JoGo: Joint Open Genome and Omics Platform

Search by Variant

Regionname

e.g. ALDH2_chr12_111761933_111822532, HBB_chr11_5220464_5232071.

Chr

Chromosome name (e.g., chr11).

Snpeff genename

Exact SnpEff gene name.

Sampleids

Target sampleid (e.g. HG02615).

Snpeff haplotype class

Haplotype-annotation class (e.g., ahapid, ahapid+chapid).

Snpeff annotation impact

Exact impact level (e.g., HIGH, MODERATE, LOW).

Snpeff annotation impact detail

Keyword match in SnpEff annotation.

Hapid

One or more haplotype IDs (comma-separated; e.g., a0001, a01, a0001c0001, a01c02, a1c2, a0001c0001t0005, a0001c0001t0005g0018).

Samplehapid

Sample haplotype IDs to include (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

No_hapid

Haplotype IDs to exclude (comma-separated; e.g., a0001, a0002, a0001c0001, a0001c0001t0005, a1, a01).

No_samplehapid

Sample haplotype IDs to exclude (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

Start

Start position (GRCh38).

End

End position (GRCh38).

Minac

Minimum alternate allele count (≥).

Maxac

Maximum alternate allele count (≤).

Minlen

Minimum variant length (≥).

Maxlen

Maximum variant length (≤).

Sort By

Select column to sort.

Order by

Ascending or descending.

Show

Results per page.

regionname	pos	ref	alt	annotation	impact	samples	ahapids	achapids	acthapids	actghapids	ac	an	af	len	hgvs_c	hgvs_p	genename	geneid	featuretype	featureid	transcript_biotype	rank	cdna cdna pos length	cds cds pos length	aa aa pos length	status	chr	external
PORCN_chrX_48503992_48525808	48512348	GA GA	G G	frameshift_variant frameshift_variant	HIGH	HG01884.hp1 HG01884.hp1	a0002 a0002	a0002c0004 a0002c0004	a0002c0004t0001 a0002c0004t0001	a0002c0004t0001g0042 a0002c0004t0001g0042	1	297	0.0034	-1	c.398 others(4): Show c.398delA	p.Lys others(5): Show p.Lys133fs	PORCN	ENSG00000102312.24	transcript	ENST00000326194.11	protein_coding	5/15	547/1867	398/1386	133/461	INFO_REALIGN_3_PRIME	chrX	TogoVar
PORCN_chrX_48503992_48525808	48512376	G G	GA GA	frameshift_variant frameshift_variant	HIGH	HG01884.hp1 HG01884.hp1	a0002 a0002	a0002c0004 a0002c0004	a0002c0004t0001 a0002c0004t0001	a0002c0004t0001g0042 a0002c0004t0001g0042	1	297	0.0034	1	c.425 others(4): Show c.425dupA	p.Asp others(5): Show p.Asp142fs	PORCN	ENSG00000102312.24	transcript	ENST00000326194.11	protein_coding	5/15	575/1867	426/1386	142/461	INFO_REALIGN_3_PRIME	chrX	TogoVar
PORCN_chrX_48503992_48525808	48512491	T T	TC TC	frameshift_variant frameshift_variant	HIGH	HG01884.hp1 HG01884.hp1	a0002 a0002	a0002c0004 a0002c0004	a0002c0004t0001 a0002c0004t0001	a0002c0004t0001g0042 a0002c0004t0001g0042	1	297	0.0034	1	c.541 others(4): Show c.541dupC	p.Gln others(5): Show p.Gln181fs	PORCN	ENSG00000102312.24	transcript	ENST00000326194.11	protein_coding	5/15	691/1867	542/1386	181/461	INFO_REALIGN_3_PRIME	chrX	TogoVar
PORCN_chrX_48503992_48525808	48512495	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0004 a0004	a0004c0009 a0004c0009	a0004c0009t0009 a0004c0009t0009	a0004c0009t0009g0018 a0004c0009t0009g0018	1	297	0.0034	1	c.545 others(4): Show c.545dupG	p.Arg others(5): Show p.Arg183fs	PORCN	ENSG00000102312.24	transcript	ENST00000326194.11	protein_coding	5/15	695/1867	546/1386	182/461	INFO_REALIGN_3_PRIME	chrX	TogoVar
PORCN_chrX_48503992_48525808	48515741	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0004 a0004	a0004c0009 a0004c0009	a0004c0009t0009 a0004c0009t0009	a0004c0009t0009g0018 a0004c0009t0009g0018	1	297	0.0034	-1	c.975 others(4): Show c.975delG	p.Thr others(5): Show p.Thr326fs	PORCN	ENSG00000102312.24	transcript	ENST00000326194.11	protein_coding	11/15	1124/1867	975/1386	325/461	INFO_REALIGN_3_PRIME	chrX	TogoVar
PORCN_chrX_48503992_48525808	48517240	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19001.hp2 NA19001.hp2	a0006 a0006	a0006c0008 a0006c0008	a0006c0008t0001 a0006c0008t0001	a0006c0008t0001g0041 a0006c0008t0001g0041	1	297	0.0034	1	c.123 others(5): Show c.1233dupC	p.Tyr others(5): Show p.Tyr412fs	PORCN	ENSG00000102312.24	transcript	ENST00000326194.11	protein_coding	14/15	1383/1867	1234/1386	412/461	INFO_REALIGN_3_PRIME	chrX	TogoVar
POR_chr7_75910155_75991855	75985687	G G	GT GT	frameshift_variant frameshift_variant	HIGH	HG01993.hp2 HG02055.hp2 HG04184.hp2 others(2): Show HG01993.hp2 HG02055.hp2 HG04184.hp2 NA18954.hp1 NA19084.hp2	a0005 a0009 a0010 a0005 a0009 a0010	a0005c0011 a0009c0018 a0010c0020 a0005c0011 a0009c0018 a0010c0020	a0005c0011t0002 a0009c0018t0002 a0010c0020t0002 a0005c0011t0002 a0009c0018t0002 a0010c0020t0002	a0005c0011t0002g0140 a0005c0011t0002g0145 a0005c0011t0002g0160 others(2): Show a0005c0011t0002g0140 a0005c0011t0002g0145 a0005c0011t0002g0160 a0009c0018t0002g0163 a0010c0020t0002g0092	5	278	0.0180	1	c.149 others(10): Show c.1498_1499insT	p.Ala others(5): Show p.Ala500fs	POR	ENSG00000127948.17	transcript	ENST00000461988.6	protein_coding	13/16	1537/2446	1499/2034	500/677		chr7	TogoVar
POR_chr7_75910155_75991855	75985794	C C	CG CG	frameshift_variant frameshift_variant	HIGH	HG01361.hp1 HG02572.hp1 NA18977.hp2 others(5): Show HG01361.hp1 HG02572.hp1 NA18977.hp2 NA18979.hp2 NA18985.hp2 NA19030.hp1 NA19084.hp2 NA20300.hp2	a0003 a0004 a0009 a0003 a0004 a0009	a0003c0010 a0004c0012 a0004c0021 others(1): Show a0003c0010 a0004c0012 a0004c0021 a0009c0018	a0003c0010t0001 a0003c0010t0002 a0004c0012t0001 others(2): Show a0003c0010t0001 a0003c0010t0002 a0004c0012t0001 a0004c0021t0001 a0009c0018t0002	a0003c0010t0001g0227 a0003c0010t0002g0061 a0003c0010t0002g0205 others(5): Show a0003c0010t0001g0227 a0003c0010t0002g0061 a0003c0010t0002g0205 a0003c0010t0002g0233 a0004c0012t0001g0053 a0004c0012t0001g0211 a0004c0021t0001g0102 a0009c0018t0002g0163	8	278	0.0288	1	c.160 others(5): Show c.1609dupG	p.Val others(5): Show p.Val537fs	POR	ENSG00000127948.17	transcript	ENST00000461988.6	protein_coding	13/16	1648/2446	1610/2034	537/677	INFO_REALIGN_3_PRIME	chr7	TogoVar
POTEC_chr18_14502339_14548600	14543056	GGTGGTGA others(15): Show GGTGGTGAAACCACTTGCCCATC	G G	frameshift_variant frameshift_variant	HIGH	HG02970.hp2 HG02970.hp2	a0023 a0023	a0023c0026 a0023c0026	a0023c0026t0008 a0023c0026t0008	a0023c0026t0008g0196 a0023c0026t0008g0196	1	388	0.0026	-22	c.69_ others(27): Show c.69_90delGATGGGCAAGTGGTTTCACCAC	p.Lys others(4): Show p.Lys23fs	POTEC	ENSG00000183206.18	transcript	ENST00000358970.10	protein_coding	1/11	544/6642	69/1629	23/542		chr18	TogoVar
POTED_chr21_13604777_13650823	13628440	TAGCC TAGCC	T T	frameshift_variant others(1): Show frameshift_variant splice_region_variant	HIGH	HG02647.hp2 HG02970.hp1 HG02976.hp2 others(6): Show HG02647.hp2 HG02970.hp1 HG02976.hp2 HG03041.hp1 HG03139.hp2 HG03195.hp1 HG03486.hp2 NA19043.hp1 NA21309.hp1	a0005 a0005	a0005c0006 a0005c0006	a0005c0006t0009 a0005c0006t0041 a0005c0006t0009 a0005c0006t0041	a0005c0006t0009g0020 a0005c0006t0009g0222 a0005c0006t0009g0223 others(3): Show a0005c0006t0009g0020 a0005c0006t0009g0222 a0005c0006t0009g0223 a0005c0006t0009g0224 a0005c0006t0009g0227 a0005c0006t0041g0225	9	416	0.0216	-4	c.119 others(13): Show c.1192_1195delCCAG	p.Pro others(5): Show p.Pro398fs	POTED	ENSG00000166351.11	transcript	ENST00000299443.6	protein_coding	7/11	1644/6464	1192/1755	398/584	INFO_REALIGN_3_PRIME	chr21	TogoVar
POTED_chr21_13604777_13650823	13639505	T T	TTTCTTCT others(6): Show TTTCTTCTAGTGAC	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA19063.hp1 NA19063.hp1	a0001 a0001	a0001c0003 a0001c0003	a0001c0003t0043 a0001c0003t0043	a0001c0003t0043g0204 a0001c0003t0043g0204	1	416	0.0024	13	c.141 others(22): Show c.1412_1413insCTTCTTCTAGTGA	p.Glu others(5): Show p.Glu472fs	POTED	ENSG00000166351.11	transcript	ENST00000299443.6	protein_coding	10/11	1865/6464	1413/1755	471/584	INFO_REALIGN_3_PRIME	chr21	TogoVar
POU2AF1_chr11_111347255_111384275	111354538	AGCGGGGG others(7): Show AGCGGGGGCCCCACT	A A	frameshift_variant frameshift_variant	HIGH	HG01070.hp2 HG01070.hp2	a0003 a0003	a0003c0007 a0003c0007	a0003c0007t0009 a0003c0007t0009	a0003c0007t0009g0084 a0003c0007t0009g0084	1	384	0.0026	-14	c.480 others(21): Show c.480_493delAGTGGGGCCCCCGC	p.Val others(5): Show p.Val161fs	POU2AF1	ENSG00000110777.12	transcript	ENST00000393067.8	protein_coding	5/5	591/2875	480/771	160/256		chr11	TogoVar
POU3F2_chr6_98829574_98844458	98835104	C C	CG CG	frameshift_variant frameshift_variant	HIGH	HG00408.hp1 HG00597.hp1 HG00597.hp2 others(44): Show HG00408.hp1 HG00597.hp1 HG00597.hp2 HG00741.hp2 HG01099.hp2 HG01106.hp1 HG01192.hp1 HG01261.hp2 HG01433.hp2 HG01515.hp1 HG01993.hp1 HG02258.hp1 HG02280.hp2 HG02293.hp1 HG02572.hp1 HG02572.hp2 HG02602.hp2 HG02647.hp1 HG02738.hp1 HG02809.hp1 HG03516.hp2 HG03688.hp1 HG03688.hp2 HG03927.hp1 HG03927.hp2 HG04115.hp1 HG04184.hp1 NA18949.hp2 NA18967.hp2 NA18978.hp2 NA18979.hp2 NA18989.hp2 NA18992.hp1 NA18998.hp2 NA19000.hp1 NA19000.hp2 NA19006.hp1 NA19006.hp2 NA19010.hp2 NA19060.hp1 NA19060.hp2 NA19064.hp1 NA19068.hp2 NA19076.hp2 NA19079.hp1 NA19082.hp1 NA19089.hp2	a0002 a0002	a0002c0002 a0002c0004 a0002c0002 a0002c0004	a0002c0002t0001 a0002c0002t0002 a0002c0002t0004 others(7): Show a0002c0002t0001 a0002c0002t0002 a0002c0002t0004 a0002c0002t0005 a0002c0002t0008 a0002c0002t0010 a0002c0002t0017 a0002c0002t0025 a0002c0002t0027 a0002c0004t0003	a0002c0002t0001g0000 a0002c0002t0002g0000 a0002c0002t0004g0000 others(7): Show a0002c0002t0001g0000 a0002c0002t0002g0000 a0002c0002t0004g0000 a0002c0002t0005g0000 a0002c0002t0008g0000 a0002c0002t0010g0000 a0002c0002t0017g0000 a0002c0002t0025g0000 a0002c0002t0027g0000 a0002c0004t0003g0000	47	436	0.1078	1	c.239 others(4): Show c.239dupG	p.Gly others(4): Show p.Gly81fs	POU3F2	ENSG00000184486.10	transcript	ENST00000328345.8	protein_coding	1/1	540/4885	240/1332	80/443	INFO_REALIGN_3_PRIME	chr6	TogoVar
POU3F3_chr2_104849115_104863574	104855606	C C	CG CG	frameshift_variant frameshift_variant	HIGH	HG00597.hp1 HG00621.hp1 HG01981.hp2 others(17): Show HG00597.hp1 HG00621.hp1 HG01981.hp2 HG02055.hp2 HG02056.hp2 HG02109.hp2 HG02647.hp1 HG02647.hp2 HG03098.hp2 HG03130.hp1 HG03516.hp1 HG03669.hp2 HG03688.hp1 HG03831.hp1 HG03942.hp2 HG04204.hp1 NA18965.hp1 NA18975.hp2 NA19067.hp1 NA19083.hp2	a0000 a0000	a0000c0003 a0000c0004 a0000c0003 a0000c0004	a0000c0003t0001 a0000c0003t0003 a0000c0003t0004 others(3): Show a0000c0003t0001 a0000c0003t0003 a0000c0003t0004 a0000c0003t0008 a0000c0003t0024 a0000c0004t0002	a0000c0003t0001g0000 a0000c0003t0003g0000 a0000c0003t0004g0000 others(3): Show a0000c0003t0001g0000 a0000c0003t0003g0000 a0000c0003t0004g0000 a0000c0003t0008g0000 a0000c0003t0024g0000 a0000c0004t0002g0000	20	406	0.0493	1	c.101 others(4): Show c.101dupG	p.Gly others(4): Show p.Gly35fs	POU3F3	ENSG00000198914.5	transcript	ENST00000361360.4	protein_coding	1/1	1498/4460	102/1503	34/500	INFO_REALIGN_3_PRIME	chr2	TogoVar
POU3F4_chrX_83503290_83517127	83508570	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19089.hp1 NA19089.hp1	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0001 a0002c0002t0001	a0002c0002t0001g0000 a0002c0002t0001g0000	1	300	0.0033	-1	c.249 others(4): Show c.249delC	p.Arg others(4): Show p.Arg85fs	POU3F4	ENSG00000196767.9	transcript	ENST00000644024.2	protein_coding	1/1	284/3838	249/1086	83/361	INFO_REALIGN_3_PRIME	chrX	TogoVar
POU4F1_chr13_78593362_78608552	78602182	CCCCGGGG others(6): Show CCCCGGGGCCGCCG	C C	frameshift_variant frameshift_variant	HIGH	NA18995.hp1 NA18995.hp1	a0003 a0003	a0003c0010 a0003c0010	a0003c0010t0001 a0003c0010t0001	a0003c0010t0001g0040 a0003c0010t0001g0040	1	432	0.0023	-13	c.480 others(20): Show c.480_492delCGGCGGCCCCGGG	p.Gly others(5): Show p.Gly161fs	POU4F1	ENSG00000152192.8	transcript	ENST00000377208.7	protein_coding	2/2	718/4539	480/1260	160/419		chr13	TogoVar
PPEF1_chrX_18702645_18832917	18823943	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA18967.hp1 NA18967.hp1	a0004 a0004	a0004c0006 a0004c0006	a0004c0006t0004 a0004c0006t0004	a0004c0006t0004g0218 a0004c0006t0004g0218	1	224	0.0045	1	c.152 others(5): Show c.1525dupG	p.Ala others(5): Show p.Ala509fs	PPEF1	ENSG00000086717.19	transcript	ENST00000470157.2	protein_coding	14/16	1662/2528	1526/1962	509/653	INFO_REALIGN_3_PRIME	chrX	TogoVar
PPEF2_chr4_75854867_75907452	75860716	T T	TGTGGGCA others(9): Show TGTGGGCATTCTGAGGC	frameshift_variant frameshift_variant	HIGH	NA18960.hp1 NA18960.hp1	a0012 a0012	a0012c0021 a0012c0021	a0012c0021t0001 a0012c0021t0001	a0012c0021t0001g0057 a0012c0021t0001g0057	1	270	0.0037	16	c.219 others(25): Show c.2197_2212dupGCCTCAGAATGCCCAC	p.Gln others(5): Show p.Gln738fs	PPEF2	ENSG00000156194.19	transcript	ENST00000286719.12	protein_coding	17/17	2493/3343	2212/2262	738/753		chr4	TogoVar
PPEF2_chr4_75854867_75907452	75873297	A A	AC AC	frameshift_variant frameshift_variant	HIGH	HG02145.hp2 HG02809.hp2 HG02970.hp1 others(1): Show HG02145.hp2 HG02809.hp2 HG02970.hp1 HG02976.hp2	a0006 a0006	a0006c0007 a0006c0007	a0006c0007t0003 a0006c0007t0003	a0006c0007t0003g0204 a0006c0007t0003g0205 a0006c0007t0003g0207 others(1): Show a0006c0007t0003g0204 a0006c0007t0003g0205 a0006c0007t0003g0207 a0006c0007t0003g0209	4	270	0.0148	1	c.133 others(5): Show c.1335dupG	p.Trp others(5): Show p.Trp446fs	PPEF2	ENSG00000156194.19	transcript	ENST00000286719.12	protein_coding	12/17	1616/3343	1335/2262	445/753		chr4	TogoVar
PPID_chr4_158704127_158728396	158717095	CAT CAT	C C	frameshift_variant frameshift_variant	HIGH	HG02129.hp2 NA18971.hp1 NA18992.hp1 others(2): Show HG02129.hp2 NA18971.hp1 NA18992.hp1 NA18999.hp2 NA19010.hp2	a0004 a0004	a0004c0006 a0004c0006	a0004c0006t0001 a0004c0006t0001	a0004c0006t0001g0019 a0004c0006t0001g0095 a0004c0006t0001g0019 a0004c0006t0001g0095	5	348	0.0144	-2	c.437 others(9): Show c.437_438delAT	p.His others(5): Show p.His146fs	PPID	ENSG00000171497.5	transcript	ENST00000307720.4	protein_coding	4/10	546/1830	437/1113	146/370		chr4	TogoVar
PPP1R26_chr9_135474782_135493892	135484987	A A	AGCCCAGC others(7): Show AGCCCAGCCTTCCAG	frameshift_variant frameshift_variant	HIGH	NA19012.hp1 NA19012.hp1	a0028 a0028	a0028c0039 a0028c0039	a0028c0039t0003 a0028c0039t0003	a0028c0039t0003g0006 a0028c0039t0003g0006	1	462	0.0022	14	c.479 others(21): Show c.479_492dupCCCAGCCTTCCAGG	p.Ala others(5): Show p.Ala165fs	PPP1R26	ENSG00000196422.11	transcript	ENST00000356818.7	protein_coding	4/4	1062/4951	493/3630	165/1209	INFO_REALIGN_3_PRIME	chr9	TogoVar
PPP1R2C_chrX_42772366_42783163	42777517	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA18978.hp1 NA18978.hp1	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0002 a0005c0005t0002	a0005c0005t0002g0000 a0005c0005t0002g0000	1	333	0.0030	-1	c.562 others(4): Show c.562delG	p.Glu others(5): Show p.Glu188fs	PPP1R2C	ENSG00000102055.7	transcript	ENST00000378131.4	protein_coding	1/1	646/798	562/609	188/202		chrX	TogoVar
PPP1R2C_chrX_42772366_42783163	42777549	GT GT	G G	frameshift_variant frameshift_variant	HIGH	NA18978.hp1 NA18978.hp1	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0002 a0005c0005t0002	a0005c0005t0002g0000 a0005c0005t0002g0000	1	333	0.0030	-1	c.530 others(4): Show c.530delA	p.Asn others(5): Show p.Asn177fs	PPP1R2C	ENSG00000102055.7	transcript	ENST00000378131.4	protein_coding	1/1	614/798	530/609	177/202		chrX	TogoVar
PPP1R2C_chrX_42772366_42783163	42777565	GT GT	G G	frameshift_variant frameshift_variant	HIGH	NA18978.hp1 NA18978.hp1	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0002 a0005c0005t0002	a0005c0005t0002g0000 a0005c0005t0002g0000	1	333	0.0030	-1	c.514 others(4): Show c.514delA	p.Thr others(5): Show p.Thr172fs	PPP1R2C	ENSG00000102055.7	transcript	ENST00000378131.4	protein_coding	1/1	598/798	514/609	172/202		chrX	TogoVar
PPP1R2C_chrX_42772366_42783163	42777937	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA18978.hp1 NA18978.hp1	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0002 a0005c0005t0002	a0005c0005t0002g0000 a0005c0005t0002g0000	1	333	0.0030	-1	c.142 others(4): Show c.142delG	p.Asp others(4): Show p.Asp48fs	PPP1R2C	ENSG00000102055.7	transcript	ENST00000378131.4	protein_coding	1/1	226/798	142/609	48/202		chrX	TogoVar
PPP1R3A_chr7_113871777_113924009	113878385	T T	TCGCGCCA others(82): Show TCGCGCCACTGCACTCCAACCTGGGCGACAGCGAGACTCCGTCTCAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA	frameshift_variant frameshift_variant	HIGH	NA20752.hp1 NA20752.hp1	a0016 a0016	a0016c0013 a0016c0013	a0016c0013t0002 a0016c0013t0002	a0016c0013t0002g0129 a0016c0013t0002g0129	1	294	0.0034	89	c.270 others(98): Show c.2706_2707insTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTGAGACGGAGTCTCGCTGTCGCCCAGGTTGGAGTGCAGTGGC GCG	p.Asn others(5): Show p.Asn903fs	PPP1R3A	ENSG00000154415.8	transcript	ENST00000284601.4	protein_coding	4/4	2719/4328	2706/3369	902/1122		chr7	TogoVar
PPP1R3A_chr7_113871777_113924009	113878681	T T	TCCTTTTC others(13): Show TCCTTTTCAAAATCATTGTCA	frameshift_variant frameshift_variant	HIGH	NA18948.hp2 NA18948.hp2	a0018 a0018	a0018c0015 a0018c0015	a0018c0015t0002 a0018c0015t0002	a0018c0015t0002g0066 a0018c0015t0002g0066	1	294	0.0034	20	c.239 others(29): Show c.2391_2410dupTGACAATGATTTTGAAAAGG	p.Glu others(5): Show p.Glu804fs	PPP1R3A	ENSG00000154415.8	transcript	ENST00000284601.4	protein_coding	4/4	2423/4328	2410/3369	804/1122		chr7	TogoVar
PPP1R3F_chrX_49264793_49293090	49269903	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA18946.hp2 NA18946.hp2	a0004 a0004	a0004c0022 a0004c0022	a0004c0022t0001 a0004c0022t0001	a0004c0022t0001g0030 a0004c0022t0001g0030	1	288	0.0035	1	c.36d others(3): Show c.36dupG	p.His others(4): Show p.His13fs	PPP1R3F	ENSG00000049769.14	transcript	ENST00000055335.11	protein_coding	1/4	114/3477	37/2400	13/799	INFO_REALIGN_3_PRIME	chrX	TogoVar
PPP1R3F_chrX_49264793_49293090	49269914	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA18979.hp2 NA18979.hp2	a0005 a0005	a0005c0006 a0005c0006	a0005c0006t0001 a0005c0006t0001	a0005c0006t0001g0009 a0005c0006t0001g0009	1	288	0.0035	1	c.51d others(3): Show c.51dupC	p.Ser others(4): Show p.Ser18fs	PPP1R3F	ENSG00000049769.14	transcript	ENST00000055335.11	protein_coding	1/4	129/3477	52/2400	18/799	INFO_REALIGN_3_PRIME	chrX	TogoVar
PPP1R3F_chrX_49264793_49293090	49269987	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA18946.hp2 NA18946.hp2	a0004 a0004	a0004c0022 a0004c0022	a0004c0022t0001 a0004c0022t0001	a0004c0022t0001g0030 a0004c0022t0001g0030	1	288	0.0035	1	c.120 others(4): Show c.120dupC	p.Asp others(4): Show p.Asp41fs	PPP1R3F	ENSG00000049769.14	transcript	ENST00000055335.11	protein_coding	1/4	198/3477	121/2400	41/799	INFO_REALIGN_3_PRIME	chrX	TogoVar
PPP1R3F_chrX_49264793_49293090	49270030	A A	AC AC	frameshift_variant frameshift_variant	HIGH	NA18946.hp2 NA18946.hp2	a0004 a0004	a0004c0022 a0004c0022	a0004c0022t0001 a0004c0022t0001	a0004c0022t0001g0030 a0004c0022t0001g0030	1	288	0.0035	1	c.163 others(4): Show c.163dupC	p.Arg others(4): Show p.Arg55fs	PPP1R3F	ENSG00000049769.14	transcript	ENST00000055335.11	protein_coding	1/4	241/3477	164/2400	55/799	INFO_REALIGN_3_PRIME	chrX	TogoVar
PPP1R3F_chrX_49264793_49293090	49270046	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA18946.hp2 NA18946.hp2	a0004 a0004	a0004c0022 a0004c0022	a0004c0022t0001 a0004c0022t0001	a0004c0022t0001g0030 a0004c0022t0001g0030	1	288	0.0035	1	c.180 others(4): Show c.180dupC	p.Gly others(4): Show p.Gly61fs	PPP1R3F	ENSG00000049769.14	transcript	ENST00000055335.11	protein_coding	1/4	258/3477	181/2400	61/799	INFO_REALIGN_3_PRIME	chrX	TogoVar
PPP1R3F_chrX_49264793_49293090	49270348	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA18946.hp2 NA18946.hp2	a0004 a0004	a0004c0022 a0004c0022	a0004c0022t0001 a0004c0022t0001	a0004c0022t0001g0030 a0004c0022t0001g0030	1	288	0.0035	1	c.482 others(4): Show c.482dupC	p.Pro others(5): Show p.Pro162fs	PPP1R3F	ENSG00000049769.14	transcript	ENST00000055335.11	protein_coding	1/4	560/3477	483/2400	161/799	INFO_REALIGN_3_PRIME	chrX	TogoVar
PPP1R3F_chrX_49264793_49293090	49270440	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA18946.hp2 NA18946.hp2	a0004 a0004	a0004c0022 a0004c0022	a0004c0022t0001 a0004c0022t0001	a0004c0022t0001g0030 a0004c0022t0001g0030	1	288	0.0035	1	c.571 others(8): Show c.571_572insG	p.Phe others(5): Show p.Phe191fs	PPP1R3F	ENSG00000049769.14	transcript	ENST00000055335.11	protein_coding	1/4	649/3477	572/2400	191/799		chrX	TogoVar
PPP1R3F_chrX_49264793_49293090	49270587	A A	AC AC	frameshift_variant frameshift_variant	HIGH	NA18946.hp2 NA18946.hp2	a0004 a0004	a0004c0022 a0004c0022	a0004c0022t0001 a0004c0022t0001	a0004c0022t0001g0030 a0004c0022t0001g0030	1	288	0.0035	1	c.720 others(4): Show c.720dupC	p.Asp others(5): Show p.Asp241fs	PPP1R3F	ENSG00000049769.14	transcript	ENST00000055335.11	protein_coding	1/4	798/3477	721/2400	241/799	INFO_REALIGN_3_PRIME	chrX	TogoVar
PPP1R3F_chrX_49264793_49293090	49270643	C C	CA CA	frameshift_variant frameshift_variant	HIGH	NA18946.hp2 NA18946.hp2	a0004 a0004	a0004c0022 a0004c0022	a0004c0022t0001 a0004c0022t0001	a0004c0022t0001g0030 a0004c0022t0001g0030	1	288	0.0035	1	c.774 others(8): Show c.774_775insA	p.Leu others(5): Show p.Leu259fs	PPP1R3F	ENSG00000049769.14	transcript	ENST00000055335.11	protein_coding	1/4	852/3477	775/2400	259/799		chrX	TogoVar
PPP1R3F_chrX_49264793_49293090	49270668	A A	AC AC	frameshift_variant frameshift_variant	HIGH	NA19078.hp1 NA19078.hp1	a0006 a0006	a0006c0009 a0006c0009	a0006c0009t0005 a0006c0009t0005	a0006c0009t0005g0125 a0006c0009t0005g0125	1	288	0.0035	1	c.803 others(4): Show c.803dupC	p.Glu others(5): Show p.Glu269fs	PPP1R3F	ENSG00000049769.14	transcript	ENST00000055335.11	protein_coding	1/4	881/3477	804/2400	268/799	INFO_REALIGN_3_PRIME	chrX	TogoVar
PPP1R3F_chrX_49264793_49293090	49270721	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA18946.hp2 NA18946.hp2	a0004 a0004	a0004c0022 a0004c0022	a0004c0022t0001 a0004c0022t0001	a0004c0022t0001g0030 a0004c0022t0001g0030	1	288	0.0035	1	c.853 others(4): Show c.853dupC	p.Leu others(5): Show p.Leu285fs	PPP1R3F	ENSG00000049769.14	transcript	ENST00000055335.11	protein_coding	1/4	931/3477	854/2400	285/799	INFO_REALIGN_3_PRIME	chrX	TogoVar
PPP1R3F_chrX_49264793_49293090	49270810	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA18946.hp2 NA18946.hp2	a0004 a0004	a0004c0022 a0004c0022	a0004c0022t0001 a0004c0022t0001	a0004c0022t0001g0030 a0004c0022t0001g0030	1	288	0.0035	1	c.943 others(4): Show c.943dupC	p.Gln others(5): Show p.Gln315fs	PPP1R3F	ENSG00000049769.14	transcript	ENST00000055335.11	protein_coding	1/4	1021/3477	944/2400	315/799	INFO_REALIGN_3_PRIME	chrX	TogoVar
PPP1R3F_chrX_49264793_49293090	49286012	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0011 a0011	a0011c0015 a0011c0015	a0011c0015t0011 a0011c0015t0011	a0011c0015t0011g0051 a0011c0015t0011g0051	1	288	0.0035	1	c.132 others(5): Show c.1327dupG	p.Ala others(5): Show p.Ala443fs	PPP1R3F	ENSG00000049769.14	transcript	ENST00000055335.11	protein_coding	4/4	1405/3477	1328/2400	443/799	INFO_REALIGN_3_PRIME	chrX	TogoVar
PPP1R3F_chrX_49264793_49293090	49286030	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0011 a0011	a0011c0015 a0011c0015	a0011c0015t0011 a0011c0015t0011	a0011c0015t0011g0051 a0011c0015t0011g0051	1	288	0.0035	1	c.134 others(5): Show c.1342dupC	p.Leu others(5): Show p.Leu448fs	PPP1R3F	ENSG00000049769.14	transcript	ENST00000055335.11	protein_coding	4/4	1420/3477	1343/2400	448/799	INFO_REALIGN_3_PRIME	chrX	TogoVar
PPP1R3F_chrX_49264793_49293090	49286088	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0011 a0011	a0011c0015 a0011c0015	a0011c0015t0011 a0011c0015t0011	a0011c0015t0011g0051 a0011c0015t0011g0051	1	288	0.0035	1	c.140 others(5): Show c.1404dupG	p.Leu others(5): Show p.Leu469fs	PPP1R3F	ENSG00000049769.14	transcript	ENST00000055335.11	protein_coding	4/4	1482/3477	1405/2400	469/799	INFO_REALIGN_3_PRIME	chrX	TogoVar
PPP1R3F_chrX_49264793_49293090	49286214	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0011 a0011	a0011c0015 a0011c0015	a0011c0015t0011 a0011c0015t0011	a0011c0015t0011g0051 a0011c0015t0011g0051	1	288	0.0035	1	c.152 others(5): Show c.1529dupG	p.Gly others(5): Show p.Gly511fs	PPP1R3F	ENSG00000049769.14	transcript	ENST00000055335.11	protein_coding	4/4	1607/3477	1530/2400	510/799	INFO_REALIGN_3_PRIME	chrX	TogoVar
PPP1R3F_chrX_49264793_49293090	49286294	T T	TA TA	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0008 a0008	a0008c0011 a0008c0011	a0008c0011t0010 a0008c0011t0010	a0008c0011t0010g0056 a0008c0011t0010g0056	1	288	0.0035	1	c.160 others(10): Show c.1604_1605insA	p.Lys others(5): Show p.Lys537fs	PPP1R3F	ENSG00000049769.14	transcript	ENST00000055335.11	protein_coding	4/4	1682/3477	1605/2400	535/799		chrX	TogoVar
PPP1R3F_chrX_49264793_49293090	49286309	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0011 a0011	a0011c0015 a0011c0015	a0011c0015t0011 a0011c0015t0011	a0011c0015t0011g0051 a0011c0015t0011g0051	1	288	0.0035	1	c.162 others(5): Show c.1622dupC	p.Glu others(5): Show p.Glu542fs	PPP1R3F	ENSG00000049769.14	transcript	ENST00000055335.11	protein_coding	4/4	1700/3477	1623/2400	541/799	INFO_REALIGN_3_PRIME	chrX	TogoVar
PPP1R3F_chrX_49264793_49293090	49286423	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0011 a0011	a0011c0015 a0011c0015	a0011c0015t0011 a0011c0015t0011	a0011c0015t0011g0051 a0011c0015t0011g0051	1	288	0.0035	1	c.173 others(5): Show c.1736dupG	p.Glu others(5): Show p.Glu580fs	PPP1R3F	ENSG00000049769.14	transcript	ENST00000055335.11	protein_coding	4/4	1814/3477	1737/2400	579/799	INFO_REALIGN_3_PRIME	chrX	TogoVar
PPP1R3F_chrX_49264793_49293090	49286426	G G	GT GT	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA19075.hp1 NA19075.hp1	a0008 a0008	a0008c0011 a0008c0011	a0008c0011t0010 a0008c0011t0010	a0008c0011t0010g0056 a0008c0011t0010g0056	1	288	0.0035	1	c.173 others(5): Show c.1737dupT	p.Glu others(5): Show p.Glu580fs	PPP1R3F	ENSG00000049769.14	transcript	ENST00000055335.11	protein_coding	4/4	1815/3477	1738/2400	580/799	INFO_REALIGN_3_PRIME	chrX	TogoVar
PPP1R3F_chrX_49264793_49293090	49286571	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0011 a0011	a0011c0015 a0011c0015	a0011c0015t0011 a0011c0015t0011	a0011c0015t0011g0051 a0011c0015t0011g0051	1	288	0.0035	1	c.188 others(5): Show c.1883dupG	p.Val others(5): Show p.Val630fs	PPP1R3F	ENSG00000049769.14	transcript	ENST00000055335.11	protein_coding	4/4	1961/3477	1884/2400	628/799	INFO_REALIGN_3_PRIME	chrX	TogoVar
PPP1R3F_chrX_49264793_49293090	49286677	A A	AC AC	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0011 a0011	a0011c0015 a0011c0015	a0011c0015t0011 a0011c0015t0011	a0011c0015t0011g0051 a0011c0015t0011g0051	1	288	0.0035	1	c.198 others(5): Show c.1988dupC	p.Glu others(5): Show p.Glu664fs	PPP1R3F	ENSG00000049769.14	transcript	ENST00000055335.11	protein_coding	4/4	2066/3477	1989/2400	663/799	INFO_REALIGN_3_PRIME	chrX	TogoVar
PPP1R3F_chrX_49264793_49293090	49286753	T T	TA TA	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0011 a0011	a0011c0015 a0011c0015	a0011c0015t0011 a0011c0015t0011	a0011c0015t0011g0051 a0011c0015t0011g0051	1	288	0.0035	1	c.206 others(5): Show c.2064dupA	p.Ser others(5): Show p.Ser689fs	PPP1R3F	ENSG00000049769.14	transcript	ENST00000055335.11	protein_coding	4/4	2142/3477	2065/2400	689/799	INFO_REALIGN_3_PRIME	chrX	TogoVar

Search by Variant

Search

Search Results (Total: 5828 hits)