1	327	0.0031	1	c.204 others(5): Show c.2042dupA	p.Asn others(5): Show p.Asn681fs	OFD1	ENSG00000046651.16	transcript	ENST00000340096.11	protein_coding	16/23	2367/3612	2043/3039	681/1012	INFO_REALIGN_3_PRIME	chrX	TogoVar
OFD1_chrX_13729748_13774357	13760598	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0005 a0005	a0005c0008 a0005c0008	a0005c0008t0001 a0005c0008t0001	a0005c0008t0001g0120 a0005c0008t0001g0120	1	327	0.0031	1	c.213 others(5): Show c.2139dupC	p.Val others(5): Show p.Val714fs	OFD1	ENSG00000046651.16	transcript	ENST00000340096.11	protein_coding	16/23	2464/3612	2140/3039	714/1012	INFO_REALIGN_3_PRIME	chrX	TogoVar
OFD1_chrX_13729748_13774357	13760638	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0005 a0005	a0005c0008 a0005c0008	a0005c0008t0001 a0005c0008t0001	a0005c0008t0001g0120 a0005c0008t0001g0120	1	327	0.0031	1	c.218 others(5): Show c.2183dupG	p.Thr others(5): Show p.Thr729fs	OFD1	ENSG00000046651.16	transcript	ENST00000340096.11	protein_coding	16/23	2508/3612	2184/3039	728/1012	INFO_REALIGN_3_PRIME	chrX	TogoVar
OFD1_chrX_13729748_13774357	13760671	AC AC	A A	frameshift_variant frameshift_variant	HIGH	NA18992.hp2 NA18992.hp2	a0004 a0004	a0004c0012 a0004c0012	a0004c0012t0002 a0004c0012t0002	a0004c0012t0002g0155 a0004c0012t0002g0155	1	327	0.0031	-1	c.221 others(5): Show c.2215delC	p.Leu others(5): Show p.Leu739fs	OFD1	ENSG00000046651.16	transcript	ENST00000340096.11	protein_coding	16/23	2539/3612	2215/3039	739/1012	INFO_REALIGN_3_PRIME	chrX	TogoVar
OFD1_chrX_13729748_13774357	13760685	CA CA	C C	frameshift_variant frameshift_variant	HIGH	NA18992.hp2 NA18992.hp2	a0004 a0004	a0004c0012 a0004c0012	a0004c0012t0002 a0004c0012t0002	a0004c0012t0002g0155 a0004c0012t0002g0155	1	327	0.0031	-1	c.223 others(5): Show c.2230delA	p.Arg others(5): Show p.Arg744fs	OFD1	ENSG00000046651.16	transcript	ENST00000340096.11	protein_coding	16/23	2554/3612	2230/3039	744/1012	INFO_REALIGN_3_PRIME	chrX	TogoVar
OFD1_chrX_13729748_13774357	13760706	A A	AAATGT AAATGT	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA18992.hp2 NA18992.hp2	a0004 a0004	a0004c0012 a0004c0012	a0004c0012t0002 a0004c0012t0002	a0004c0012t0002g0155 a0004c0012t0002g0155	1	327	0.0031	5	c.224 others(14): Show c.2248_2252dupATGTA	p.Tyr others(5): Show p.Tyr751fs	OFD1	ENSG00000046651.16	transcript	ENST00000340096.11	protein_coding	16/23	2577/3612	2253/3039	751/1012	INFO_REALIGN_3_PRIME	chrX	TogoVar
OFD1_chrX_13729748_13774357	13761083	A A	AG AG	frameshift_variant others(1): Show frameshift_variant splice_region_variant	HIGH	NA19075.hp1 NA19075.hp1	a0005 a0005	a0005c0008 a0005c0008	a0005c0008t0001 a0005c0008t0001	a0005c0008t0001g0120 a0005c0008t0001g0120	1	327	0.0031	1	c.226 others(5): Show c.2261dupG	p.Leu others(5): Show p.Leu755fs	OFD1	ENSG00000046651.16	transcript	ENST00000340096.11	protein_coding	17/23	2586/3612	2262/3039	754/1012	INFO_REALIGN_3_PRIME	chrX	TogoVar
OFD1_chrX_13729748_13774357	13761083	AG AG	A A	frameshift_variant others(1): Show frameshift_variant splice_region_variant	HIGH	NA18992.hp2 NA18992.hp2	a0004 a0004	a0004c0012 a0004c0012	a0004c0012t0002 a0004c0012t0002	a0004c0012t0002g0155 a0004c0012t0002g0155	1	327	0.0031	-1	c.226 others(5): Show c.2261delG	p.Gly others(5): Show p.Gly754fs	OFD1	ENSG00000046651.16	transcript	ENST00000340096.11	protein_coding	17/23	2585/3612	2261/3039	754/1012	INFO_REALIGN_3_PRIME	chrX	TogoVar
OFD1_chrX_13729748_13774357	13761108	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA18992.hp2 NA18992.hp2	a0004 a0004	a0004c0012 a0004c0012	a0004c0012t0002 a0004c0012t0002	a0004c0012t0002g0155 a0004c0012t0002g0155	1	327	0.0031	1	c.228 others(5): Show c.2289dupC	p.Ser others(5): Show p.Ser764fs	OFD1	ENSG00000046651.16	transcript	ENST00000340096.11	protein_coding	17/23	2614/3612	2290/3039	764/1012	INFO_REALIGN_3_PRIME	chrX	TogoVar
OGFOD2_chr12_122970244_122985042	122979102	AGCCCCTG others(19): Show AGCCCCTGGAGGTGGAGCACGTGGTGG	A A	frameshift_variant frameshift_variant	HIGH	HG03209.hp2 HG03209.hp2	a0004 a0004	a0004c0008 a0004c0008	a0004c0008t0001 a0004c0008t0001	a0004c0008t0001g0002 a0004c0008t0001g0002	1	366	0.0027	-26	c.813 others(33): Show c.813_838delCCTGGAGGTGGAGCACGTGGTGGGCC	p.Leu others(5): Show p.Leu272fs	OGFOD2	ENSG00000111325.16	transcript	ENST00000228922.12	protein_coding	7/7	821/1757	813/1053	271/350	INFO_REALIGN_3_PRIME	chr12	TogoVar
OGFR_chr20_62799835_62819000	62813338	GCCGAGAG others(54): Show GCCGAGAGCCCATCGGAGACCCCAGGCCCCAGCCCGGCAGGACCTACAAG GGATGAGCCAGC	G G	frameshift_variant frameshift_variant	HIGH	HG03654.hp1 HG03654.hp1	a0000 a0000	a0000c0061 a0000c0061	a0000c0061t0002 a0000c0061t0002	a0000c0061t0002g0062 a0000c0061t0002g0062	1	422	0.0024	-61	c.172 others(70): Show c.1725_1785delCGAGAGCCCATCGGAGACCCCAGGCCCCAGCCCGGC AGGACCTACAAGGGATGAGCCAGCC	p.Glu others(5): Show p.Glu576fs	OGFR	ENSG00000060491.17	transcript	ENST00000290291.10	protein_coding	7/7	1750/2410	1725/2034	575/677	INFO_REALIGN_3_PRIME	chr20	TogoVar
OGT_chrX_71528104_71580892	71555954	GT GT	G G	frameshift_variant others(1): Show frameshift_variant splice_region_variant	HIGH	NA18953.hp1 NA18953.hp1	a0002 a0002	a0002c0005 a0002c0005	a0002c0005t0006 a0002c0005t0006	a0002c0005t0006g0069 a0002c0005t0006g0069	1	257	0.0039	-1	c.927 others(4): Show c.927delT	p.Ala others(5): Show p.Ala310fs	OGT	ENSG00000147162.15	transcript	ENST00000373719.8	protein_coding	8/22	1123/5435	927/3141	309/1046	INFO_REALIGN_3_PRIME	chrX	TogoVar
OIP5_chr15_41304273_41337591	41332540	GCCGCAGC others(18): Show GCCGCAGCGGCTGAGCCGCCATCTTC	G G	frameshift_variant others(1): Show frameshift_variant start_lost	HIGH	HG01496.hp2 HG01496.hp2	a0006 a0006	a0006c0007 a0006c0007	a0006c0007t0005 a0006c0007t0005	a0006c0007t0005g0036 a0006c0007t0005g0036	1	356	0.0028	-25	c.-4_ others(30): Show c.-4_21delGAAGATGGCGGCTCAGCCGCTGCGG	p.Met others(3): Show p.Met1fs	OIP5	ENSG00000104147.9	transcript	ENST00000220514.8	protein_coding	1/5	51/1201	1/690	1/229		chr15	TogoVar
OLIG1_chr21_33065141_33077413	33070847	GTGCTGCT others(19): Show GTGCTGCTGGCGCCCGGCGCCGTAGGA	G G	frameshift_variant frameshift_variant	HIGH	NA19057.hp2 NA19057.hp2	a0000 a0000	a0000c0005 a0000c0005	a0000c0005t0001 a0000c0005t0001	a0000c0005t0001g0000 a0000c0005t0001g0000	1	454	0.0022	-26	c.602 others(33): Show c.602_627delTGCTGCTGGCGCCCGGCGCCGTAGGA	p.Val others(5): Show p.Val201fs	OLIG1	ENSG00000184221.13	transcript	ENST00000382348.2	protein_coding	1/1	708/2273	602/816	201/271		chr21	TogoVar
ONECUT3_chr19_1748506_1785988	1754124	A A	AC AC	frameshift_variant frameshift_variant	HIGH	HG00621.hp2 HG01099.hp2 HG01261.hp1 others(9): Show HG00621.hp2 HG01099.hp2 HG01261.hp1 HG01934.hp2 HG02055.hp2 HG02135.hp2 HG02622.hp1 HG02818.hp2 HG03927.hp1 HG04199.hp2 NA18985.hp2 NA19083.hp2	a0002 a0005 a0002 a0005	a0002c0002 a0002c0013 a0005c0008 a0002c0002 a0002c0013 a0005c0008	a0002c0002t0006 a0002c0002t0027 a0002c0002t0124 others(9): Show a0002c0002t0006 a0002c0002t0027 a0002c0002t0124 a0002c0002t0139 a0002c0002t0158 a0002c0002t0220 a0002c0002t0231 a0002c0002t0247 a0002c0002t0273 a0002c0013t0292 a0005c0008t0129 a0005c0008t0175	a0002c0002t0006g0165 a0002c0002t0027g0255 a0002c0002t0124g0150 others(9): Show a0002c0002t0006g0165 a0002c0002t0027g0255 a0002c0002t0124g0150 a0002c0002t0139g0279 a0002c0002t0158g0307 a0002c0002t0220g0132 a0002c0002t0231g0178 a0002c0002t0247g0202 a0002c0002t0273g0171 a0002c0013t0292g0337 a0005c0008t0129g0252 a0005c0008t0175g0157	12	370	0.0324	1	c.467 others(4): Show c.467dupC	p.Pro others(5): Show p.Pro157fs	ONECUT3	ENSG00000205922.5	transcript	ENST00000382349.5	protein_coding	1/2	625/7185	468/1485	156/494	INFO_REALIGN_3_PRIME	chr19	TogoVar
ONECUT3_chr19_1748506_1785988	1754325	A A	AC AC	frameshift_variant frameshift_variant	HIGH	HG01928.hp1 HG02055.hp1 HG03471.hp1 others(8): Show HG01928.hp1 HG02055.hp1 HG03471.hp1 HG03710.hp1 HG04115.hp2 HG04199.hp2 HG04204.hp2 HG04228.hp1 NA18973.hp1 NA18980.hp1 NA18985.hp2	a0003 a0005 a0009 a0003 a0005 a0009	a0003c0003 a0005c0008 a0009c0017 a0003c0003 a0005c0008 a0009c0017	a0003c0003t0045 a0003c0003t0135 a0003c0003t0143 others(8): Show a0003c0003t0045 a0003c0003t0135 a0003c0003t0143 a0003c0003t0153 a0003c0003t0176 a0003c0003t0226 a0003c0003t0237 a0003c0003t0280 a0005c0008t0129 a0005c0008t0175 a0009c0017t0151	a0003c0003t0045g0076 a0003c0003t0135g0005 a0003c0003t0143g0097 others(8): Show a0003c0003t0045g0076 a0003c0003t0135g0005 a0003c0003t0143g0097 a0003c0003t0153g0358 a0003c0003t0176g0063 a0003c0003t0226g0207 a0003c0003t0237g0186 a0003c0003t0280g0189 a0005c0008t0129g0252 a0005c0008t0175g0157 a0009c0017t0151g0271	11	370	0.0297	1	c.668 others(4): Show c.668dupC	p.Pro others(5): Show p.Pro224fs	ONECUT3	ENSG00000205922.5	transcript	ENST00000382349.5	protein_coding	1/2	826/7185	669/1485	223/494	INFO_REALIGN_3_PRIME	chr19	TogoVar
OPHN1_chrX_68037344_68438495	68053689	CT CT	C C	frameshift_variant frameshift_variant	HIGH	HG01169.hp2 HG01169.hp2	a0004 a0004	a0004c0005 a0004c0005	a0004c0005t0012 a0004c0005t0012	a0004c0005t0012g0024 a0004c0005t0012g0024	1	155	0.0065	-1	c.227 others(5): Show c.2279delA	p.Lys others(5): Show p.Lys760fs	OPHN1	ENSG00000079482.14	transcript	ENST00000355520.6	protein_coding	22/25	2611/7569	2279/2409	760/802		chrX	TogoVar
OPHN1_chrX_68037344_68438495	68053705	TG TG	T T	frameshift_variant frameshift_variant	HIGH	HG01169.hp2 HG01169.hp2	a0004 a0004	a0004c0005 a0004c0005	a0004c0005t0012 a0004c0005t0012	a0004c0005t0012g0024 a0004c0005t0012g0024	1	155	0.0065	-1	c.226 others(5): Show c.2263delC	p.Gln others(5): Show p.Gln755fs	OPHN1	ENSG00000079482.14	transcript	ENST00000355520.6	protein_coding	22/25	2595/7569	2263/2409	755/802		chrX	TogoVar
OPN1LW_chrX_154139243_154164032	154150916	AT AT	A A	frameshift_variant frameshift_variant	HIGH	NA19240.hp1 NA19240.hp1	a0019 a0019	a0019c0044 a0019c0044	a0019c0044t0010 a0019c0044t0010	a0019c0044t0010g0135 a0019c0044t0010g0135	1	258	0.0039	-1	c.374 others(4): Show c.374delT	p.Met others(5): Show p.Met125fs	OPN1LW	ENSG00000102076.10	transcript	ENST00000369951.9	protein_coding	2/6	415/1242	374/1095	125/364		chrX	TogoVar
OPN1LW_chrX_154139243_154164032	154153099	GT GT	G G	frameshift_variant frameshift_variant	HIGH	NA19240.hp1 NA19240.hp1	a0019 a0019	a0019c0044 a0019c0044	a0019c0044t0010 a0019c0044t0010	a0019c0044t0010g0135 a0019c0044t0010g0135	1	258	0.0039	-1	c.571 others(4): Show c.571delT	p.Trp others(5): Show p.Trp191fs	OPN1LW	ENSG00000102076.10	transcript	ENST00000369951.9	protein_coding	3/6	612/1242	571/1095	191/364	INFO_REALIGN_3_PRIME	chrX	TogoVar
OPN1LW_chrX_154139243_154164032	154154606	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19240.hp1 NA19240.hp1	a0019 a0019	a0019c0044 a0019c0044	a0019c0044t0010 a0019c0044t0010	a0019c0044t0010g0135 a0019c0044t0010g0135	1	258	0.0039	-1	c.614 others(4): Show c.614delC	p.Pro others(5): Show p.Pro205fs	OPN1LW	ENSG00000102076.10	transcript	ENST00000369951.9	protein_coding	4/6	655/1242	614/1095	205/364	INFO_REALIGN_3_PRIME	chrX	TogoVar
OPN1LW_chrX_154139243_154164032	154154660	T T	TC TC	frameshift_variant frameshift_variant	HIGH	HG01169.hp1 NA19240.hp1 HG01169.hp1 NA19240.hp1	a0019 a0030 a0019 a0030	a0019c0044 a0030c0025 a0019c0044 a0030c0025	a0019c0044t0010 a0030c0025t0005 a0019c0044t0010 a0030c0025t0005	a0019c0044t0010g0135 a0030c0025t0005g0065 a0019c0044t0010g0135 a0030c0025t0005g0065	2	258	0.0078	1	c.667 others(4): Show c.667dupC	p.Leu others(5): Show p.Leu223fs	OPN1LW	ENSG00000102076.10	transcript	ENST00000369951.9	protein_coding	4/6	709/1242	668/1095	223/364	INFO_REALIGN_3_PRIME	chrX	TogoVar
OPN1LW_chrX_154139243_154164032	154154719	GT GT	G G	frameshift_variant frameshift_variant	HIGH	NA19240.hp1 NA19240.hp1	a0019 a0019	a0019c0044 a0019c0044	a0019c0044t0010 a0019c0044t0010	a0019c0044t0010g0135 a0019c0044t0010g0135	1	258	0.0039	-1	c.725 others(4): Show c.725delT	p.Val others(5): Show p.Val242fs	OPN1LW	ENSG00000102076.10	transcript	ENST00000369951.9	protein_coding	4/6	766/1242	725/1095	242/364		chrX	TogoVar
OPN1LW_chrX_154139243_154164032	154156292	A A	AG AG	frameshift_variant others(1): Show frameshift_variant splice_region_variant	HIGH	HG03225.hp1 HG03225.hp1	a0007 a0007	a0007c0035 a0007c0035	a0007c0035t0006 a0007c0035t0006	a0007c0035t0006g0133 a0007c0035t0006g0133	1	258	0.0039	1	c.745 others(4): Show c.745dupG	p.Val others(5): Show p.Val249fs	OPN1LW	ENSG00000102076.10	transcript	ENST00000369951.9	protein_coding	5/6	787/1242	746/1095	249/364	INFO_REALIGN_3_PRIME	chrX	TogoVar
OPN1LW_chrX_154139243_154164032	154156321	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA19240.hp1 NA19240.hp1	a0019 a0019	a0019c0044 a0019c0044	a0019c0044t0010 a0019c0044t0010	a0019c0044t0010g0135 a0019c0044t0010g0135	1	258	0.0039	-1	c.774 others(4): Show c.774delC	p.Thr others(5): Show p.Thr259fs	OPN1LW	ENSG00000102076.10	transcript	ENST00000369951.9	protein_coding	5/6	815/1242	774/1095	258/364	INFO_REALIGN_3_PRIME	chrX	TogoVar
OPN1LW_chrX_154139243_154164032	154156329	GA GA	G G	frameshift_variant frameshift_variant	HIGH	HG01169.hp1 HG01169.hp1	a0030 a0030	a0030c0025 a0030c0025	a0030c0025t0005 a0030c0025t0005	a0030c0025t0005g0065 a0030c0025t0005g0065	1	258	0.0039	-1	c.782 others(4): Show c.782delA	p.Lys others(5): Show p.Lys261fs	OPN1LW	ENSG00000102076.10	transcript	ENST00000369951.9	protein_coding	5/6	823/1242	782/1095	261/364	INFO_REALIGN_3_PRIME	chrX	TogoVar
OPN1LW_chrX_154139243_154164032	154156399	T T	TA TA	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	HG01169.hp1 HG01169.hp1	a0030 a0030	a0030c0025 a0030c0025	a0030c0025t0005 a0030c0025t0005	a0030c0025t0005g0065 a0030c0025t0005g0065	1	258	0.0039	1	c.851 others(4): Show c.851dupA	p.Tyr others(5): Show p.Tyr284fs	OPN1LW	ENSG00000102076.10	transcript	ENST00000369951.9	protein_coding	5/6	893/1242	852/1095	284/364	INFO_REALIGN_3_PRIME	chrX	TogoVar
OPN1LW_chrX_154139243_154164032	154156469	CG CG	C C	frameshift_variant frameshift_variant	HIGH	NA18988.hp1 NA18988.hp1	a0023 a0023	a0023c0031 a0023c0031	a0023c0031t0001 a0023c0031t0001	a0023c0031t0001g0074 a0023c0031t0001g0074	1	258	0.0039	-1	c.922 others(4): Show c.922delG	p.Ala others(5): Show p.Ala308fs	OPN1LW	ENSG00000102076.10	transcript	ENST00000369951.9	protein_coding	5/6	963/1242	922/1095	308/364	INFO_REALIGN_3_PRIME	chrX	TogoVar
OPN1LW_chrX_154139243_154164032	154156507	GT GT	G G	frameshift_variant frameshift_variant	HIGH	HG01169.hp1 HG01169.hp1	a0030 a0030	a0030c0025 a0030c0025	a0030c0025t0005 a0030c0025t0005	a0030c0025t0005g0065 a0030c0025t0005g0065	1	258	0.0039	-1	c.960 others(4): Show c.960delT	p.Ile others(5): Show p.Ile321fs	OPN1LW	ENSG00000102076.10	transcript	ENST00000369951.9	protein_coding	5/6	1001/1242	960/1095	320/364	INFO_REALIGN_3_PRIME	chrX	TogoVar
OPN1LW_chrX_154139243_154164032	154158824	C C	CT CT	frameshift_variant frameshift_variant	HIGH	HG02965.hp1 HG02965.hp1	a0031 a0031	a0031c0036 a0031c0036	a0031c0036t0001 a0031c0036t0001	a0031c0036t0001g0119 a0031c0036t0001g0119	1	258	0.0039	1	c.994 others(4): Show c.994dupT	p.Cys others(5): Show p.Cys332fs	OPN1LW	ENSG00000102076.10	transcript	ENST00000369951.9	protein_coding	6/6	1036/1242	995/1095	332/364	INFO_REALIGN_3_PRIME	chrX	TogoVar
OPN1MW2_chrX_154214756_154238286	154228887	A A	AC AC	frameshift_variant frameshift_variant	HIGH	HG01261.hp1 HG01261.hp1	a0013 a0013	a0013c0026 a0013c0026	a0013c0026t0001 a0013c0026t0001	a0013c0026t0001g0039 a0013c0026t0001g0039	1	111	0.0090	1	c.642 others(4): Show c.642dupC	p.Gly others(5): Show p.Gly215fs	OPN1MW2	ENSG00000166160.9	transcript	ENST00000369929.8	protein_coding	4/6	703/1261	643/1095	215/364	INFO_REALIGN_3_PRIME	chrX	TogoVar
OPN1MW2_chrX_154214756_154238286	154228967	C C	CT CT	frameshift_variant frameshift_variant	HIGH	NA18985.hp1 NA18985.hp1	a0014 a0014	a0014c0022 a0014c0022	a0014c0022t0002 a0014c0022t0002	a0014c0022t0002g0056 a0014c0022t0002g0056	1	111	0.0090	1	c.719 others(4): Show c.719dupT	p.Gln others(5): Show p.Gln241fs	OPN1MW2	ENSG00000166160.9	transcript	ENST00000369929.8	protein_coding	4/6	780/1261	720/1095	240/364	INFO_REALIGN_3_PRIME	chrX	TogoVar
OPN1MW2_chrX_154214756_154238286	154233145	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA18985.hp1 NA18985.hp1	a0014 a0014	a0014c0022 a0014c0022	a0014c0022t0002 a0014c0022t0002	a0014c0022t0002g0056 a0014c0022t0002g0056	1	111	0.0090	1	c.106 others(10): Show c.1060_1061insC	p.Glu others(5): Show p.Glu354fs	OPN1MW2	ENSG00000166160.9	transcript	ENST00000369929.8	protein_coding	6/6	1121/1261	1061/1095	354/364		chrX	TogoVar
OPN1MW3_chrX_154252582_154276090	154257623	G G	GC GC	frameshift_variant frameshift_variant	HIGH	HG00621.hp1 HG00621.hp1	a0002 a0002	a0002c0006 a0002c0006	a0002c0006t0001 a0002c0006t0001	a0002c0006t0001g0001 a0002c0006t0001g0001	1	7	0.1429	1	c.7du others(2): Show c.7dupC	p.Gln others(3): Show p.Gln3fs	OPN1MW3	ENSG00000269433.4	transcript	ENST00000599405.4	protein_coding	1/6	46/1239	8/1095	3/364	INFO_REALIGN_3_PRIME	chrX	TogoVar
OPN1MW3_chrX_154252582_154276090	154265066	CA CA	C C	frameshift_variant frameshift_variant	HIGH	HG02486.hp1 HG02486.hp1	a0003 a0003	a0003c0005 a0003c0005	a0003c0005t0001 a0003c0005t0001	a0003c0005t0001g0004 a0003c0005t0001g0004	1	7	0.1429	-1	c.482 others(4): Show c.482delA	p.Asn others(5): Show p.Asn161fs	OPN1MW3	ENSG00000269433.4	transcript	ENST00000599405.4	protein_coding	3/6	520/1239	482/1095	161/364	INFO_REALIGN_3_PRIME	chrX	TogoVar
OPN1MW3_chrX_154252582_154276090	154266646	G G	GC GC	frameshift_variant frameshift_variant	HIGH	HG02145.hp1 HG02145.hp1	a0006 a0006	a0006c0003 a0006c0003	a0006c0003t0002 a0006c0003t0002	a0006c0003t0002g0005 a0006c0003t0002g0005	1	7	0.1429	1	c.595 others(4): Show c.595dupC	p.Leu others(5): Show p.Leu199fs	OPN1MW3	ENSG00000269433.4	transcript	ENST00000599405.4	protein_coding	4/6	634/1239	596/1095	199/364	INFO_REALIGN_3_PRIME	chrX	TogoVar
OPN1MW3_chrX_154252582_154276090	154266664	G G	GC GC	frameshift_variant frameshift_variant	HIGH	HG02145.hp1 HG02145.hp1	a0006 a0006	a0006c0003 a0006c0003	a0006c0003t0002 a0006c0003t0002	a0006c0003t0002g0005 a0006c0003t0002g0005	1	7	0.1429	1	c.614 others(4): Show c.614dupC	p.Asp others(5): Show p.Asp206fs	OPN1MW3	ENSG00000269433.4	transcript	ENST00000599405.4	protein_coding	4/6	653/1239	615/1095	205/364	INFO_REALIGN_3_PRIME	chrX	TogoVar
OPN1MW3_chrX_154252582_154276090	154266671	C C	CG CG	frameshift_variant frameshift_variant	HIGH	HG02486.hp1 HG02486.hp1	a0003 a0003	a0003c0005 a0003c0005	a0003c0005t0001 a0003c0005t0001	a0003c0005t0001g0004 a0003c0005t0001g0004	1	7	0.1429	1	c.619 others(4): Show c.619dupG	p.Val others(5): Show p.Val207fs	OPN1MW3	ENSG00000269433.4	transcript	ENST00000599405.4	protein_coding	4/6	658/1239	620/1095	207/364	INFO_REALIGN_3_PRIME	chrX	TogoVar
OPN1MW3_chrX_154252582_154276090	154266678	A A	AGT AGT	frameshift_variant frameshift_variant	HIGH	HG02145.hp1 HG02145.hp1	a0006 a0006	a0006c0003 a0006c0003	a0006c0003t0002 a0006c0003t0002	a0006c0003t0002g0005 a0006c0003t0002g0005	1	7	0.1429	2	c.626 others(9): Show c.626_627insTG	p.Gly others(5): Show p.Gly210fs	OPN1MW3	ENSG00000269433.4	transcript	ENST00000599405.4	protein_coding	4/6	665/1239	627/1095	209/364	INFO_REALIGN_3_PRIME	chrX	TogoVar

Search by Variant

Search

Search Results (Total: 5828 hits)