Joint Open Genome and Omics Platform (JoGo)

Search by Variant

Regionname

e.g. ALDH2_chr12_111761933_111822532, HBB_chr11_5220464_5232071.

Chr

Chromosome name (e.g., chr11).

Snpeff genename

Exact SnpEff gene name.

Sampleids

Target sampleid (e.g. HG02615).

Snpeff haplotype class

Haplotype-annotation class (e.g., ahapid, ahapid+chapid).

Snpeff annotation impact

Exact impact level (e.g., HIGH, MODERATE, LOW).

Snpeff annotation impact detail

Keyword match in SnpEff annotation.

Hapid

One or more haplotype IDs (comma-separated; e.g., a0001, a01, a0001c0001, a01c02, a1c2, a0001c0001t0005, a0001c0001t0005g0018).

Samplehapid

Sample haplotype IDs to include (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

No_hapid

Haplotype IDs to exclude (comma-separated; e.g., a0001, a0002, a0001c0001, a0001c0001t0005, a1, a01).

No_samplehapid

Sample haplotype IDs to exclude (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

Start

Start position (GRCh38).

End

End position (GRCh38).

Minac

Minimum alternate allele count (≥).

Maxac

Maximum alternate allele count (≤).

Minlen

Minimum variant length (≥).

Maxlen

Maximum variant length (≤).

Sort By

Select column to sort.

Order by

Ascending or descending.

Show

Results per page.

regionname	pos	ref	alt	annotation	impact	samples	ahapids	achapids	acthapids	actghapids	ac	an	af	len	hgvs_c	hgvs_p	genename	geneid	featuretype	featureid	transcript_biotype	rank	cdna cdna pos length	cds cds pos length	aa aa pos length	status	chr	external
DNAH7_chr2_195732703_196073837	196047389	G G	A A	stop_gained stop_gained	HIGH	HG01928.hp2 HG01928.hp2	a0022 a0022	a0022c0070 a0022c0070	a0022c0070t0003 a0022c0070t0003	a0022c0070t0003g0108 a0022c0070t0003g0108	1	256	0.0039	0	c.361 others(3): Show c.361C>T	p.Arg others(4): Show p.Arg121*	DNAH7	ENSG00000118997.14	transcript	ENST00000312428.11	protein_coding	5/65	487/12419	361/12075	121/4024		chr2	TogoVar
DNAH8_chr6_38710311_39035792	38857680	A A	T T	stop_gained stop_gained	HIGH	NA18970.hp1 NA18970.hp1	a0073 a0073	a0073c0072 a0073c0072	a0073c0072t0001 a0073c0072t0001	a0073c0072t0001g0164 a0073c0072t0001g0164	1	284	0.0035	0	c.589 others(4): Show c.5896A>T	p.Arg others(5): Show p.Arg1966*	DNAH8	ENSG00000124721.18	transcript	ENST00000327475.11	protein_coding	42/93	6035/14663	5896/14124	1966/4707		chr6	TogoVar
DNAH9_chr17_11593470_11974748	11699776	C C	T T	stop_gained stop_gained	HIGH	HG02735.hp1 HG02735.hp1	a0036 a0036	a0036c0130 a0036c0130	a0036c0130t0001 a0036c0130t0001	a0036c0130t0001g0113 a0036c0130t0001g0113	1	178	0.0056	0	c.491 others(4): Show c.4918C>T	p.Arg others(5): Show p.Arg1640*	DNAH9	ENSG00000007174.18	transcript	ENST00000262442.9	protein_coding	23/69	4947/13711	4918/13461	1640/4486		chr17	TogoVar
DNAJB7_chr22_40854549_40867113	40861877	C C	A A	stop_gained stop_gained	HIGH	NA18940.hp2 NA18940.hp2	a0010 a0010	a0010c0012 a0010c0012	a0010c0012t0001 a0010c0012t0001	a0010c0012t0001g0000 a0010c0012t0001g0000	1	410	0.0024	0	c.118 others(3): Show c.118G>T	p.Glu others(3): Show p.Glu40*	DNAJB7	ENSG00000172404.5	transcript	ENST00000307221.5	protein_coding	1/1	237/2565	118/930	40/309		chr22	TogoVar
DNHD1_chr11_6492280_6577020	6558077	C C	T T	stop_gained stop_gained	HIGH	HG03041.hp1 HG03041.hp1	a0097 a0097	a0097c0119 a0097c0119	a0097c0119t0002 a0097c0119t0002	a0097c0119t0002g0153 a0097c0119t0002g0153	1	342	0.0029	0	c.878 others(4): Show c.8782C>T	p.Arg others(5): Show p.Arg2928*	DNHD1	ENSG00000179532.13	transcript	ENST00000254579.11	protein_coding	25/43	9362/14876	8782/14262	2928/4753		chr11	TogoVar
DNHD1_chr11_6492280_6577020	6563801	C C	T T	stop_gained stop_gained	HIGH	HG01243.hp2 HG01884.hp2 HG02965.hp2 HG01243.hp2 HG01884.hp2 HG02965.hp2	a0046 a0056 a0046 a0056	a0046c0037 a0056c0058 a0046c0037 a0056c0058	a0046c0037t0001 a0056c0058t0001 a0046c0037t0001 a0056c0058t0001	a0046c0037t0001g0089 a0046c0037t0001g0090 a0056c0058t0001g0206 a0046c0037t0001g0089 a0046c0037t0001g0090 a0056c0058t0001g0206	3	342	0.0088	0	c.996 others(4): Show c.9961C>T	p.Arg others(5): Show p.Arg3321*	DNHD1	ENSG00000179532.13	transcript	ENST00000254579.11	protein_coding	31/43	10541/14876	9961/14262	3321/4753		chr11	TogoVar
DPEP2_chr16_67982394_68004484	67991870	G G	C C	stop_gained stop_gained	HIGH	HG01069.hp1 HG01069.hp1	a0005 a0005	a0005c0008 a0005c0008	a0005c0008t0001 a0005c0008t0001	a0005c0008t0001g0116 a0005c0008t0001g0116	1	356	0.0028	0	c.630 others(3): Show c.630C>G	p.Tyr others(4): Show p.Tyr210*	DPEP2	ENSG00000167261.14	transcript	ENST00000393847.6	protein_coding	5/11	785/1728	630/1461	210/486		chr16	TogoVar
DPM3_chr1_155134891_155145531	155140156	C C	A A	stop_gained stop_gained	HIGH	NA18984.hp2 NA18984.hp2	a0003 a0003	a0003c0003 a0003c0003	a0003c0003t0001 a0003c0003t0001	a0003c0003t0001g0006 a0003c0003t0001g0006	1	350	0.0029	0	c.85G others(2): Show c.85G>T	p.Glu others(3): Show p.Glu29*	DPM3	ENSG00000179085.8	transcript	ENST00000368400.5	protein_coding	2/2	131/396	85/279	29/92		chr1	TogoVar
DPM3_chr1_155134891_155145531	155140171	C C	A A	stop_gained stop_gained	HIGH	NA18984.hp2 NA18984.hp2	a0003 a0003	a0003c0003 a0003c0003	a0003c0003t0001 a0003c0003t0001	a0003c0003t0001g0006 a0003c0003t0001g0006	1	350	0.0029	0	c.70G others(2): Show c.70G>T	p.Gly others(3): Show p.Gly24*	DPM3	ENSG00000179085.8	transcript	ENST00000368400.5	protein_coding	2/2	116/396	70/279	24/92		chr1	TogoVar
DPRX_chr19_53626999_53642014	53636914	G G	T T	stop_gained stop_gained	HIGH	HG00639.hp1 HG02280.hp1 HG02486.hp1 others(4): Show HG00639.hp1 HG02280.hp1 HG02486.hp1 HG02572.hp1 HG02976.hp1 NA18906.hp1 NA20129.hp1	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0001 a0002c0002t0001	a0002c0002t0001g0029 a0002c0002t0001g0056 a0002c0002t0001g0057 others(2): Show a0002c0002t0001g0029 a0002c0002t0001g0056 a0002c0002t0001g0057 a0002c0002t0001g0073 a0002c0002t0001g0076	7	478	0.0146	0	c.502 others(3): Show c.502G>T	p.Glu others(4): Show p.Glu168*	DPRX	ENSG00000204595.3	transcript	ENST00000376650.2	protein_coding	3/3	610/710	502/576	168/191		chr19	TogoVar
DQX1_chr2_74513131_74531231	74523438	G G	A A	stop_gained stop_gained	HIGH	HG01167.hp1 HG01167.hp1	a0007 a0007	a0007c0010 a0007c0010	a0007c0010t0001 a0007c0010t0001	a0007c0010t0001g0052 a0007c0010t0001g0052	1	356	0.0028	0	c.916 others(3): Show c.916C>T	p.Arg others(4): Show p.Arg306*	DQX1	ENSG00000144045.14	transcript	ENST00000404568.4	protein_coding	5/12	1031/2584	916/2154	306/717		chr2	TogoVar
DRC7_chr16_57689806_57736805	57726876	G G	GCCTTAAT others(22): Show GCCTTAATTTTCTCACTCTATAAAAATACA	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA18940.hp2 NA18940.hp2	a0015 a0015	a0015c0039 a0015c0039	a0015c0039t0001 a0015c0039t0001	a0015c0039t0001g0160 a0015c0039t0001g0160	1	388	0.0026	29	c.201 others(38): Show c.2019_2020insCCTTAATTTTCTCACTCTATAAAAATACA	p.Ala others(5): Show p.Ala674fs	DRC7	ENSG00000159625.15	transcript	ENST00000360716.8	protein_coding	15/19	2235/3387	2020/2625	674/874		chr16	TogoVar
DSCC1_chr8_119828976_119860894	119838260	G G	A A	stop_gained others(1): Show stop_gained splice_region_variant	HIGH	HG02965.hp2 HG02965.hp2	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0003 a0005c0005t0003	a0005c0005t0003g0201 a0005c0005t0003g0201	1	378	0.0027	0	c.107 others(4): Show c.1072C>T	p.Gln others(4): Show p.Gln358*	DSCC1	ENSG00000136982.6	transcript	ENST00000313655.5	protein_coding	8/9	1171/2198	1072/1182	358/393		chr8	TogoVar
DSN1_chr20_36746795_36778763	36752835	G G	A A	stop_gained stop_gained	HIGH	HG03239.hp2 HG03239.hp2	a0003 a0003	a0003c0004 a0003c0004	a0003c0004t0003 a0003c0004t0003	a0003c0004t0003g0129 a0003c0004t0003g0129	1	332	0.0030	0	c.102 others(4): Show c.1024C>T	p.Gln others(4): Show p.Gln342*	DSN1	ENSG00000149636.16	transcript	ENST00000373750.9	protein_coding	11/11	1141/2181	1024/1071	342/356		chr20	TogoVar
DUOX1_chr15_45124994_45170574	45141323	C C	T T	stop_gained stop_gained	HIGH	HG01891.hp2 HG01891.hp2	a0013 a0013	a0013c0041 a0013c0041	a0013c0041t0005 a0013c0041t0005	a0013c0041t0005g0123 a0013c0041t0005g0123	1	386	0.0026	0	c.159 others(4): Show c.1597C>T	p.Arg others(4): Show p.Arg533*	DUOX1	ENSG00000137857.18	transcript	ENST00000389037.7	protein_coding	14/34	1751/5483	1597/4656	533/1551		chr15	TogoVar
DUSP15_chr20_31856077_31875527	31861645	C C	A A	stop_gained stop_gained	HIGH	HG02055.hp1 HG02055.hp1	a0006 a0006	a0006c0007 a0006c0007	a0006c0007t0001 a0006c0007t0001	a0006c0007t0001g0074 a0006c0007t0001g0074	1	378	0.0027	0	c.466 others(3): Show c.466G>T	p.Glu others(4): Show p.Glu156*	DUSP15	ENSG00000149599.16	transcript	ENST00000339738.10	protein_coding	7/7	656/1224	466/708	156/235		chr20	TogoVar
DUSP9_chrX_153642203_153656326	153650100	A A	AT AT	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA18987.hp1 NA18987.hp1	a0005 a0005	a0005c0009 a0005c0009	a0005c0009t0020 a0005c0009t0020	a0005c0009t0020g0013 a0005c0009t0020g0013	1	328	0.0031	1	c.951 others(4): Show c.951dupT	p.Asp others(5): Show p.Asp318fs	DUSP9	ENSG00000130829.18	transcript	ENST00000342782.4	protein_coding	4/4	1210/2434	952/1155	318/384	INFO_REALIGN_3_PRIME	chrX	TogoVar
DUXB_chr16_75688893_75706461	75696841	G G	A A	stop_gained stop_gained	HIGH	NA18522.hp2 NA18522.hp2	a0006 a0006	a0006c0008 a0006c0008	a0006c0008t0001 a0006c0008t0001	a0006c0008t0001g0052 a0006c0008t0001g0052	1	422	0.0024	0	c.283 others(3): Show c.283C>T	p.Gln others(3): Show p.Gln95*	DUXB	ENSG00000282757.4	transcript	ENST00000633875.4	protein_coding	3/5	326/1117	283/1038	95/345		chr16	TogoVar
DYNC2I1_chr7_158851558_158951189	158879722	C C	A A	stop_gained stop_gained	HIGH	NA18953.hp1 NA18953.hp1	a0012 a0012	a0012c0013 a0012c0013	a0012c0013t0001 a0012c0013t0001	a0012c0013t0001g0104 a0012c0013t0001g0104	1	274	0.0037	0	c.612 others(3): Show c.612C>A	p.Tyr others(4): Show p.Tyr204*	DYNC2I1	ENSG00000126870.16	transcript	ENST00000407559.8	protein_coding	5/25	790/3789	612/3201	204/1066		chr7	TogoVar
DYNLT4_chr1_44800893_44812351	44806185	C C	A A	stop_gained stop_gained	HIGH	HG02004.hp2 HG02004.hp2	a0003 a0003	a0003c0009 a0003c0009	a0003c0009t0001 a0003c0009t0001	a0003c0009t0001g0013 a0003c0009t0001g0013	1	392	0.0026	0	c.484 others(3): Show c.484G>T	p.Glu others(4): Show p.Glu162*	DYNLT4	ENSG00000188396.4	transcript	ENST00000339355.3	protein_coding	3/3	577/869	484/666	162/221		chr1	TogoVar
DYRK4_chr12_4557208_4618875	4604918	C C	G G	stop_gained stop_gained	HIGH	HG02055.hp1 HG02055.hp1	a0009 a0009	a0009c0026 a0009c0026	a0009c0026t0001 a0009c0026t0001	a0009c0026t0001g0288 a0009c0026t0001g0288	1	414	0.0024	0	c.113 others(4): Show c.1131C>G	p.Tyr others(4): Show p.Tyr377*	DYRK4	ENSG00000010219.14	transcript	ENST00000543431.6	protein_coding	11/15	1169/2065	1131/1905	377/634		chr12	TogoVar
DYTN_chr2_206646621_206723396	206705791	G G	A A	stop_gained stop_gained	HIGH	HG02559.hp1 HG02895.hp1 HG02897.hp1 HG02559.hp1 HG02895.hp1 HG02897.hp1	a0005 a0005	a0005c0008 a0005c0008	a0005c0008t0001 a0005c0008t0001	a0005c0008t0001g0005 a0005c0008t0001g0200 a0005c0008t0001g0005 a0005c0008t0001g0200	3	382	0.0079	0	c.379 others(3): Show c.379C>T	p.Arg others(4): Show p.Arg127*	DYTN	ENSG00000232125.5	transcript	ENST00000452335.2	protein_coding	4/12	496/2051	379/1737	127/578		chr2	TogoVar
E2F5_chr8_85172154_85219518	85203112	T T	A A	stop_gained stop_gained	HIGH	NA18985.hp2 NA18985.hp2	a0003 a0003	a0003c0006 a0003c0006	a0003c0006t0001 a0003c0006t0001	a0003c0006t0001g0152 a0003c0006t0001g0152	1	336	0.0030	0	c.363 others(3): Show c.363T>A	p.Cys others(4): Show p.Cys121*	E2F5	ENSG00000133740.11	transcript	ENST00000416274.7	protein_coding	3/8	630/1964	363/1041	121/346		chr8	TogoVar
E4F1_chr16_2218591_2240742	2234658	C C	T T	stop_gained stop_gained	HIGH	HG02698.hp2 HG02698.hp2	a0009 a0009	a0009c0015 a0009c0015	a0009c0015t0001 a0009c0015t0001	a0009c0015t0001g0002 a0009c0015t0001g0002	1	392	0.0026	0	c.166 others(4): Show c.1669C>T	p.Arg others(4): Show p.Arg557*	E4F1	ENSG00000167967.16	transcript	ENST00000301727.9	protein_coding	11/14	1692/2548	1669/2355	557/784		chr16	TogoVar
EBLN1_chr10_22203475_22223015	22209191	C C	A A	stop_gained stop_gained	HIGH	NA19043.hp1 NA19043.hp1	a0014 a0014	a0014c0016 a0014c0016	a0014c0016t0012 a0014c0016t0012	a0014c0016t0012g0068 a0014c0016t0012g0068	1	432	0.0023	0	c.793 others(3): Show c.793G>T	p.Glu others(4): Show p.Glu265*	EBLN1	ENSG00000223601.3	transcript	ENST00000422359.3	protein_coding	3/3	1061/1777	793/1101	265/366		chr10	TogoVar
EBLN1_chr10_22203475_22223015	22209293	T T	TTTGTCCT others(18): Show TTTGTCCTTTTTCGCTGACTACTTTA	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	HG01070.hp1 HG01070.hp1	a0015 a0015	a0015c0015 a0015c0015	a0015c0015t0002 a0015c0015t0002	a0015c0015t0002g0065 a0015c0015t0002g0065	1	432	0.0023	25	c.690 others(32): Show c.690_691insTAAAGTAGTCAGCGAAAAAGGACAA	p.Lys others(5): Show p.Lys231fs	EBLN1	ENSG00000223601.3	transcript	ENST00000422359.3	protein_coding	3/3	958/1777	690/1101	230/366		chr10	TogoVar
EBLN1_chr10_22203475_22223015	22209341	C C	A A	stop_gained stop_gained	HIGH	HG01167.hp2 HG01167.hp2	a0009 a0009	a0009c0011 a0009c0011	a0009c0011t0002 a0009c0011t0002	a0009c0011t0002g0062 a0009c0011t0002g0062	1	432	0.0023	0	c.643 others(3): Show c.643G>T	p.Glu others(4): Show p.Glu215*	EBLN1	ENSG00000223601.3	transcript	ENST00000422359.3	protein_coding	3/3	911/1777	643/1101	215/366		chr10	TogoVar
EBLN1_chr10_22203475_22223015	22209436	A A	C C	stop_gained stop_gained	HIGH	HG01167.hp2 HG01167.hp2	a0009 a0009	a0009c0011 a0009c0011	a0009c0011t0002 a0009c0011t0002	a0009c0011t0002g0062 a0009c0011t0002g0062	1	432	0.0023	0	c.548 others(3): Show c.548T>G	p.Leu others(4): Show p.Leu183*	EBLN1	ENSG00000223601.3	transcript	ENST00000422359.3	protein_coding	3/3	816/1777	548/1101	183/366		chr10	TogoVar
EBLN2_chr3_73056659_73068337	73062573	T T	G G	stop_gained stop_gained	HIGH	HG01515.hp2 HG03239.hp1 HG01515.hp2 HG03239.hp1	a0002 a0002	a0002c0009 a0002c0009	a0002c0009t0003 a0002c0009t0003	a0002c0009t0003g0000 a0002c0009t0003g0000	2	428	0.0047	0	c.492 others(3): Show c.492T>G	p.Tyr others(4): Show p.Tyr164*	EBLN2	ENSG00000255423.1	transcript	ENST00000533473.1	protein_coding	1/1	915/1679	492/819	164/272		chr3	TogoVar
EBLN2_chr3_73056659_73068337	73062749	C C	A A	stop_gained stop_gained	HIGH	HG02896.hp1 HG02897.hp2 NA18522.hp2 HG02896.hp1 HG02897.hp2 NA18522.hp2	a0007 a0007	a0007c0008 a0007c0008	a0007c0008t0001 a0007c0008t0001	a0007c0008t0001g0000 a0007c0008t0001g0000	3	428	0.0070	0	c.668 others(3): Show c.668C>A	p.Ser others(4): Show p.Ser223*	EBLN2	ENSG00000255423.1	transcript	ENST00000533473.1	protein_coding	1/1	1091/1679	668/819	223/272		chr3	TogoVar
ECH1_chr19_38810422_38836794	38817483	G G	A A	stop_gained stop_gained	HIGH	NA18960.hp2 NA18960.hp2	a0008 a0008	a0008c0012 a0008c0012	a0008c0012t0001 a0008c0012t0001	a0008c0012t0001g0098 a0008c0012t0001g0098	1	420	0.0024	0	c.442 others(3): Show c.442C>T	p.Arg others(4): Show p.Arg148*	ECH1	ENSG00000104823.9	transcript	ENST00000221418.9	protein_coding	4/10	464/1200	442/987	148/328		chr19	TogoVar
ECT2L_chr6_138791087_138909070	138880972	A A	T T	stop_gained stop_gained	HIGH	NA18998.hp2 NA18998.hp2	a0017 a0017	a0017c0035 a0017c0035	a0017c0035t0003 a0017c0035t0003	a0017c0035t0003g0159 a0017c0035t0003g0159	1	326	0.0031	0	c.168 others(4): Show c.1681A>T	p.Lys others(4): Show p.Lys561*	ECT2L	ENSG00000203734.13	transcript	ENST00000541398.7	protein_coding	15/22	2030/4507	1681/2715	561/904		chr6	TogoVar
EDN2_chr1_41473775_41489683	41479468	G G	A A	stop_gained stop_gained	HIGH	NA19088.hp1 NA19088.hp1	a0007 a0007	a0007c0006 a0007c0006	a0007c0006t0001 a0007c0006t0001	a0007c0006t0001g0063 a0007c0006t0001g0063	1	442	0.0023	0	c.478 others(3): Show c.478C>T	p.Arg others(4): Show p.Arg160*	EDN2	ENSG00000127129.10	transcript	ENST00000372587.5	protein_coding	5/5	560/1253	478/537	160/178		chr1	TogoVar
EFCAB13_chr17_47318955_47446312	47347921	C C	T T	stop_gained stop_gained	HIGH	HG00408.hp2 HG00423.hp1 HG00438.hp1 others(25): Show HG00408.hp2 HG00423.hp1 HG00438.hp1 HG00544.hp2 HG00558.hp2 HG01123.hp2 HG02004.hp2 HG02027.hp2 HG02155.hp2 HG02602.hp2 HG02738.hp2 HG03654.hp1 HG03704.hp2 HG03834.hp1 HG03927.hp2 NA18955.hp2 NA18957.hp1 NA18965.hp1 NA18977.hp2 NA18981.hp2 NA18985.hp2 NA19000.hp1 NA19003.hp2 NA19004.hp1 NA19007.hp2 NA19063.hp2 NA19075.hp1 NA19081.hp1	a0005 a0011 a0005 a0011	a0005c0005 a0011c0027 a0005c0005 a0011c0027	a0005c0005t0001 a0005c0005t0002 a0005c0005t0003 others(2): Show a0005c0005t0001 a0005c0005t0002 a0005c0005t0003 a0005c0005t0007 a0011c0027t0001	a0005c0005t0001g0007 a0005c0005t0001g0008 a0005c0005t0001g0068 others(25): Show a0005c0005t0001g0007 a0005c0005t0001g0008 a0005c0005t0001g0068 a0005c0005t0001g0069 a0005c0005t0001g0071 a0005c0005t0001g0074 a0005c0005t0001g0075 a0005c0005t0001g0110 a0005c0005t0001g0115 a0005c0005t0001g0116 a0005c0005t0001g0200 a0005c0005t0001g0202 a0005c0005t0001g0203 a0005c0005t0001g0204 a0005c0005t0001g0206 a0005c0005t0001g0207 a0005c0005t0001g0208 a0005c0005t0001g0209 a0005c0005t0001g0210 a0005c0005t0001g0211 a0005c0005t0001g0212 a0005c0005t0001g0274 a0005c0005t0001g0342 a0005c0005t0002g0238 a0005c0005t0003g0118 a0005c0005t0003g0327 a0005c0005t0007g0213 a0011c0027t0001g0121	28	356	0.0787	0	c.631 others(3): Show c.631C>T	p.Arg others(4): Show p.Arg211*	EFCAB13	ENSG00000178852.16	transcript	ENST00000331493.7	protein_coding	9/25	1068/3957	631/2922	211/973		chr17	TogoVar
EFCAB13_chr17_47318955_47446312	47374891	A A	T T	stop_gained stop_gained	HIGH	HG01070.hp1 HG01071.hp1 homoSapiens_chm13v2.hp1 HG01070.hp1 HG01071.hp1 homoSapiens_chm13v2.hp1	a0001 a0001	a0001c0013 a0001c0013	a0001c0013t0001 a0001c0013t0001	a0001c0013t0001g0117 a0001c0013t0001g0196 a0001c0013t0001g0197 a0001c0013t0001g0117 a0001c0013t0001g0196 a0001c0013t0001g0197	3	356	0.0084	0	c.129 others(4): Show c.1297A>T	p.Lys others(4): Show p.Lys433*	EFCAB13	ENSG00000178852.16	transcript	ENST00000331493.7	protein_coding	12/25	1734/3957	1297/2922	433/973		chr17	TogoVar
EFCAB13_chr17_47318955_47446312	47391492	T T	G G	stop_gained stop_gained	HIGH	HG00099.hp1 HG00642.hp1 HG00735.hp1 others(10): Show HG00099.hp1 HG00642.hp1 HG00735.hp1 HG01081.hp1 HG01099.hp2 HG01168.hp1 HG01169.hp1 HG01175.hp1 HG01261.hp2 HG02055.hp1 HG02602.hp1 HG02818.hp1 NA20752.hp2	a0001 a0001	a0001c0006 a0001c0006	a0001c0006t0001 a0001c0006t0002 a0001c0006t0003 a0001c0006t0001 a0001c0006t0002 a0001c0006t0003	a0001c0006t0001g0093 a0001c0006t0001g0094 a0001c0006t0001g0095 others(10): Show a0001c0006t0001g0093 a0001c0006t0001g0094 a0001c0006t0001g0095 a0001c0006t0001g0097 a0001c0006t0001g0098 a0001c0006t0001g0100 a0001c0006t0002g0072 a0001c0006t0002g0073 a0001c0006t0002g0092 a0001c0006t0002g0099 a0001c0006t0002g0102 a0001c0006t0003g0096 a0001c0006t0003g0101	13	356	0.0365	0	c.163 others(4): Show c.1638T>G	p.Tyr others(4): Show p.Tyr546*	EFCAB13	ENSG00000178852.16	transcript	ENST00000331493.7	protein_coding	15/25	2075/3957	1638/2922	546/973		chr17	TogoVar
EFCAB3_chr17_62375553_62421480	62391965	C C	T T	stop_gained others(1): Show stop_gained splice_region_variant	HIGH	HG01081.hp2 HG01081.hp2	a0005 a0005	a0005c0006 a0005c0006	a0005c0006t0001 a0005c0006t0001	a0005c0006t0001g0030 a0005c0006t0001g0030	1	368	0.0027	0	c.295 others(3): Show c.295C>T	p.Arg others(3): Show p.Arg99*	EFCAB3	ENSG00000172421.10	transcript	ENST00000305286.8	protein_coding	4/10	373/1546	295/1317	99/438		chr17	TogoVar
EFCAB5_chr17_29936634_30113452	30078331	C C	T T	stop_gained stop_gained	HIGH	HG02922.hp2 HG03195.hp1 NA19240.hp1 HG02922.hp2 HG03195.hp1 NA19240.hp1	a0007 a0007	a0007c0009 a0007c0009	a0007c0009t0002 a0007c0009t0002	a0007c0009t0002g0100 a0007c0009t0002g0101 a0007c0009t0002g0102 a0007c0009t0002g0100 a0007c0009t0002g0101 a0007c0009t0002g0102	3	248	0.0121	0	c.285 others(4): Show c.2854C>T	p.Gln others(4): Show p.Gln952*	EFCAB5	ENSG00000176927.16	transcript	ENST00000394835.8	protein_coding	15/23	3017/5103	2854/4512	952/1503		chr17	TogoVar
EFCAB8_chr20_32853923_32966845	32943738	C C	T T	stop_gained stop_gained	HIGH	HG00280.hp1 HG00280.hp2 HG00642.hp1 others(28): Show HG00280.hp1 HG00280.hp2 HG00642.hp1 HG00733.hp1 HG00741.hp2 HG01123.hp1 HG01168.hp1 HG01255.hp2 HG01261.hp1 HG01496.hp1 HG01515.hp2 HG01516.hp1 HG01516.hp2 HG01943.hp2 HG01975.hp2 HG02293.hp1 HG02300.hp2 HG02683.hp2 HG02738.hp2 HG03017.hp2 HG03491.hp2 HG03688.hp1 HG03831.hp2 HG03927.hp2 HG04199.hp2 NA18522.hp2 NA18951.hp2 NA18952.hp1 NA18998.hp1 NA19081.hp2 NA20129.hp2	a0004 a0005 a0008 others(5): Show a0004 a0005 a0008 a0011 a0027 a0029 a0032 a0037	a0004c0004 a0005c0037 a0008c0007 others(5): Show a0004c0004 a0005c0037 a0008c0007 a0011c0010 a0027c0029 a0029c0059 a0032c0064 a0037c0057	a0004c0004t0001 a0004c0004t0003 a0005c0037t0004 others(8): Show a0004c0004t0001 a0004c0004t0003 a0005c0037t0004 a0008c0007t0003 a0008c0007t0006 a0011c0010t0003 a0011c0010t0006 a0027c0029t0003 a0029c0059t0003 a0032c0064t0003 a0037c0057t0004	a0004c0004t0001g0089 a0004c0004t0003g0058 a0004c0004t0003g0059 others(28): Show a0004c0004t0001g0089 a0004c0004t0003g0058 a0004c0004t0003g0059 a0004c0004t0003g0066 a0004c0004t0003g0068 a0004c0004t0003g0069 a0004c0004t0003g0073 a0004c0004t0003g0077 a0004c0004t0003g0084 a0004c0004t0003g0085 a0004c0004t0003g0086 a0004c0004t0003g0087 a0004c0004t0003g0189 a0004c0004t0003g0253 a0005c0037t0004g0183 a0008c0007t0003g0194 a0008c0007t0003g0280 a0008c0007t0003g0281 a0008c0007t0006g0013 a0008c0007t0006g0016 a0008c0007t0006g0044 a0011c0010t0003g0141 a0011c0010t0006g0009 a0011c0010t0006g0010 a0011c0010t0006g0030 a0011c0010t0006g0049 a0027c0029t0003g0117 a0027c0029t0003g0239 a0029c0059t0003g0071 a0032c0064t0003g0083 a0037c0057t0004g0249	31	284	0.1092	0	c.289 others(4): Show c.2893C>T	p.Gln others(4): Show p.Gln965*	EFCAB8	ENSG00000215529.13	transcript	ENST00000400522.9	protein_coding	23/27	2987/4197	2893/3867	965/1288		chr20	TogoVar
EFNB1_chrX_68824021_68847160	68840583	T T	TA TA	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA19075.hp1 NA19075.hp1	a0004 a0004	a0004c0005 a0004c0005	a0004c0005t0025 a0004c0005t0025	a0004c0005t0025g0053 a0004c0005t0025g0053	1	335	0.0030	1	c.971 others(4): Show c.971dupA	p.Tyr others(5): Show p.Tyr324fs	EFNB1	ENSG00000090776.6	transcript	ENST00000204961.5	protein_coding	5/5	1728/3303	972/1041	324/346	INFO_REALIGN_3_PRIME	chrX	TogoVar
EGFL8_chr6_32159595_32173281	32166618	C C	G G	stop_gained others(1): Show stop_gained splice_region_variant	HIGH	HG04115.hp1 HG04115.hp1	a0005 a0005	a0005c0007 a0005c0007	a0005c0007t0005 a0005c0007t0005	a0005c0007t0005g0003 a0005c0007t0005g0003	1	433	0.0023	0	c.222 others(3): Show c.222C>G	p.Tyr others(3): Show p.Tyr74*	EGFL8	ENSG00000241404.7	transcript	ENST00000333845.11	protein_coding	3/9	313/1298	222/882	74/293		chr6	TogoVar
EGF_chr4_109907883_110018766	109976211	C C	T T	stop_gained stop_gained	HIGH	HG02083.hp2 HG02083.hp2	a0021 a0021	a0021c0031 a0021c0031	a0021c0031t0005 a0021c0031t0005	a0021c0031t0005g0029 a0021c0031t0005g0029	1	388	0.0026	0	c.202 others(4): Show c.2029C>T	p.Arg others(4): Show p.Arg677*	EGF	ENSG00000138798.13	transcript	ENST00000265171.10	protein_coding	13/24	2482/6388	2029/3624	677/1207		chr4	TogoVar
EGLN2_chr19_40794191_40813434	40800675	G G	T T	stop_gained stop_gained	HIGH	HG01515.hp1 HG01515.hp1	a0003 a0003	a0003c0012 a0003c0012	a0003c0012t0001 a0003c0012t0001	a0003c0012t0001g0085 a0003c0012t0001g0085	1	420	0.0024	0	c.103 others(3): Show c.103G>T	p.Gly others(3): Show p.Gly35*	EGLN2	ENSG00000269858.6	transcript	ENST00000303961.9	protein_coding	2/6	409/2100	103/1224	35/407		chr19	TogoVar
EHBP1L1_chr11_65571053_65597650	65581969	A A	T T	stop_gained stop_gained	HIGH	NA18946.hp1 NA18946.hp1	a0020 a0020	a0020c0027 a0020c0027	a0020c0027t0001 a0020c0027t0001	a0020c0027t0001g0102 a0020c0027t0001g0102	1	412	0.0024	0	c.129 others(4): Show c.1297A>T	p.Arg others(4): Show p.Arg433*	EHBP1L1	ENSG00000173442.13	transcript	ENST00000309295.9	protein_coding	9/19	1547/5170	1297/4572	433/1523		chr11	TogoVar
EHBP1L1_chr11_65571053_65597650	65585026	C C	A A	stop_gained stop_gained	HIGH	NA18969.hp1 NA18969.hp1	a0024 a0024	a0024c0034 a0024c0034	a0024c0034t0002 a0024c0034t0002	a0024c0034t0002g0006 a0024c0034t0002g0006	1	412	0.0024	0	c.336 others(4): Show c.3368C>A	p.Ser others(5): Show p.Ser1123*	EHBP1L1	ENSG00000173442.13	transcript	ENST00000309295.9	protein_coding	12/19	3618/5170	3368/4572	1123/1523		chr11	TogoVar
EIF3CL_chr16_28374715_28408841	28388130	C C	T T	stop_gained stop_gained	HIGH	HG00544.hp1 HG01106.hp1 HG01243.hp1 others(24): Show HG00544.hp1 HG01106.hp1 HG01243.hp1 HG01496.hp1 HG02056.hp1 HG02071.hp1 HG02071.hp2 HG02257.hp1 HG02280.hp2 HG02451.hp2 HG02630.hp2 HG02647.hp1 HG02809.hp1 HG02895.hp2 HG04199.hp1 NA18522.hp2 NA18966.hp2 NA18971.hp1 NA18971.hp2 NA18983.hp1 NA19000.hp1 NA19009.hp2 NA19062.hp1 NA19064.hp2 NA19087.hp2 NA19091.hp1 NA20129.hp2	a0002 a0003 a0005 others(2): Show a0002 a0003 a0005 a0006 a0007	a0002c0002 a0002c0007 a0002c0013 others(5): Show a0002c0002 a0002c0007 a0002c0013 a0002c0018 a0003c0003 a0005c0008 a0006c0009 a0007c0017	a0002c0002t0001 a0002c0007t0001 a0002c0013t0001 others(5): Show a0002c0002t0001 a0002c0007t0001 a0002c0013t0001 a0002c0018t0001 a0003c0003t0002 a0005c0008t0001 a0006c0009t0002 a0007c0017t0001	a0002c0002t0001g0026 a0002c0002t0001g0027 a0002c0002t0001g0029 others(24): Show a0002c0002t0001g0026 a0002c0002t0001g0027 a0002c0002t0001g0029 a0002c0002t0001g0078 a0002c0002t0001g0080 a0002c0002t0001g0081 a0002c0002t0001g0082 a0002c0002t0001g0094 a0002c0002t0001g0097 a0002c0002t0001g0131 a0002c0002t0001g0151 a0002c0002t0001g0152 a0002c0002t0001g0153 a0002c0007t0001g0114 a0002c0007t0001g0115 a0002c0007t0001g0116 a0002c0013t0001g0150 a0002c0018t0001g0028 a0003c0003t0002g0010 a0003c0003t0002g0011 a0003c0003t0002g0012 a0003c0003t0002g0013 a0003c0003t0002g0014 a0003c0003t0002g0016 a0005c0008t0001g0021 a0006c0009t0002g0015 a0007c0017t0001g0113	27	172	0.1570	0	c.174 others(4): Show c.1749G>A	p.Trp others(4): Show p.Trp583*	EIF3CL	ENSG00000205609.13	transcript	ENST00000380876.5	protein_coding	15/21	1834/2913	1749/2745	583/914		chr16	TogoVar
EIF3CL_chr16_28374715_28408841	28400906	G G	A A	stop_gained stop_gained	HIGH	HG02280.hp2 HG02280.hp2	a0006 a0006	a0006c0009 a0006c0009	a0006c0009t0002 a0006c0009t0002	a0006c0009t0002g0015 a0006c0009t0002g0015	1	172	0.0058	0	c.436 others(3): Show c.436C>T	p.Arg others(4): Show p.Arg146*	EIF3CL	ENSG00000205609.13	transcript	ENST00000380876.5	protein_coding	5/21	521/2913	436/2745	146/914		chr16	TogoVar
EIF3C_chr16_28706464_28740596	28727173	G G	A A	stop_gained stop_gained	HIGH	HG02572.hp2 HG02572.hp2	a0003 a0003	a0003c0004 a0003c0004	a0003c0004t0001 a0003c0004t0001	a0003c0004t0001g0082 a0003c0004t0001g0082	1	100	0.0100	0	c.174 others(4): Show c.1746G>A	p.Trp others(4): Show p.Trp582*	EIF3C	ENSG00000184110.15	transcript	ENST00000331666.11	protein_coding	15/21	1831/2910	1746/2742	582/913		chr16	TogoVar
EIF4EBP3_chr5_140542662_140554576	140549052	C C	T T	stop_gained stop_gained	HIGH	HG01891.hp1 HG01891.hp1	a0002 a0002	a0002c0004 a0002c0004	a0002c0004t0001 a0002c0004t0001	a0002c0004t0001g0002 a0002c0004t0001g0002	1	394	0.0025	0	c.250 others(3): Show c.250C>T	p.Gln others(3): Show p.Gln84*	EIF4EBP3	ENSG00000243056.2	transcript	ENST00000310331.3	protein_coding	2/3	326/693	250/303	84/100		chr5	TogoVar
ELP1_chr9_108862517_108939124	108878028	C C	T T	stop_gained stop_gained	HIGH	HG01993.hp1 HG01993.hp1	a0025 a0025	a0025c0039 a0025c0039	a0025c0039t0003 a0025c0039t0003	a0025c0039t0003g0166 a0025c0039t0003g0166	1	416	0.0024	0	c.382 others(4): Show c.3822G>A	p.Trp others(5): Show p.Trp1274*	ELP1	ENSG00000070061.16	transcript	ENST00000374647.10	protein_coding	35/37	4138/5913	3822/3999	1274/1332		chr9	TogoVar

Search by Variant

Search

Search Results (Total: 3004 hits)