Joint Open Genome and Omics Platform (JoGo)

Search by Variant

Regionname

e.g. ALDH2_chr12_111761933_111822532, HBB_chr11_5220464_5232071.

Chr

Chromosome name (e.g., chr11).

Snpeff genename

Exact SnpEff gene name.

Sampleids

Target sampleid (e.g. HG02615).

Snpeff haplotype class

Haplotype-annotation class (e.g., ahapid, ahapid+chapid).

Snpeff annotation impact

Exact impact level (e.g., HIGH, MODERATE, LOW).

Snpeff annotation impact detail

Keyword match in SnpEff annotation.

Hapid

One or more haplotype IDs (comma-separated; e.g., a0001, a01, a0001c0001, a01c02, a1c2, a0001c0001t0005, a0001c0001t0005g0018).

Samplehapid

Sample haplotype IDs to include (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

No_hapid

Haplotype IDs to exclude (comma-separated; e.g., a0001, a0002, a0001c0001, a0001c0001t0005, a1, a01).

No_samplehapid

Sample haplotype IDs to exclude (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

Start

Start position (GRCh38).

End

End position (GRCh38).

Minac

Minimum alternate allele count (≥).

Maxac

Maximum alternate allele count (≤).

Minlen

Minimum variant length (≥).

Maxlen

Maximum variant length (≤).

Sort By

Select column to sort.

Order by

Ascending or descending.

Show

Results per page.

regionname	pos	ref	alt	annotation	impact	samples	ahapids	achapids	acthapids	actghapids	ac	an	af	len	hgvs_c	hgvs_p	genename	geneid	featuretype	featureid	transcript_biotype	rank	cdna cdna pos length	cds cds pos length	aa aa pos length	status	chr	external
BCAP31_chrX_153695492_153729387	153720936	CA CA	C C	frameshift_variant frameshift_variant	HIGH	NA19068.hp1 NA19068.hp1	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0001 a0002c0002t0001	a0002c0002t0001g0135 a0002c0002t0001g0135	1	267	0.0038	-1	c.128 others(4): Show c.128delT	p.Leu others(4): Show p.Leu43fs	BCAP31	ENSG00000185825.17	transcript	ENST00000345046.12	protein_coding	3/8	226/1284	128/741	43/246		chrX	TogoVar
BCAP31_chrX_153695492_153729387	153720941	CCA CCA	C C	frameshift_variant frameshift_variant	HIGH	NA19068.hp1 NA19068.hp1	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0001 a0002c0002t0001	a0002c0002t0001g0135 a0002c0002t0001g0135	1	267	0.0038	-2	c.122 others(9): Show c.122_123delTG	p.Val others(4): Show p.Val41fs	BCAP31	ENSG00000185825.17	transcript	ENST00000345046.12	protein_coding	3/8	221/1284	122/741	41/246		chrX	TogoVar
BCAP31_chrX_153695492_153729387	153720947	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19068.hp1 NA19068.hp1	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0001 a0002c0002t0001	a0002c0002t0001g0135 a0002c0002t0001g0135	1	267	0.0038	-1	c.117 others(4): Show c.117delG	p.Leu others(4): Show p.Leu40fs	BCAP31	ENSG00000185825.17	transcript	ENST00000345046.12	protein_coding	3/8	215/1284	117/741	39/246		chrX	TogoVar
BCL3_chr19_44743708_44765044	44757112	C C	CACGGCCA others(4): Show CACGGCCAGAGG	frameshift_variant frameshift_variant	HIGH	NA18948.hp1 NA18948.hp1	a0005 a0005	a0005c0006 a0005c0006	a0005c0006t0006 a0005c0006t0006	a0005c0006t0006g0138 a0005c0006t0006g0138	1	344	0.0029	11	c.615 others(18): Show c.615_616insACGGCCAGAGG	p.Gln others(5): Show p.Gln206fs	BCL3	ENSG00000069399.15	transcript	ENST00000164227.10	protein_coding	4/9	699/1877	616/1365	206/454		chr19	TogoVar
BCORL1_chrX_129977635_130063071	130025038	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA18985.hp1 NA18985.hp1	a0007 a0007	a0007c0012 a0007c0012	a0007c0012t0011 a0007c0012t0011	a0007c0012t0011g0043 a0007c0012t0011g0043	1	203	0.0049	-1	c.373 others(5): Show c.3739delC	p.Gln others(6): Show p.Gln1247fs	BCORL1	ENSG00000085185.16	transcript	ENST00000540052.6	protein_coding	7/14	3911/7465	3739/5358	1247/1785	INFO_REALIGN_3_PRIME	chrX	TogoVar
BCOR_chrX_40046251_40102958	40055510	AG AG	A A	frameshift_variant others(1): Show frameshift_variant splice_region_variant	HIGH	NA18956.hp1 NA18956.hp1	a0010 a0010	a0010c0013 a0010c0013	a0010c0013t0001 a0010c0013t0001	a0010c0013t0001g0103 a0010c0013t0001g0103	1	257	0.0039	-1	c.459 others(5): Show c.4598delC	p.Pro others(6): Show p.Pro1533fs	BCOR	ENSG00000183337.18	transcript	ENST00000378444.9	protein_coding	12/15	5382/6910	4598/5268	1533/1755		chrX	TogoVar
BCOR_chrX_40046251_40102958	40057167	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA18956.hp1 NA18956.hp1	a0010 a0010	a0010c0013 a0010c0013	a0010c0013t0001 a0010c0013t0001	a0010c0013t0001g0103 a0010c0013t0001g0103	1	257	0.0039	-1	c.458 others(5): Show c.4582delC	p.Gln others(6): Show p.Gln1528fs	BCOR	ENSG00000183337.18	transcript	ENST00000378444.9	protein_coding	11/15	5366/6910	4582/5268	1528/1755		chrX	TogoVar
BCOR_chrX_40046251_40102958	40057175	A A	AC AC	frameshift_variant frameshift_variant	HIGH	NA18946.hp2 NA18946.hp2	a0011 a0011	a0011c0010 a0011c0010	a0011c0010t0001 a0011c0010t0001	a0011c0010t0001g0210 a0011c0010t0001g0210	1	257	0.0039	1	c.457 others(5): Show c.4574dupG	p.Cys others(6): Show p.Cys1525fs	BCOR	ENSG00000183337.18	transcript	ENST00000378444.9	protein_coding	11/15	5358/6910	4574/5268	1525/1755		chrX	TogoVar
BCOR_chrX_40046251_40102958	40057300	C C	CT CT	frameshift_variant frameshift_variant	HIGH	NA18946.hp2 NA18946.hp2	a0011 a0011	a0011c0010 a0011c0010	a0011c0010t0001 a0011c0010t0001	a0011c0010t0001g0210 a0011c0010t0001g0210	1	257	0.0039	1	c.444 others(5): Show c.4449dupA	p.Glu others(6): Show p.Glu1484fs	BCOR	ENSG00000183337.18	transcript	ENST00000378444.9	protein_coding	11/15	5233/6910	4449/5268	1483/1755		chrX	TogoVar
BCOR_chrX_40046251_40102958	40062278	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA18989.hp1 NA18989.hp1	a0004 a0004	a0004c0008 a0004c0008	a0004c0008t0001 a0004c0008t0001	a0004c0008t0001g0097 a0004c0008t0001g0097	1	257	0.0039	1	c.428 others(5): Show c.4288dupC	p.Gln others(6): Show p.Gln1430fs	BCOR	ENSG00000183337.18	transcript	ENST00000378444.9	protein_coding	10/15	5072/6910	4288/5268	1430/1755		chrX	TogoVar
BCOR_chrX_40046251_40102958	40062316	C C	CT CT	frameshift_variant frameshift_variant	HIGH	NA18946.hp2 NA18946.hp2	a0011 a0011	a0011c0010 a0011c0010	a0011c0010t0001 a0011c0010t0001	a0011c0010t0001g0210 a0011c0010t0001g0210	1	257	0.0039	1	c.425 others(5): Show c.4250dupA	p.Pro others(6): Show p.Pro1418fs	BCOR	ENSG00000183337.18	transcript	ENST00000378444.9	protein_coding	10/15	5034/6910	4250/5268	1417/1755		chrX	TogoVar
BCOR_chrX_40046251_40102958	40062821	T T	TGTATG TGTATG	frameshift_variant frameshift_variant	HIGH	NA18989.hp1 NA18989.hp1	a0004 a0004	a0004c0008 a0004c0008	a0004c0008t0001 a0004c0008t0001	a0004c0008t0001g0097 a0004c0008t0001g0097	1	257	0.0039	5	c.409 others(14): Show c.4097_4098insCATAC	p.Lys others(6): Show p.Lys1366fs	BCOR	ENSG00000183337.18	transcript	ENST00000378444.9	protein_coding	9/15	4881/6910	4097/5268	1366/1755		chrX	TogoVar
BCOR_chrX_40046251_40102958	40062841	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA18946.hp2 NA18946.hp2	a0011 a0011	a0011c0010 a0011c0010	a0011c0010t0001 a0011c0010t0001	a0011c0010t0001g0210 a0011c0010t0001g0210	1	257	0.0039	-1	c.407 others(5): Show c.4077delG	p.Lys others(6): Show p.Lys1360fs	BCOR	ENSG00000183337.18	transcript	ENST00000378444.9	protein_coding	9/15	4861/6910	4077/5268	1359/1755		chrX	TogoVar
BCOR_chrX_40046251_40102958	40062867	G G	GT GT	frameshift_variant frameshift_variant	HIGH	NA18989.hp1 NA18989.hp1	a0004 a0004	a0004c0008 a0004c0008	a0004c0008t0001 a0004c0008t0001	a0004c0008t0001g0097 a0004c0008t0001g0097	1	257	0.0039	1	c.405 others(5): Show c.4051dupA	p.Thr others(6): Show p.Thr1351fs	BCOR	ENSG00000183337.18	transcript	ENST00000378444.9	protein_coding	9/15	4835/6910	4051/5268	1351/1755		chrX	TogoVar
BCOR_chrX_40046251_40102958	40062882	AG AG	A A	frameshift_variant frameshift_variant	HIGH	NA18956.hp2 NA18956.hp2	a0008 a0008	a0008c0015 a0008c0015	a0008c0015t0001 a0008c0015t0001	a0008c0015t0001g0161 a0008c0015t0001g0161	1	257	0.0039	-1	c.403 others(5): Show c.4036delC	p.Leu others(6): Show p.Leu1346fs	BCOR	ENSG00000183337.18	transcript	ENST00000378444.9	protein_coding	9/15	4820/6910	4036/5268	1346/1755		chrX	TogoVar
BCOR_chrX_40046251_40102958	40062943	CT CT	C C	frameshift_variant frameshift_variant	HIGH	NA18946.hp2 NA18946.hp2	a0011 a0011	a0011c0010 a0011c0010	a0011c0010t0001 a0011c0010t0001	a0011c0010t0001g0210 a0011c0010t0001g0210	1	257	0.0039	-1	c.397 others(5): Show c.3975delA	p.Glu others(6): Show p.Glu1326fs	BCOR	ENSG00000183337.18	transcript	ENST00000378444.9	protein_coding	9/15	4759/6910	3975/5268	1325/1755		chrX	TogoVar
BCOR_chrX_40046251_40102958	40063054	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA18989.hp1 NA18989.hp1	a0004 a0004	a0004c0008 a0004c0008	a0004c0008t0001 a0004c0008t0001	a0004c0008t0001g0097 a0004c0008t0001g0097	1	257	0.0039	1	c.386 others(5): Show c.3864dupC	p.Gly others(6): Show p.Gly1289fs	BCOR	ENSG00000183337.18	transcript	ENST00000378444.9	protein_coding	9/15	4648/6910	3864/5268	1288/1755		chrX	TogoVar
BCOR_chrX_40046251_40102958	40063670	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA18989.hp1 NA18989.hp1	a0004 a0004	a0004c0008 a0004c0008	a0004c0008t0001 a0004c0008t0001	a0004c0008t0001g0097 a0004c0008t0001g0097	1	257	0.0039	-1	c.378 others(5): Show c.3784delG	p.Ala others(6): Show p.Ala1262fs	BCOR	ENSG00000183337.18	transcript	ENST00000378444.9	protein_coding	8/15	4568/6910	3784/5268	1262/1755		chrX	TogoVar
BCOR_chrX_40046251_40102958	40073153	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA18989.hp1 NA18989.hp1	a0004 a0004	a0004c0008 a0004c0008	a0004c0008t0001 a0004c0008t0001	a0004c0008t0001g0097 a0004c0008t0001g0097	1	257	0.0039	1	c.219 others(5): Show c.2192dupC	p.His others(5): Show p.His732fs	BCOR	ENSG00000183337.18	transcript	ENST00000378444.9	protein_coding	4/15	2976/6910	2192/5268	731/1755		chrX	TogoVar
BCOR_chrX_40046251_40102958	40073705	C C	CA CA	frameshift_variant frameshift_variant	HIGH	NA18989.hp1 NA18989.hp1	a0004 a0004	a0004c0008 a0004c0008	a0004c0008t0001 a0004c0008t0001	a0004c0008t0001g0097 a0004c0008t0001g0097	1	257	0.0039	1	c.164 others(5): Show c.1640dupT	p.Met others(5): Show p.Met547fs	BCOR	ENSG00000183337.18	transcript	ENST00000378444.9	protein_coding	4/15	2424/6910	1640/5268	547/1755		chrX	TogoVar
BCOR_chrX_40046251_40102958	40073711	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA18989.hp1 NA18989.hp1	a0004 a0004	a0004c0008 a0004c0008	a0004c0008t0001 a0004c0008t0001	a0004c0008t0001g0097 a0004c0008t0001g0097	1	257	0.0039	1	c.163 others(5): Show c.1634dupC	p.Arg others(5): Show p.Arg546fs	BCOR	ENSG00000183337.18	transcript	ENST00000378444.9	protein_coding	4/15	2418/6910	1634/5268	545/1755		chrX	TogoVar
BCOR_chrX_40046251_40102958	40074579	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA18949.hp1 NA18949.hp2 NA18949.hp1 NA18949.hp2	a0003 a0003	a0003c0019 a0003c0020 a0003c0019 a0003c0020	a0003c0019t0001 a0003c0020t0001 a0003c0019t0001 a0003c0020t0001	a0003c0019t0001g0159 a0003c0020t0001g0115 a0003c0019t0001g0159 a0003c0020t0001g0115	2	257	0.0078	1	c.766 others(4): Show c.766dupC	p.His others(5): Show p.His256fs	BCOR	ENSG00000183337.18	transcript	ENST00000378444.9	protein_coding	4/15	1550/6910	766/5268	256/1755		chrX	TogoVar
BDP1_chr5_71450651_71572820	71516170	GGACAGAG others(10): Show GGACAGAGGCAAATAGTA	G G	frameshift_variant frameshift_variant	HIGH	NA19091.hp1 NA19091.hp1	a0032 a0032	a0032c0025 a0032c0025	a0032c0025t0002 a0032c0025t0002	a0032c0025t0002g0066 a0032c0025t0002g0066	1	325	0.0031	-17	c.476 others(26): Show c.4764_4780delGAGGCAAATAGTAGACA	p.Gln others(6): Show p.Gln1590fs	BDP1	ENSG00000145734.20	transcript	ENST00000358731.9	protein_coding	21/39	4991/11037	4764/7875	1588/2624	INFO_REALIGN_3_PRIME	chr5	TogoVar
BDP1_chr5_71450651_71572820	71516218	G G	GCAAGGAT others(3): Show GCAAGGATAAT	frameshift_variant frameshift_variant	HIGH	NA19091.hp1 NA19091.hp1	a0032 a0032	a0032c0025 a0032c0025	a0032c0025t0002 a0032c0025t0002	a0032c0025t0002g0066 a0032c0025t0002g0066	1	325	0.0031	10	c.480 others(19): Show c.4807_4808insCAAGGATAAT	p.Glu others(6): Show p.Glu1603fs	BDP1	ENSG00000145734.20	transcript	ENST00000358731.9	protein_coding	21/39	5035/11037	4808/7875	1603/2624		chr5	TogoVar
BEND2_chrX_18157931_18225886	18165127	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA18978.hp2 NA18978.hp2	a0008 a0008	a0008c0008 a0008c0008	a0008c0008t0009 a0008c0008t0009	a0008c0008t0009g0287 a0008c0008t0009g0287	1	295	0.0034	1	c.228 others(5): Show c.2281dupC	p.Leu others(5): Show p.Leu761fs	BEND2	ENSG00000177324.14	transcript	ENST00000380033.9	protein_coding	14/14	2417/4614	2281/2400	761/799		chrX	TogoVar
BEX1_chrX_103057651_103069171	103063121	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19077.hp2 NA19077.hp2	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0001 a0002c0002t0001	a0002c0002t0001g0038 a0002c0002t0001g0038	1	339	0.0030	-1	c.153 others(4): Show c.153delG	p.Arg others(4): Show p.Arg51fs	BEX1	ENSG00000133169.6	transcript	ENST00000372728.4	protein_coding	3/3	324/795	153/378	51/125		chrX	TogoVar
BEX2_chrX_103304346_103315990	103309705	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19054.hp1 NA19054.hp1	a0005 a0005	a0005c0006 a0005c0006	a0005c0006t0006 a0005c0006t0006	a0005c0006t0006g0010 a0005c0006t0006g0010	1	308	0.0033	1	c.271 others(4): Show c.271dupG	p.Glu others(4): Show p.Glu91fs	BEX2	ENSG00000133134.12	transcript	ENST00000372677.8	protein_coding	3/3	483/843	271/387	91/128		chrX	TogoVar
BEX2_chrX_103304346_103315990	103309760	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19054.hp1 NA19054.hp1	a0005 a0005	a0005c0006 a0005c0006	a0005c0006t0006 a0005c0006t0006	a0005c0006t0006g0010 a0005c0006t0006g0010	1	308	0.0033	-1	c.216 others(4): Show c.216delG	p.Arg others(4): Show p.Arg72fs	BEX2	ENSG00000133134.12	transcript	ENST00000372677.8	protein_coding	3/3	428/843	216/387	72/128		chrX	TogoVar
BEX2_chrX_103304346_103315990	103309809	GA GA	G G	frameshift_variant frameshift_variant	HIGH	NA19054.hp1 NA19054.hp1	a0005 a0005	a0005c0006 a0005c0006	a0005c0006t0006 a0005c0006t0006	a0005c0006t0006g0010 a0005c0006t0006g0010	1	308	0.0033	-1	c.167 others(4): Show c.167delT	p.Phe others(4): Show p.Phe56fs	BEX2	ENSG00000133134.12	transcript	ENST00000372677.8	protein_coding	3/3	379/843	167/387	56/128		chrX	TogoVar
BEX3_chrX_103371538_103383164	103377621	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0004 a0002c0002t0004	a0002c0002t0004g0009 a0002c0002t0004g0009	1	298	0.0034	-1	c.104 others(4): Show c.104delC	p.Pro others(4): Show p.Pro35fs	BEX3	ENSG00000166681.14	transcript	ENST00000361298.9	protein_coding	3/3	271/810	104/306	35/101	INFO_REALIGN_3_PRIME	chrX	TogoVar
BEX3_chrX_103371538_103383164	103377749	GA GA	G G	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0004 a0002c0002t0004	a0002c0002t0004g0009 a0002c0002t0004g0009	1	298	0.0034	-1	c.229 others(4): Show c.229delA	p.Arg others(4): Show p.Arg77fs	BEX3	ENSG00000166681.14	transcript	ENST00000361298.9	protein_coding	3/3	396/810	229/306	77/101		chrX	TogoVar
BGN_chrX_153489980_153514546	153504637	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0007 a0007	a0007c0008 a0007c0008	a0007c0008t0034 a0007c0008t0034	a0007c0008t0034g0176 a0007c0008t0034g0176	1	321	0.0031	1	c.10d others(3): Show c.10dupC	p.Leu others(3): Show p.Leu4fs	BGN	ENSG00000182492.16	transcript	ENST00000331595.9	protein_coding	2/8	156/2353	11/1107	4/368	INFO_REALIGN_3_PRIME	chrX	TogoVar
BGN_chrX_153489980_153514546	153504749	GA GA	G G	frameshift_variant frameshift_variant	HIGH	NA19055.hp1 NA19055.hp1	a0006 a0006	a0006c0013 a0006c0013	a0006c0013t0009 a0006c0013t0009	a0006c0013t0009g0086 a0006c0013t0009g0086	1	321	0.0031	-1	c.120 others(4): Show c.120delA	p.Ala others(4): Show p.Ala41fs	BGN	ENSG00000182492.16	transcript	ENST00000331595.9	protein_coding	2/8	265/2353	120/1107	40/368	INFO_REALIGN_3_PRIME	chrX	TogoVar
BGN_chrX_153489980_153514546	153505264	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA18972.hp2 NA18972.hp2	a0003 a0003	a0003c0010 a0003c0010	a0003c0010t0041 a0003c0010t0041	a0003c0010t0041g0172 a0003c0010t0041g0172	1	321	0.0031	-1	c.269 others(4): Show c.269delC	p.Pro others(4): Show p.Pro90fs	BGN	ENSG00000182492.16	transcript	ENST00000331595.9	protein_coding	3/8	414/2353	269/1107	90/368	INFO_REALIGN_3_PRIME	chrX	TogoVar
BGN_chrX_153489980_153514546	153505934	GA GA	G G	frameshift_variant frameshift_variant	HIGH	NA18972.hp2 NA18972.hp2	a0003 a0003	a0003c0010 a0003c0010	a0003c0010t0041 a0003c0010t0041	a0003c0010t0041g0172 a0003c0010t0041g0172	1	321	0.0031	-1	c.425 others(4): Show c.425delA	p.Lys others(5): Show p.Lys142fs	BGN	ENSG00000182492.16	transcript	ENST00000331595.9	protein_coding	4/8	570/2353	425/1107	142/368	INFO_REALIGN_3_PRIME	chrX	TogoVar
BGN_chrX_153489980_153514546	153507166	C C	CAG CAG	frameshift_variant frameshift_variant	HIGH	HG02897.hp2 HG02897.hp2	a0004 a0004	a0004c0011 a0004c0011	a0004c0011t0039 a0004c0011t0039	a0004c0011t0039g0049 a0004c0011t0039g0049	1	321	0.0031	2	c.892 others(9): Show c.892_893dupGA	p.Asp others(5): Show p.Asp298fs	BGN	ENSG00000182492.16	transcript	ENST00000331595.9	protein_coding	7/8	1039/2353	894/1107	298/368	INFO_REALIGN_3_PRIME	chrX	TogoVar
BGN_chrX_153489980_153514546	153508300	G G	GT GT	frameshift_variant frameshift_variant	HIGH	NA18972.hp2 NA18972.hp2	a0003 a0003	a0003c0010 a0003c0010	a0003c0010t0041 a0003c0010t0041	a0003c0010t0041g0172 a0003c0010t0041g0172	1	321	0.0031	1	c.963 others(4): Show c.963dupT	p.Pro others(5): Show p.Pro322fs	BGN	ENSG00000182492.16	transcript	ENST00000331595.9	protein_coding	8/8	1109/2353	964/1107	322/368	INFO_REALIGN_3_PRIME	chrX	TogoVar
BGN_chrX_153489980_153514546	153508382	GC GC	G G	frameshift_variant frameshift_variant	HIGH	HG02897.hp2 HG02897.hp2	a0004 a0004	a0004c0011 a0004c0011	a0004c0011t0039 a0004c0011t0039	a0004c0011t0039g0049 a0004c0011t0039g0049	1	321	0.0031	-1	c.104 others(5): Show c.1046delC	p.Pro others(5): Show p.Pro349fs	BGN	ENSG00000182492.16	transcript	ENST00000331595.9	protein_coding	8/8	1191/2353	1046/1107	349/368	INFO_REALIGN_3_PRIME	chrX	TogoVar
BHLHE41_chr12_26115030_26130037	26122665	A A	AAACAAAA others(4): Show AAACAAAAAAAC	frameshift_variant frameshift_variant	HIGH	NA19065.hp1 NA19065.hp1	a0009 a0009	a0009c0012 a0009c0012	a0009c0012t0001 a0009c0012t0001	a0009c0012t0001g0039 a0009c0012t0001g0039	1	422	0.0024	11	c.849 others(18): Show c.849_850insGTTTTTTTGTT	p.Ser others(5): Show p.Ser284fs	BHLHE41	ENSG00000123095.6	transcript	ENST00000242728.5	protein_coding	5/5	1107/3743	849/1449	283/482		chr12	TogoVar
BIN2_chr12_51276038_51329174	51313889	C C	CAATTTCT others(3): Show CAATTTCTGCA	frameshift_variant frameshift_variant	HIGH	HG04204.hp2 HG04204.hp2	a0007 a0007	a0007c0020 a0007c0020	a0007c0020t0001 a0007c0020t0001	a0007c0020t0001g0375 a0007c0020t0001g0375	1	400	0.0025	10	c.86_ others(15): Show c.86_95dupTGCAGAAATT	p.Leu others(4): Show p.Leu32fs	BIN2	ENSG00000110934.13	transcript	ENST00000615107.6	protein_coding	2/13	167/2231	95/1698	32/565		chr12	TogoVar
BIRC3_chr11_102312484_102344403	102336137	T T	TTTTAGTA others(6): Show TTTTAGTAAAAGGA	frameshift_variant frameshift_variant	HIGH	NA18969.hp1 NA18969.hp1	a0005 a0005	a0005c0010 a0005c0010	a0005c0010t0032 a0005c0010t0032	a0005c0010t0032g0102 a0005c0010t0032g0102	1	384	0.0026	13	c.149 others(22): Show c.1497_1509dupTTTAGTAAAAGGA	p.Asn others(5): Show p.Asn504fs	BIRC3	ENSG00000023445.17	transcript	ENST00000263464.9	protein_coding	7/9	4271/6877	1510/1815	504/604	INFO_REALIGN_3_PRIME	chr11	TogoVar
BIRC7_chr20_63230905_63245495	63236173	C C	CGCAGGAG others(39): Show CGCAGGAGCGCTGTGGACCCCGCTCTCTGGGCAGCCTGCTGTCCTAG	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA18992.hp1 NA18992.hp1	a0008 a0008	a0008c0019 a0008c0019	a0008c0019t0001 a0008c0019t0001	a0008c0019t0001g0026 a0008c0019t0001g0026	1	300	0.0033	46	c.112 others(53): Show c.112_113insTGCTGTCCTAGGCAGGAGCGCTGTGGACCCCGCTCTCT GGGCAGCC	p.Pro others(4): Show p.Pro38fs	BIRC7	ENSG00000101197.13	transcript	ENST00000217169.8	protein_coding	1/7	305/1334	113/897	38/298	INFO_REALIGN_3_PRIME	chr20	TogoVar
BIRC7_chr20_63230905_63245495	63237961	C C	CG CG	frameshift_variant frameshift_variant	HIGH	HG00735.hp1 HG00741.hp2 HG01106.hp2 others(9): Show HG00735.hp1 HG00741.hp2 HG01106.hp2 HG01928.hp2 HG02135.hp1 HG02145.hp2 HG02970.hp2 NA18992.hp2 NA19003.hp1 NA19005.hp1 NA19009.hp2 NA19091.hp1	a0003 a0003	a0003c0008 a0003c0010 a0003c0011 others(1): Show a0003c0008 a0003c0010 a0003c0011 a0003c0021	a0003c0008t0001 a0003c0010t0001 a0003c0011t0001 others(1): Show a0003c0008t0001 a0003c0010t0001 a0003c0011t0001 a0003c0021t0001	a0003c0008t0001g0003 a0003c0008t0001g0018 a0003c0010t0001g0001 others(4): Show a0003c0008t0001g0003 a0003c0008t0001g0018 a0003c0010t0001g0001 a0003c0010t0001g0015 a0003c0011t0001g0002 a0003c0011t0001g0028 a0003c0021t0001g0005	12	300	0.0400	1	c.412 others(4): Show c.412dupG	p.Asp others(5): Show p.Asp138fs	BIRC7	ENSG00000101197.13	transcript	ENST00000217169.8	protein_coding	2/7	605/1334	413/897	138/298	INFO_REALIGN_3_PRIME	chr20	TogoVar
BLACAT1_chr1_205429886_205461045	205440933	CCGTCTCC others(4): Show CCGTCTCCCGCT	C C	frameshift_variant frameshift_variant	HIGH	NA19010.hp2 NA19010.hp2	a0000 a0000	a0000c0005 a0000c0005	a0000c0005t0004 a0000c0005t0004	a0000c0005t0004g0135 a0000c0005t0004g0135	1	394	0.0025	-11	c.83_ others(16): Show c.83_93delAGCGGGAGACG	p.Glu others(4): Show p.Glu28fs	BLACAT1	ENSG00000281406.2	transcript	ENST00000629624.3	protein_coding	2/2	258/6306	83/102	28/33		chr1	TogoVar
BLTP1_chr4_122147331_122367752	122250531	CCCTTCCT others(4): Show CCCTTCCTCAGA	C C	frameshift_variant frameshift_variant	HIGH	NA18974.hp2 NA18974.hp2	a0015 a0015	a0015c0028 a0015c0028	a0015c0028t0001 a0015c0028t0001	a0015c0028t0001g0058 a0015c0028t0001g0058	1	336	0.0030	-11	c.588 others(20): Show c.5882_5892delCTTCCTCAGAC	p.Pro others(6): Show p.Pro1961fs	BLTP1	ENSG00000138688.17	transcript	ENST00000679879.1	protein_coding	37/88	6257/16162	5882/15282	1961/5093	INFO_REALIGN_3_PRIME	chr4	TogoVar
BMP15_chrX_50905735_50921641	50916280	CG CG	C C	frameshift_variant frameshift_variant	HIGH	NA19059.hp2 NA19059.hp2	a0008 a0008	a0008c0009 a0008c0009	a0008c0009t0001 a0008c0009t0001	a0008c0009t0001g0023 a0008c0009t0001g0023	1	294	0.0034	-1	c.855 others(4): Show c.855delG	p.Pro others(5): Show p.Pro286fs	BMP15	ENSG00000130385.6	transcript	ENST00000252677.4	protein_coding	2/2	904/1262	855/1179	285/392	INFO_REALIGN_3_PRIME	chrX	TogoVar
BMP15_chrX_50905735_50921641	50916361	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19059.hp2 NA19059.hp2	a0008 a0008	a0008c0009 a0008c0009	a0008c0009t0001 a0008c0009t0001	a0008c0009t0001g0023 a0008c0009t0001g0023	1	294	0.0034	1	c.938 others(4): Show c.938dupC	p.Tyr others(5): Show p.Tyr315fs	BMP15	ENSG00000130385.6	transcript	ENST00000252677.4	protein_coding	2/2	988/1262	939/1179	313/392	INFO_REALIGN_3_PRIME	chrX	TogoVar
BMP15_chrX_50905735_50921641	50916428	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA19059.hp1 NA19059.hp1	a0009 a0009	a0009c0010 a0009c0010	a0009c0010t0001 a0009c0010t0001	a0009c0010t0001g0040 a0009c0010t0001g0040	1	294	0.0034	-1	c.100 others(5): Show c.1005delC	p.Asn others(5): Show p.Asn336fs	BMP15	ENSG00000130385.6	transcript	ENST00000252677.4	protein_coding	2/2	1054/1262	1005/1179	335/392	INFO_REALIGN_3_PRIME	chrX	TogoVar
BMP15_chrX_50905735_50921641	50916508	TA TA	T T	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0010 a0010	a0010c0011 a0010c0011	a0010c0011t0001 a0010c0011t0001	a0010c0011t0001g0005 a0010c0011t0001g0005	1	294	0.0034	-1	c.108 others(5): Show c.1082delA	p.Lys others(5): Show p.Lys361fs	BMP15	ENSG00000130385.6	transcript	ENST00000252677.4	protein_coding	2/2	1131/1262	1082/1179	361/392	INFO_REALIGN_3_PRIME	chrX	TogoVar
BMP2K_chr4_78771350_78921365	78911258	GCAAGAAG others(9): Show GCAAGAAGGTGAATGTA	G G	frameshift_variant frameshift_variant	HIGH	HG02040.hp2 HG02040.hp2	a0012 a0012	a0012c0025 a0012c0025	a0012c0025t0019 a0012c0025t0019	a0012c0025t0019g0203 a0012c0025t0019g0203	1	204	0.0049	-16	c.271 others(25): Show c.2718_2733delGGTGAATGTACAAGAA	p.Lys others(5): Show p.Lys906fs	BMP2K	ENSG00000138756.19	transcript	ENST00000502613.3	protein_coding	16/16	2912/8012	2718/3486	906/1161	INFO_REALIGN_3_PRIME	chr4	TogoVar

Search by Variant

Search

Search Results (Total: 5828 hits)