JoGo: Joint Open Genome and Omics Platform

Search by Variant

Regionname

e.g. ALDH2_chr12_111761933_111822532, HBB_chr11_5220464_5232071.

Chr

Chromosome name (e.g., chr11).

Snpeff genename

Exact SnpEff gene name.

Sampleids

Target sampleid (e.g. HG02615).

Snpeff haplotype class

Haplotype-annotation class (e.g., ahapid, ahapid+chapid).

Snpeff annotation impact

Exact impact level (e.g., HIGH, MODERATE, LOW).

Snpeff annotation impact detail

Keyword match in SnpEff annotation.

Hapid

One or more haplotype IDs (comma-separated; e.g., a0001, a01, a0001c0001, a01c02, a1c2, a0001c0001t0005, a0001c0001t0005g0018).

Samplehapid

Sample haplotype IDs to include (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

No_hapid

Haplotype IDs to exclude (comma-separated; e.g., a0001, a0002, a0001c0001, a0001c0001t0005, a1, a01).

No_samplehapid

Sample haplotype IDs to exclude (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

Start

Start position (GRCh38).

End

End position (GRCh38).

Minac

Minimum alternate allele count (≥).

Maxac

Maximum alternate allele count (≤).

Minlen

Minimum variant length (≥).

Maxlen

Maximum variant length (≤).

Sort By

Select column to sort.

Order by

Ascending or descending.

Show

Results per page.

regionname	pos	ref	alt	annotation	impact	samples	ahapids	achapids	acthapids	actghapids	ac	an	af	len	hgvs_c	hgvs_p	genename	geneid	featuretype	featureid	transcript_biotype	rank	cdna cdna pos length	cds cds pos length	aa aa pos length	status	chr	external
PLXNB3_chrX_153759249_153784341	153776922	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA18941.hp2 NA18941.hp2	a0013 a0013	a0013c0032 a0013c0032	a0013c0032t0004 a0013c0032t0004	a0013c0032t0004g0085 a0013c0032t0004g0085	1	308	0.0033	1	c.487 others(5): Show c.4870dupC	p.Leu others(6): Show p.Leu1624fs	PLXNB3	ENSG00000198753.12	transcript	ENST00000361971.10	protein_coding	29/36	4992/6153	4871/5730	1624/1909	INFO_REALIGN_3_PRIME	chrX	TogoVar
PLXNB3_chrX_153759249_153784341	153777235	A A	AG AG	frameshift_variant frameshift_variant	HIGH	HG02572.hp1 HG04184.hp2 NA19058.hp1 others(2): Show HG02572.hp1 HG04184.hp2 NA19058.hp1 NA19076.hp1 NA19082.hp1	a0011 a0015 a0017 others(1): Show a0011 a0015 a0017 a0022	a0011c0017 a0015c0037 a0017c0035 others(1): Show a0011c0017 a0015c0037 a0017c0035 a0022c0043	a0011c0017t0001 a0015c0037t0008 a0017c0035t0001 others(1): Show a0011c0017t0001 a0015c0037t0008 a0017c0035t0001 a0022c0043t0001	a0011c0017t0001g0058 a0011c0017t0001g0073 a0015c0037t0008g0112 others(2): Show a0011c0017t0001g0058 a0011c0017t0001g0073 a0015c0037t0008g0112 a0017c0035t0001g0050 a0022c0043t0001g0001	5	308	0.0162	1	c.496 others(5): Show c.4963dupG	p.Val others(6): Show p.Val1655fs	PLXNB3	ENSG00000198753.12	transcript	ENST00000361971.10	protein_coding	30/36	5085/6153	4964/5730	1655/1909	INFO_REALIGN_3_PRIME	chrX	TogoVar
PLXNB3_chrX_153759249_153784341	153777346	CG CG	C C	frameshift_variant frameshift_variant	HIGH	NA19058.hp1 NA19058.hp1	a0015 a0015	a0015c0037 a0015c0037	a0015c0037t0008 a0015c0037t0008	a0015c0037t0008g0112 a0015c0037t0008g0112	1	308	0.0033	-1	c.506 others(5): Show c.5068delG	p.Glu others(6): Show p.Glu1690fs	PLXNB3	ENSG00000198753.12	transcript	ENST00000361971.10	protein_coding	30/36	5189/6153	5068/5730	1690/1909	INFO_REALIGN_3_PRIME	chrX	TogoVar
PLXNB3_chrX_153759249_153784341	153778049	AGACCTTC others(4): Show AGACCTTCATTG	A A	frameshift_variant frameshift_variant	HIGH	NA21309.hp1 NA21309.hp1	a0021 a0021	a0021c0042 a0021c0042	a0021c0042t0001 a0021c0042t0001	a0021c0042t0001g0062 a0021c0042t0001g0062	1	308	0.0033	-11	c.536 others(20): Show c.5364_5374delGACCTTCATTG	p.Thr others(6): Show p.Thr1789fs	PLXNB3	ENSG00000198753.12	transcript	ENST00000361971.10	protein_coding	32/36	5485/6153	5364/5730	1788/1909		chrX	TogoVar
PLXNB3_chrX_153759249_153784341	153778062	CTCCTG CTCCTG	C C	frameshift_variant frameshift_variant	HIGH	NA21309.hp1 NA21309.hp1	a0021 a0021	a0021c0042 a0021c0042	a0021c0042t0001 a0021c0042t0001	a0021c0042t0001g0062 a0021c0042t0001g0062	1	308	0.0033	-5	c.537 others(14): Show c.5378_5382delCCTGT	p.Ser others(6): Show p.Ser1793fs	PLXNB3	ENSG00000198753.12	transcript	ENST00000361971.10	protein_coding	32/36	5499/6153	5378/5730	1793/1909	INFO_REALIGN_3_PRIME	chrX	TogoVar
PLXNB3_chrX_153759249_153784341	153778080	GCATA GCATA	G G	frameshift_variant frameshift_variant	HIGH	NA21309.hp1 NA21309.hp1	a0021 a0021	a0021c0042 a0021c0042	a0021c0042t0001 a0021c0042t0001	a0021c0042t0001g0062 a0021c0042t0001g0062	1	308	0.0033	-4	c.539 others(13): Show c.5395_5398delCATA	p.His others(6): Show p.His1799fs	PLXNB3	ENSG00000198753.12	transcript	ENST00000361971.10	protein_coding	32/36	5516/6153	5395/5730	1799/1909		chrX	TogoVar
PLXNB3_chrX_153759249_153784341	153778262	A A	AT AT	frameshift_variant frameshift_variant	HIGH	NA18939.hp1 NA18939.hp1	a0023 a0023	a0023c0045 a0023c0045	a0023c0045t0006 a0023c0045t0006	a0023c0045t0006g0080 a0023c0045t0006g0080	1	308	0.0033	1	c.541 others(5): Show c.5413dupT	p.Ser others(6): Show p.Ser1805fs	PLXNB3	ENSG00000198753.12	transcript	ENST00000361971.10	protein_coding	33/36	5535/6153	5414/5730	1805/1909	INFO_REALIGN_3_PRIME	chrX	TogoVar
PLXNB3_chrX_153759249_153784341	153779007	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA18939.hp1 NA18939.hp1	a0023 a0023	a0023c0045 a0023c0045	a0023c0045t0006 a0023c0045t0006	a0023c0045t0006g0080 a0023c0045t0006g0080	1	308	0.0033	-1	c.570 others(5): Show c.5701delC	p.Leu others(6): Show p.Leu1901fs	PLXNB3	ENSG00000198753.12	transcript	ENST00000361971.10	protein_coding	36/36	5822/6153	5701/5730	1901/1909	INFO_REALIGN_3_PRIME	chrX	TogoVar
PMIS2_chr19_35581173_35592296	35586327	CT CT	C C	frameshift_variant frameshift_variant	HIGH	HG00408.hp1 HG00423.hp1 HG00544.hp1 others(69): Show HG00408.hp1 HG00423.hp1 HG00544.hp1 HG00597.hp1 HG00609.hp1 HG00673.hp2 HG01255.hp1 HG01257.hp2 HG01258.hp1 HG01261.hp1 HG01261.hp2 HG01346.hp1 HG01358.hp1 HG01433.hp1 HG01952.hp2 HG01978.hp2 HG01993.hp1 HG02027.hp1 HG02040.hp1 HG02071.hp1 HG02074.hp1 HG02080.hp1 HG02083.hp1 HG02083.hp2 HG02129.hp2 HG02132.hp1 HG02132.hp2 HG02135.hp2 HG02155.hp2 HG02165.hp2 HG02523.hp2 HG02683.hp2 HG02809.hp2 NA18612.hp1 NA18612.hp2 NA18939.hp1 NA18940.hp1 NA18941.hp1 NA18947.hp2 NA18949.hp2 NA18952.hp2 NA18953.hp2 NA18954.hp1 NA18957.hp2 NA18960.hp2 NA18966.hp1 NA18968.hp2 NA18969.hp2 NA18971.hp1 NA18972.hp1 NA18973.hp1 NA18980.hp2 NA18984.hp2 NA18986.hp2 NA18992.hp2 NA18994.hp1 NA18994.hp2 NA18995.hp1 NA18997.hp1 NA18998.hp2 NA19003.hp2 NA19062.hp2 NA19066.hp1 NA19067.hp2 NA19070.hp1 NA19078.hp2 NA19080.hp1 NA19082.hp2 NA19084.hp1 NA19088.hp2 NA20300.hp1 NA20752.hp2	a0003 a0003	a0003c0003 a0003c0003	a0003c0003t0001 a0003c0003t0002 a0003c0003t0001 a0003c0003t0002	a0003c0003t0001g0002 a0003c0003t0001g0003 a0003c0003t0001g0009 others(3): Show a0003c0003t0001g0002 a0003c0003t0001g0003 a0003c0003t0001g0009 a0003c0003t0001g0010 a0003c0003t0001g0013 a0003c0003t0002g0003	72	444	0.1622	-1	c.69d others(3): Show c.69delT	p.Thr others(4): Show p.Thr24fs	PMIS2	ENSG00000283758.2	transcript	ENST00000640449.2	protein_coding	1/2	156/690	69/453	23/150		chr19	TogoVar
PML_chr15_73989716_74052827	74023135	C C	CG CG	frameshift_variant frameshift_variant	HIGH	HG00423.hp1 HG00738.hp1 HG00738.hp2 others(17): Show HG00423.hp1 HG00738.hp1 HG00738.hp2 HG01109.hp2 HG01243.hp1 HG01243.hp2 HG01255.hp2 HG01928.hp1 HG02055.hp2 HG02145.hp1 HG02145.hp2 HG02559.hp2 HG03471.hp2 HG03669.hp2 NA18955.hp2 NA18966.hp2 NA19011.hp2 NA19056.hp2 NA19081.hp1 NA19081.hp2	a0003 a0003	a0003c0003 a0003c0006 a0003c0008 others(4): Show a0003c0003 a0003c0006 a0003c0008 a0003c0009 a0003c0010 a0003c0011 a0003c0012	a0003c0003t0001 a0003c0003t0002 a0003c0003t0003 others(7): Show a0003c0003t0001 a0003c0003t0002 a0003c0003t0003 a0003c0006t0001 a0003c0006t0002 a0003c0008t0001 a0003c0009t0001 a0003c0010t0001 a0003c0011t0003 a0003c0012t0001	a0003c0003t0001g0001 a0003c0003t0001g0007 a0003c0003t0001g0008 others(17): Show a0003c0003t0001g0001 a0003c0003t0001g0007 a0003c0003t0001g0008 a0003c0003t0001g0042 a0003c0003t0001g0072 a0003c0003t0001g0075 a0003c0003t0001g0127 a0003c0003t0001g0141 a0003c0003t0002g0004 a0003c0003t0002g0052 a0003c0003t0002g0155 a0003c0003t0002g0178 a0003c0003t0003g0149 a0003c0006t0001g0267 a0003c0006t0002g0143 a0003c0008t0001g0026 a0003c0009t0001g0139 a0003c0010t0001g0232 a0003c0011t0003g0142 a0003c0012t0001g0240	20	342	0.0585	1	c.912 others(4): Show c.912dupG	p.Tyr others(5): Show p.Tyr305fs	PML	ENSG00000140464.20	transcript	ENST00000268058.8	protein_coding	3/9	1010/5565	913/2649	305/882	INFO_REALIGN_3_PRIME	chr15	TogoVar
PMS2_chr7_5965925_6014049	5987291	TCTCCACC others(30): Show TCTCCACCTCCGCTCTGTCCGTAGGGTCACTGGGTCCG	T T	frameshift_variant frameshift_variant	HIGH	NA18994.hp2 NA18994.hp2	a0026 a0026	a0026c0036 a0026c0036	a0026c0036t0027 a0026c0036t0027	a0026c0036t0027g0230 a0026c0036t0027g0230	1	408	0.0025	-37	c.143 others(46): Show c.1437_1473delCGGACCCAGTGACCCTACGGACAGAGCGGAGGTGGA G	p.His others(5): Show p.His479fs	PMS2	ENSG00000122512.17	transcript	ENST00000265849.12	protein_coding	11/15	1503/5093	1437/2589	479/862		chr7	TogoVar
PNCK_chrX_153664733_153678813	153671171	A A	AG AG	frameshift_variant frameshift_variant	HIGH	HG02055.hp1 HG04115.hp1 HG02055.hp1 HG04115.hp1	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0001 a0002c0002t0001	a0002c0002t0001g0041 a0002c0002t0001g0059 a0002c0002t0001g0041 a0002c0002t0001g0059	2	276	0.0073	1	c.633 others(4): Show c.633dupC	p.Phe others(5): Show p.Phe212fs	PNCK	ENSG00000130822.16	transcript	ENST00000340888.8	protein_coding	8/12	669/1473	633/1032	211/343		chrX	TogoVar
PNLIP_chr10_116540931_116572855	116561622	A A	ATTACCTA others(31): Show ATTACCTAGAGTGGGAGCATCCAAGATTAAGTGGAGACC	frameshift_variant frameshift_variant	HIGH	NA19063.hp2 NA19063.hp2	a0000 a0000	a0000c0012 a0000c0012	a0000c0012t0001 a0000c0012t0001	a0000c0012t0001g0082 a0000c0012t0001g0082	1	276	0.0036	38	c.132 others(47): Show c.1320_1321insTTACCTAGAGTGGGAGCATCCAAGATTAAGTGGAGA CC	p.Asn others(5): Show p.Asn441fs	PNLIP	ENSG00000175535.6	transcript	ENST00000369221.2	protein_coding	12/13	1349/1483	1321/1398	441/465		chr10	TogoVar
PNMA3_chrX_153051470_153065462	153057132	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA19063.hp1 NA19063.hp1	a0007 a0007	a0007c0009 a0007c0009	a0007c0009t0052 a0007c0009t0052	a0007c0009t0052g0006 a0007c0009t0052g0006	1	326	0.0031	-1	c.81d others(3): Show c.81delC	p.Glu others(4): Show p.Glu28fs	PNMA3	ENSG00000183837.10	transcript	ENST00000593810.3	protein_coding	2/2	356/3682	81/1392	27/463	INFO_REALIGN_3_PRIME	chrX	TogoVar
PNMA3_chrX_153051470_153065462	153057498	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19030.hp1 NA19030.hp1	a0006 a0006	a0006c0008 a0006c0008	a0006c0008t0023 a0006c0008t0023	a0006c0008t0023g0001 a0006c0008t0023g0001	1	326	0.0031	1	c.448 others(4): Show c.448dupG	p.Ala others(5): Show p.Ala150fs	PNMA3	ENSG00000183837.10	transcript	ENST00000593810.3	protein_coding	2/2	724/3682	449/1392	150/463	INFO_REALIGN_3_PRIME	chrX	TogoVar
PNMA3_chrX_153051470_153065462	153057532	G G	GT GT	frameshift_variant frameshift_variant	HIGH	NA19063.hp1 NA19063.hp1	a0007 a0007	a0007c0009 a0007c0009	a0007c0009t0052 a0007c0009t0052	a0007c0009t0052g0006 a0007c0009t0052g0006	1	326	0.0031	1	c.479 others(4): Show c.479dupT	p.Leu others(5): Show p.Leu160fs	PNMA3	ENSG00000183837.10	transcript	ENST00000593810.3	protein_coding	2/2	755/3682	480/1392	160/463	INFO_REALIGN_3_PRIME	chrX	TogoVar
PNMA3_chrX_153051470_153065462	153057871	A A	AC AC	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0001 a0005c0005t0001	a0005c0005t0001g0001 a0005c0005t0001g0001	1	326	0.0031	1	c.820 others(4): Show c.820dupC	p.Leu others(5): Show p.Leu274fs	PNMA3	ENSG00000183837.10	transcript	ENST00000593810.3	protein_coding	2/2	1096/3682	821/1392	274/463	INFO_REALIGN_3_PRIME	chrX	TogoVar
PNMA3_chrX_153051470_153065462	153058168	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19063.hp1 NA19063.hp1	a0007 a0007	a0007c0009 a0007c0009	a0007c0009t0052 a0007c0009t0052	a0007c0009t0052g0006 a0007c0009t0052g0006	1	326	0.0031	-1	c.111 others(5): Show c.1115delG	p.Gly others(5): Show p.Gly372fs	PNMA3	ENSG00000183837.10	transcript	ENST00000593810.3	protein_coding	2/2	1390/3682	1115/1392	372/463	INFO_REALIGN_3_PRIME	chrX	TogoVar
PNMA3_chrX_153051470_153065462	153058176	G G	GT GT	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA19009.hp1 NA19009.hp1	a0004 a0004	a0004c0007 a0004c0007	a0004c0007t0029 a0004c0007t0029	a0004c0007t0029g0001 a0004c0007t0029g0001	1	326	0.0031	1	c.112 others(5): Show c.1125dupT	p.Asp others(5): Show p.Asp376fs	PNMA3	ENSG00000183837.10	transcript	ENST00000593810.3	protein_coding	2/2	1401/3682	1126/1392	376/463	INFO_REALIGN_3_PRIME	chrX	TogoVar
PNMA3_chrX_153051470_153065462	153058214	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19009.hp1 NA19009.hp1	a0004 a0004	a0004c0007 a0004c0007	a0004c0007t0029 a0004c0007t0029	a0004c0007t0029g0001 a0004c0007t0029g0001	1	326	0.0031	1	c.116 others(5): Show c.1163dupG	p.Arg others(5): Show p.Arg389fs	PNMA3	ENSG00000183837.10	transcript	ENST00000593810.3	protein_coding	2/2	1439/3682	1164/1392	388/463	INFO_REALIGN_3_PRIME	chrX	TogoVar
PNMA3_chrX_153051470_153065462	153058257	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19009.hp1 NA19009.hp1	a0004 a0004	a0004c0007 a0004c0007	a0004c0007t0029 a0004c0007t0029	a0004c0007t0029g0001 a0004c0007t0029g0001	1	326	0.0031	1	c.120 others(5): Show c.1203dupC	p.Ser others(5): Show p.Ser402fs	PNMA3	ENSG00000183837.10	transcript	ENST00000593810.3	protein_coding	2/2	1479/3682	1204/1392	402/463	INFO_REALIGN_3_PRIME	chrX	TogoVar
PNMA3_chrX_153051470_153065462	153058306	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19009.hp1 NA19009.hp1	a0004 a0004	a0004c0007 a0004c0007	a0004c0007t0029 a0004c0007t0029	a0004c0007t0029g0001 a0004c0007t0029g0001	1	326	0.0031	1	c.125 others(5): Show c.1255dupG	p.Glu others(5): Show p.Glu419fs	PNMA3	ENSG00000183837.10	transcript	ENST00000593810.3	protein_coding	2/2	1531/3682	1256/1392	419/463	INFO_REALIGN_3_PRIME	chrX	TogoVar
PNMA5_chrX_152983824_152999116	152990269	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19078.hp1 NA19078.hp1	a0003 a0003	a0003c0004 a0003c0004	a0003c0004t0020 a0003c0004t0020	a0003c0004t0020g0050 a0003c0004t0020g0050	1	286	0.0035	-1	c.132 others(5): Show c.1329delC	p.Lys others(5): Show p.Lys444fs	PNMA5	ENSG00000198883.12	transcript	ENST00000535214.6	protein_coding	4/4	1742/3188	1329/1347	443/448		chrX	TogoVar
PNMA5_chrX_152983824_152999116	152990460	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19078.hp1 NA19078.hp1	a0003 a0003	a0003c0004 a0003c0004	a0003c0004t0020 a0003c0004t0020	a0003c0004t0020g0050 a0003c0004t0020g0050	1	286	0.0035	-1	c.113 others(5): Show c.1138delC	p.Gln others(5): Show p.Gln380fs	PNMA5	ENSG00000198883.12	transcript	ENST00000535214.6	protein_coding	4/4	1551/3188	1138/1347	380/448		chrX	TogoVar
PNMA5_chrX_152983824_152999116	152990547	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0002 a0002	a0002c0010 a0002c0010	a0002c0010t0008 a0002c0010t0008	a0002c0010t0008g0017 a0002c0010t0008g0017	1	286	0.0035	-1	c.105 others(5): Show c.1051delG	p.Ala others(5): Show p.Ala351fs	PNMA5	ENSG00000198883.12	transcript	ENST00000535214.6	protein_coding	4/4	1464/3188	1051/1347	351/448		chrX	TogoVar
PNMA5_chrX_152983824_152999116	152990561	CCCTGATG others(1): Show CCCTGATGG	C C	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0002 a0002	a0002c0010 a0002c0010	a0002c0010t0008 a0002c0010t0008	a0002c0010t0008g0017 a0002c0010t0008g0017	1	286	0.0035	-8	c.103 others(17): Show c.1030_1037delCCATCAGG	p.Pro others(5): Show p.Pro344fs	PNMA5	ENSG00000198883.12	transcript	ENST00000535214.6	protein_coding	4/4	1450/3188	1030/1347	344/448		chrX	TogoVar
PNMA5_chrX_152983824_152999116	152990659	A A	AC AC	frameshift_variant frameshift_variant	HIGH	NA19078.hp1 NA19078.hp1	a0003 a0003	a0003c0004 a0003c0004	a0003c0004t0020 a0003c0004t0020	a0003c0004t0020g0050 a0003c0004t0020g0050	1	286	0.0035	1	c.939 others(4): Show c.939dupG	p.Cys others(5): Show p.Cys314fs	PNMA5	ENSG00000198883.12	transcript	ENST00000535214.6	protein_coding	4/4	1352/3188	939/1347	313/448		chrX	TogoVar
PNMA5_chrX_152983824_152999116	152990698	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA19078.hp1 NA19078.hp1	a0003 a0003	a0003c0004 a0003c0004	a0003c0004t0020 a0003c0004t0020	a0003c0004t0020g0050 a0003c0004t0020g0050	1	286	0.0035	1	c.900 others(4): Show c.900dupC	p.Ala others(5): Show p.Ala301fs	PNMA5	ENSG00000198883.12	transcript	ENST00000535214.6	protein_coding	4/4	1313/3188	900/1347	300/448		chrX	TogoVar
PNMA5_chrX_152983824_152999116	152990912	G G	GT GT	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0002 a0002	a0002c0010 a0002c0010	a0002c0010t0008 a0002c0010t0008	a0002c0010t0008g0017 a0002c0010t0008g0017	1	286	0.0035	1	c.686 others(4): Show c.686dupA	p.Asp others(5): Show p.Asp229fs	PNMA5	ENSG00000198883.12	transcript	ENST00000535214.6	protein_coding	4/4	1099/3188	686/1347	229/448		chrX	TogoVar
PNMA5_chrX_152983824_152999116	152991031	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19078.hp1 NA19078.hp1	a0003 a0003	a0003c0004 a0003c0004	a0003c0004t0020 a0003c0004t0020	a0003c0004t0020g0050 a0003c0004t0020g0050	1	286	0.0035	-1	c.567 others(4): Show c.567delG	p.Trp others(5): Show p.Trp189fs	PNMA5	ENSG00000198883.12	transcript	ENST00000535214.6	protein_coding	4/4	980/3188	567/1347	189/448		chrX	TogoVar
PNMA5_chrX_152983824_152999116	152991076	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19078.hp1 NA19078.hp1	a0003 a0003	a0003c0004 a0003c0004	a0003c0004t0020 a0003c0004t0020	a0003c0004t0020g0050 a0003c0004t0020g0050	1	286	0.0035	1	c.522 others(4): Show c.522dupC	p.Phe others(5): Show p.Phe175fs	PNMA5	ENSG00000198883.12	transcript	ENST00000535214.6	protein_coding	4/4	935/3188	522/1347	174/448		chrX	TogoVar
PNMA5_chrX_152983824_152999116	152991257	GC GC	G G	frameshift_variant frameshift_variant	HIGH	HG01168.hp1 HG01168.hp1	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0010 a0005c0005t0010	a0005c0005t0010g0036 a0005c0005t0010g0036	1	286	0.0035	-1	c.341 others(4): Show c.341delG	p.Gly others(5): Show p.Gly114fs	PNMA5	ENSG00000198883.12	transcript	ENST00000535214.6	protein_coding	4/4	754/3188	341/1347	114/448		chrX	TogoVar
PNMA5_chrX_152983824_152999116	152991338	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19078.hp1 NA19078.hp1	a0003 a0003	a0003c0004 a0003c0004	a0003c0004t0020 a0003c0004t0020	a0003c0004t0020g0050 a0003c0004t0020g0050	1	286	0.0035	-1	c.260 others(4): Show c.260delG	p.Gly others(4): Show p.Gly87fs	PNMA5	ENSG00000198883.12	transcript	ENST00000535214.6	protein_coding	4/4	673/3188	260/1347	87/448		chrX	TogoVar
PNMA5_chrX_152983824_152999116	152991517	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0002 a0002	a0002c0010 a0002c0010	a0002c0010t0008 a0002c0010t0008	a0002c0010t0008g0017 a0002c0010t0008g0017	1	286	0.0035	1	c.81d others(3): Show c.81dupC	p.Met others(4): Show p.Met28fs	PNMA5	ENSG00000198883.12	transcript	ENST00000535214.6	protein_coding	4/4	494/3188	81/1347	27/448		chrX	TogoVar
PNMA5_chrX_152983824_152999116	152991517	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19086.hp1 NA19086.hp1	a0008 a0008	a0008c0003 a0008c0003	a0008c0003t0002 a0008c0003t0002	a0008c0003t0002g0038 a0008c0003t0002g0038	1	286	0.0035	-1	c.81d others(3): Show c.81delC	p.Met others(4): Show p.Met28fs	PNMA5	ENSG00000198883.12	transcript	ENST00000535214.6	protein_coding	4/4	494/3188	81/1347	27/448		chrX	TogoVar
PNMA6A_chrX_153067454_153080019	153073064	T T	TG TG	frameshift_variant frameshift_variant	HIGH	HG02135.hp1 HG02135.hp1	a0020 a0020	a0020c0024 a0020c0024	a0020c0024t0031 a0020c0024t0031	a0020c0024t0031g0009 a0020c0024t0031g0009	1	86	0.0116	1	c.4du others(2): Show c.4dupG	p.Ala others(3): Show p.Ala2fs	PNMA6A	ENSG00000235961.6	transcript	ENST00000421798.5	protein_coding	2/2	286/2238	5/1200	2/399	INFO_REALIGN_3_PRIME	chrX	TogoVar
PNMA6A_chrX_153067454_153080019	153073100	T T	TG TG	frameshift_variant frameshift_variant	HIGH	HG03710.hp1 HG03710.hp1	a0006 a0006	a0006c0007 a0006c0007	a0006c0007t0003 a0006c0007t0003	a0006c0007t0003g0001 a0006c0007t0003g0001	1	86	0.0116	1	c.43d others(3): Show c.43dupG	p.Val others(4): Show p.Val15fs	PNMA6A	ENSG00000235961.6	transcript	ENST00000421798.5	protein_coding	2/2	325/2238	44/1200	15/399	INFO_REALIGN_3_PRIME	chrX	TogoVar
PNMA6A_chrX_153067454_153080019	153073113	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0007 a0007	a0007c0008 a0007c0008	a0007c0008t0012 a0007c0008t0012	a0007c0008t0012g0012 a0007c0008t0012g0012	1	86	0.0116	1	c.52d others(3): Show c.52dupC	p.Arg others(4): Show p.Arg18fs	PNMA6A	ENSG00000235961.6	transcript	ENST00000421798.5	protein_coding	2/2	334/2238	53/1200	18/399	INFO_REALIGN_3_PRIME	chrX	TogoVar
PNMA6A_chrX_153067454_153080019	153073117	A A	AG AG	frameshift_variant frameshift_variant	HIGH	HG02622.hp2 HG02622.hp2	a0019 a0019	a0019c0023 a0019c0023	a0019c0023t0027 a0019c0023t0027	a0019c0023t0027g0014 a0019c0023t0027g0014	1	86	0.0116	1	c.59d others(3): Show c.59dupG	p.Leu others(4): Show p.Leu21fs	PNMA6A	ENSG00000235961.6	transcript	ENST00000421798.5	protein_coding	2/2	341/2238	60/1200	20/399	INFO_REALIGN_3_PRIME	chrX	TogoVar
PNMA6A_chrX_153067454_153080019	153073139	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA19060.hp2 NA19060.hp2	a0018 a0018	a0018c0022 a0018c0022	a0018c0022t0010 a0018c0022t0010	a0018c0022t0010g0008 a0018c0022t0010g0008	1	86	0.0116	-1	c.80d others(3): Show c.80delC	p.Pro others(4): Show p.Pro27fs	PNMA6A	ENSG00000235961.6	transcript	ENST00000421798.5	protein_coding	2/2	361/2238	80/1200	27/399	INFO_REALIGN_3_PRIME	chrX	TogoVar
PNMA6A_chrX_153067454_153080019	153073154	A A	AT AT	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA19076.hp1 NA19076.hp1	a0007 a0007	a0007c0008 a0007c0008	a0007c0008t0012 a0007c0008t0012	a0007c0008t0012g0012 a0007c0008t0012g0012	1	86	0.0116	1	c.93d others(3): Show c.93dupT	p.Asp others(4): Show p.Asp32fs	PNMA6A	ENSG00000235961.6	transcript	ENST00000421798.5	protein_coding	2/2	375/2238	94/1200	32/399	INFO_REALIGN_3_PRIME	chrX	TogoVar
PNMA6A_chrX_153067454_153080019	153073166	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19060.hp2 NA19060.hp2	a0018 a0018	a0018c0022 a0018c0022	a0018c0022t0010 a0018c0022t0010	a0018c0022t0010g0008 a0018c0022t0010g0008	1	86	0.0116	1	c.106 others(4): Show c.106dupC	p.Gln others(4): Show p.Gln36fs	PNMA6A	ENSG00000235961.6	transcript	ENST00000421798.5	protein_coding	2/2	388/2238	107/1200	36/399	INFO_REALIGN_3_PRIME	chrX	TogoVar
PNMA6A_chrX_153067454_153080019	153073174	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19060.hp2 NA19060.hp2	a0018 a0018	a0018c0022 a0018c0022	a0018c0022t0010 a0018c0022t0010	a0018c0022t0010g0008 a0018c0022t0010g0008	1	86	0.0116	1	c.115 others(4): Show c.115dupC	p.Leu others(4): Show p.Leu39fs	PNMA6A	ENSG00000235961.6	transcript	ENST00000421798.5	protein_coding	2/2	397/2238	116/1200	39/399	INFO_REALIGN_3_PRIME	chrX	TogoVar
PNMA6A_chrX_153067454_153080019	153073253	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA19060.hp2 NA19060.hp2	a0018 a0018	a0018c0022 a0018c0022	a0018c0022t0010 a0018c0022t0010	a0018c0022t0010g0008 a0018c0022t0010g0008	1	86	0.0116	1	c.193 others(4): Show c.193dupG	p.Ala others(4): Show p.Ala65fs	PNMA6A	ENSG00000235961.6	transcript	ENST00000421798.5	protein_coding	2/2	475/2238	194/1200	65/399	INFO_REALIGN_3_PRIME	chrX	TogoVar
PNMA6A_chrX_153067454_153080019	153073273	CG CG	C C	frameshift_variant frameshift_variant	HIGH	HG02129.hp1 HG02129.hp1	a0017 a0017	a0017c0013 a0017c0013	a0017c0013t0011 a0017c0013t0011	a0017c0013t0011g0013 a0017c0013t0011g0013	1	86	0.0116	-1	c.214 others(4): Show c.214delG	p.Glu others(4): Show p.Glu72fs	PNMA6A	ENSG00000235961.6	transcript	ENST00000421798.5	protein_coding	2/2	495/2238	214/1200	72/399	INFO_REALIGN_3_PRIME	chrX	TogoVar
PNMA6A_chrX_153067454_153080019	153073295	T T	TC TC	frameshift_variant frameshift_variant	HIGH	HG02129.hp1 HG02129.hp1	a0017 a0017	a0017c0013 a0017c0013	a0017c0013t0011 a0017c0013t0011	a0017c0013t0011g0013 a0017c0013t0011g0013	1	86	0.0116	1	c.237 others(4): Show c.237dupC	p.Arg others(4): Show p.Arg80fs	PNMA6A	ENSG00000235961.6	transcript	ENST00000421798.5	protein_coding	2/2	519/2238	238/1200	80/399	INFO_REALIGN_3_PRIME	chrX	TogoVar
PNMA6A_chrX_153067454_153080019	153073317	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0007 a0007	a0007c0008 a0007c0008	a0007c0008t0012 a0007c0008t0012	a0007c0008t0012g0012 a0007c0008t0012g0012	1	86	0.0116	-1	c.260 others(4): Show c.260delG	p.Gly others(4): Show p.Gly87fs	PNMA6A	ENSG00000235961.6	transcript	ENST00000421798.5	protein_coding	2/2	541/2238	260/1200	87/399	INFO_REALIGN_3_PRIME	chrX	TogoVar
PNMA6A_chrX_153067454_153080019	153073374	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0007 a0007	a0007c0008 a0007c0008	a0007c0008t0012 a0007c0008t0012	a0007c0008t0012g0012 a0007c0008t0012g0012	1	86	0.0116	1	c.313 others(4): Show c.313dupC	p.Leu others(5): Show p.Leu105fs	PNMA6A	ENSG00000235961.6	transcript	ENST00000421798.5	protein_coding	2/2	595/2238	314/1200	105/399	INFO_REALIGN_3_PRIME	chrX	TogoVar
PNMA6A_chrX_153067454_153080019	153073445	TG TG	T T	frameshift_variant frameshift_variant	HIGH	HG02896.hp1 HG02896.hp1	a0010 a0010	a0010c0012 a0010c0012	a0010c0012t0018 a0010c0012t0018	a0010c0012t0018g0001 a0010c0012t0018g0001	1	86	0.0116	-1	c.387 others(4): Show c.387delG	p.Leu others(5): Show p.Leu130fs	PNMA6A	ENSG00000235961.6	transcript	ENST00000421798.5	protein_coding	2/2	668/2238	387/1200	129/399	INFO_REALIGN_3_PRIME	chrX	TogoVar
PNMA6A_chrX_153067454_153080019	153073451	T T	TG TG	frameshift_variant frameshift_variant	HIGH	HG02135.hp1 HG02135.hp1	a0020 a0020	a0020c0024 a0020c0024	a0020c0024t0031 a0020c0024t0031	a0020c0024t0031g0009 a0020c0024t0031g0009	1	86	0.0116	1	c.390 others(4): Show c.390dupG	p.Arg others(5): Show p.Arg131fs	PNMA6A	ENSG00000235961.6	transcript	ENST00000421798.5	protein_coding	2/2	672/2238	391/1200	131/399	INFO_REALIGN_3_PRIME	chrX	TogoVar

Search by Variant

Search

Search Results (Total: 5828 hits)