Joint Open Genome and Omics Platform (JoGo)

Search by Variant

Regionname

e.g. ALDH2_chr12_111761933_111822532, HBB_chr11_5220464_5232071.

Chr

Chromosome name (e.g., chr11).

Snpeff genename

Exact SnpEff gene name.

Sampleids

Target sampleid (e.g. HG02615).

Snpeff haplotype class

Haplotype-annotation class (e.g., ahapid, ahapid+chapid).

Snpeff annotation impact

Exact impact level (e.g., HIGH, MODERATE, LOW).

Snpeff annotation impact detail

Keyword match in SnpEff annotation.

Hapid

One or more haplotype IDs (comma-separated; e.g., a0001, a01, a0001c0001, a01c02, a1c2, a0001c0001t0005, a0001c0001t0005g0018).

Samplehapid

Sample haplotype IDs to include (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

No_hapid

Haplotype IDs to exclude (comma-separated; e.g., a0001, a0002, a0001c0001, a0001c0001t0005, a1, a01).

No_samplehapid

Sample haplotype IDs to exclude (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

Start

Start position (GRCh38).

End

End position (GRCh38).

Minac

Minimum alternate allele count (≥).

Maxac

Maximum alternate allele count (≤).

Minlen

Minimum variant length (≥).

Maxlen

Maximum variant length (≤).

Sort By

Select column to sort.

Order by

Ascending or descending.

Show

Results per page.

⚠️ Results limited to 10,000 hits. Refine your search for more specific results.

regionname	pos	ref	alt	annotation	impact	samples	ahapids	achapids	acthapids	actghapids	ac	an	af	len	hgvs_c	genename	geneid	featuretype	featureid	transcript_biotype	rank	distance	chr	external
CST9_chr20_23597410_23610917	23605910	C C	T T	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG00423.hp2 HG00597.hp1 HG00642.hp1 others(75): Show HG00423.hp2 HG00597.hp1 HG00642.hp1 HG00733.hp2 HG01081.hp1 HG01099.hp1 HG01123.hp2 HG01175.hp2 HG01192.hp1 HG01243.hp1 HG01255.hp1 HG01257.hp2 HG01258.hp2 HG01496.hp1 HG01496.hp2 HG01934.hp1 HG01934.hp2 HG01993.hp1 HG02004.hp1 HG02071.hp1 HG02080.hp2 HG02129.hp2 HG02135.hp1 HG02148.hp2 HG02155.hp2 HG02165.hp1 HG02165.hp2 HG02273.hp2 HG02293.hp2 HG02300.hp1 HG02300.hp2 HG02572.hp1 HG02683.hp2 HG03017.hp1 HG03209.hp2 HG03453.hp2 HG03486.hp2 HG03491.hp2 HG03492.hp1 HG03516.hp2 HG03540.hp1 HG03654.hp2 HG03710.hp1 HG03831.hp1 HG03834.hp2 HG03942.hp1 HG04115.hp1 NA18747.hp1 NA18747.hp2 NA18941.hp1 NA18942.hp1 NA18943.hp2 NA18950.hp1 NA18952.hp1 NA18953.hp2 NA18954.hp1 NA18961.hp2 NA18966.hp1 NA18969.hp2 NA18972.hp1 NA18979.hp1 NA18983.hp1 NA18986.hp2 NA18988.hp2 NA18992.hp2 NA19003.hp1 NA19006.hp2 NA19010.hp2 NA19043.hp1 NA19054.hp2 NA19055.hp1 NA19056.hp2 NA19062.hp1 NA19079.hp2 NA19088.hp2 NA19089.hp2 NA19091.hp2 NA20129.hp1	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0002 a0001c0001t0007 a0001c0001t0002 a0001c0001t0007	a0001c0001t0002g0002 a0001c0001t0002g0015 a0001c0001t0007g0009 a0001c0001t0002g0002 a0001c0001t0002g0015 a0001c0001t0007g0009	78	422	0.1848	0	c.-46 others(3): Show c.-46G>A	CST9	ENSG00000173335.5	transcript	ENST00000376971.4	protein_coding	1/2	46	chr20	TogoVar
CSTB_chr21_43768950_43781308	43776282	G G	C C	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG01891.hp2 HG01891.hp2	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0006 a0001c0001t0006	a0001c0001t0006g0034 a0001c0001t0006g0034	1	452	0.0022	0	c.-13 others(3): Show c.-13C>G	CSTB	ENSG00000160213.10	transcript	ENST00000291568.7	protein_coding	1/3	13	chr21	TogoVar
CSTF1_chr20_56387645_56411362	56392653	C C	T T	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG00642.hp2 HG01081.hp1 HG01261.hp1 others(1): Show HG00642.hp2 HG01081.hp1 HG01261.hp1 HG03942.hp1	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0093 a0001c0001t0094 a0001c0001t0095 others(1): Show a0001c0001t0093 a0001c0001t0094 a0001c0001t0095 a0001c0001t0096	a0001c0001t0093g0002 a0001c0001t0094g0002 a0001c0001t0095g0002 others(1): Show a0001c0001t0093g0002 a0001c0001t0094g0002 a0001c0001t0095g0002 a0001c0001t0096g0002	4	422	0.0095	0	c.-93 others(3): Show c.-93C>T	CSTF1	ENSG00000101138.12	transcript	ENST00000217109.9	protein_coding	1/6	2900	chr20	TogoVar
CSTF1_chr20_56387645_56411362	56392680	A A	G G	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG02622.hp1 HG02622.hp1	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0092 a0001c0001t0092	a0001c0001t0092g0088 a0001c0001t0092g0088	1	422	0.0024	0	c.-66 others(3): Show c.-66A>G	CSTF1	ENSG00000101138.12	transcript	ENST00000217109.9	protein_coding	1/6	2873	chr20	TogoVar
CSTF1_chr20_56387645_56411362	56392703	C C	G G	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG00597.hp2 NA18952.hp1 NA18993.hp2 HG00597.hp2 NA18952.hp1 NA18993.hp2	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0089 a0001c0001t0090 a0001c0001t0091 a0001c0001t0089 a0001c0001t0090 a0001c0001t0091	a0001c0001t0089g0001 a0001c0001t0090g0001 a0001c0001t0091g0001 a0001c0001t0089g0001 a0001c0001t0090g0001 a0001c0001t0091g0001	3	422	0.0071	0	c.-43 others(3): Show c.-43C>G	CSTF1	ENSG00000101138.12	transcript	ENST00000217109.9	protein_coding	1/6	2850	chr20	TogoVar
CSTF2T_chr10_51690486_51704595	51699590	G G	A A	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG01167.hp1 HG01192.hp2 HG02257.hp1 others(4): Show HG01167.hp1 HG01192.hp2 HG02257.hp1 HG03130.hp1 HG03130.hp2 HG03471.hp2 NA19240.hp2	a0001 a0001	a0001c0003 a0001c0003	a0001c0003t0006 a0001c0003t0029 a0001c0003t0030 a0001c0003t0006 a0001c0003t0029 a0001c0003t0030	a0001c0003t0006g0000 a0001c0003t0029g0000 a0001c0003t0030g0000 a0001c0003t0006g0000 a0001c0003t0029g0000 a0001c0003t0030g0000	7	428	0.0164	0	c.-41 others(3): Show c.-41C>T	CSTF2T	ENSG00000177613.9	transcript	ENST00000331173.6	protein_coding	1/1	41	chr10	TogoVar
CSTF2T_chr10_51690486_51704595	51699594	C C	G G	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG01168.hp2 HG01168.hp2	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0011 a0001c0001t0011	a0001c0001t0011g0000 a0001c0001t0011g0000	1	428	0.0023	0	c.-45 others(3): Show c.-45G>C	CSTF2T	ENSG00000177613.9	transcript	ENST00000331173.6	protein_coding	1/1	45	chr10	TogoVar
CSTF2_chrX_100815391_100846520	100820406	T T	C C	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	NA18944.hp1 NA18944.hp1	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0004 a0001c0001t0004	a0001c0001t0004g0023 a0001c0001t0004g0023	1	299	0.0033	0	c.-11 others(3): Show c.-11T>C	CSTF2	ENSG00000101811.15	transcript	ENST00000372972.7	protein_coding	1/14	11	chrX	TogoVar
CSTF3_chr11_33079584_33166480	33161377	A A	G G	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG01433.hp1 HG01433.hp1	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0007 a0001c0001t0007	a0001c0001t0007g0193 a0001c0001t0007g0193	1	360	0.0028	0	c.-52 others(3): Show c.-52T>C	CSTF3	ENSG00000176102.13	transcript	ENST00000323959.9	protein_coding	1/21	52	chr11	TogoVar
CSTF3_chr11_33079584_33166480	33161395	A A	G G	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG00423.hp1 HG02135.hp1 NA18945.hp2 others(3): Show HG00423.hp1 HG02135.hp1 NA18945.hp2 NA18971.hp2 NA19000.hp2 NA19007.hp1	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0004 a0001c0001t0004	a0001c0001t0004g0009 a0001c0001t0004g0190 a0001c0001t0004g0191 others(1): Show a0001c0001t0004g0009 a0001c0001t0004g0190 a0001c0001t0004g0191 a0001c0001t0004g0192	6	360	0.0167	0	c.-70 others(3): Show c.-70T>C	CSTF3	ENSG00000176102.13	transcript	ENST00000323959.9	protein_coding	1/21	70	chr11	TogoVar
CSTF3_chr11_33079584_33166480	33161422	C C	G G	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	NA18942.hp2 NA18942.hp2	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0005 a0001c0001t0005	a0001c0001t0005g0022 a0001c0001t0005g0022	1	360	0.0028	0	c.-97 others(3): Show c.-97G>C	CSTF3	ENSG00000176102.13	transcript	ENST00000323959.9	protein_coding	1/21	97	chr11	TogoVar
CSTL1_chr20_23434685_23449930	23439723	G G	A A	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG00099.hp1 HG00099.hp1	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0004 a0001c0001t0004	a0001c0001t0004g0001 a0001c0001t0004g0001	1	452	0.0022	0	c.-20 others(4): Show c.-208G>A	CSTL1	ENSG00000125823.13	transcript	ENST00000347397.5	protein_coding	1/4	545	chr20	TogoVar
CSTL1_chr20_23434685_23449930	23439725	C C	A A	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG01928.hp2 HG01934.hp2 HG01928.hp2 HG01934.hp2	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0002 a0001c0001t0002	a0001c0001t0002g0001 a0001c0001t0002g0001	2	452	0.0044	0	c.-20 others(4): Show c.-206C>A	CSTL1	ENSG00000125823.13	transcript	ENST00000347397.5	protein_coding	1/4	543	chr20	TogoVar
CSTL1_chr20_23434685_23449930	23440160	G G	A A	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG01192.hp1 HG02148.hp2 HG01192.hp1 HG02148.hp2	a0003 a0003	a0003c0003 a0003c0003	a0003c0003t0003 a0003c0003t0003	a0003c0003t0003g0003 a0003c0003t0003g0003	2	452	0.0044	0	c.-10 others(4): Show c.-108G>A	CSTL1	ENSG00000125823.13	transcript	ENST00000347397.5	protein_coding	2/4	108	chr20	TogoVar
CSTL1_chr20_23434685_23449930	23440225	C C	T T	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG01496.hp2 HG01496.hp2	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0005 a0001c0001t0005	a0001c0001t0005g0001 a0001c0001t0005g0001	1	452	0.0022	0	c.-43 others(3): Show c.-43C>T	CSTL1	ENSG00000125823.13	transcript	ENST00000347397.5	protein_coding	2/4	43	chr20	TogoVar
CS_chr12_56266699_56305330	56300215	C C	T T	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG01167.hp1 HG01169.hp1 HG02630.hp2 others(4): Show HG01167.hp1 HG01169.hp1 HG02630.hp2 HG02896.hp2 HG02897.hp1 HG03139.hp2 HG03516.hp2	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0003 a0001c0001t0006 a0001c0001t0003 a0001c0001t0006	a0001c0001t0003g0025 a0001c0001t0003g0026 a0001c0001t0003g0028 others(4): Show a0001c0001t0003g0025 a0001c0001t0003g0026 a0001c0001t0003g0028 a0001c0001t0003g0029 a0001c0001t0003g0030 a0001c0001t0003g0031 a0001c0001t0006g0027	7	316	0.0222	0	c.-14 others(3): Show c.-14G>A	CS	ENSG00000062485.19	transcript	ENST00000351328.8	protein_coding	1/11	14	chr12	TogoVar
CT45A10_chrX_135876065_135898444	135893414	A A	G G	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG02723.hp1 HG02723.hp1	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0003 a0001c0001t0003	a0001c0001t0003g0033 a0001c0001t0003g0033	1	258	0.0039	0	c.-76 others(3): Show c.-76T>C	CT45A10	ENSG00000269586.8	transcript	ENST00000682849.1	protein_coding	1/5	8070	chrX	TogoVar
CT45A1_chrX_135708639_135728228	135713670	T T	C C	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG00621.hp1 HG01943.hp1 HG02056.hp1 others(16): Show HG00621.hp1 HG01943.hp1 HG02056.hp1 HG02132.hp1 HG02257.hp1 HG02257.hp2 HG02572.hp1 HG02717.hp1 HG02818.hp1 HG02818.hp2 HG03098.hp1 HG03130.hp1 HG03688.hp1 NA18940.hp1 NA18948.hp1 NA18966.hp1 NA19012.hp1 NA19085.hp1 NA20129.hp1	a0001 a0002 a0003 others(1): Show a0001 a0002 a0003 a0005	a0001c0001 a0002c0002 a0003c0005 others(1): Show a0001c0001 a0002c0002 a0003c0005 a0005c0003	a0001c0001t0002 a0002c0002t0002 a0003c0005t0002 others(1): Show a0001c0001t0002 a0002c0002t0002 a0003c0005t0002 a0005c0003t0002	a0001c0001t0002g0004 a0001c0001t0002g0009 a0002c0002t0002g0003 others(12): Show a0001c0001t0002g0004 a0001c0001t0002g0009 a0002c0002t0002g0003 a0002c0002t0002g0006 a0002c0002t0002g0016 a0002c0002t0002g0017 a0002c0002t0002g0020 a0002c0002t0002g0021 a0002c0002t0002g0023 a0002c0002t0002g0024 a0002c0002t0002g0025 a0002c0002t0002g0037 a0002c0002t0002g0038 a0003c0005t0002g0018 a0005c0003t0002g0022	19	57	0.3333	0	c.-27 others(3): Show c.-27T>C	CT45A1	ENSG00000268940.6	transcript	ENST00000594565.6	protein_coding	1/5	5271	chrX	TogoVar
CT45A1_chrX_135708639_135728228	135713671	G G	A A	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	NA18945.hp1 NA18945.hp1	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0003 a0001c0001t0003	a0001c0001t0003g0007 a0001c0001t0003g0007	1	57	0.0175	0	c.-26 others(3): Show c.-26G>A	CT45A1	ENSG00000268940.6	transcript	ENST00000594565.6	protein_coding	1/5	5270	chrX	TogoVar
CT45A2_chrX_135806668_135825012	135819793	C C	CG CG	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG02080.hp1 HG02080.hp1	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0003 a0001c0001t0003	a0001c0001t0003g0003 a0001c0001t0003g0003	1	22	0.0455	1	c.-27 others(4): Show c.-27dupC	CT45A2	ENSG00000271449.8	transcript	ENST00000612907.2	protein_coding	1/5	3529	chrX	TogoVar
CT45A2_chrX_135806668_135825012	135819929	CA CA	C C	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG02080.hp1 HG02080.hp1	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0003 a0001c0001t0003	a0001c0001t0003g0003 a0001c0001t0003g0003	1	22	0.0455	-1	c.-16 others(5): Show c.-163delT	CT45A2	ENSG00000271449.8	transcript	ENST00000612907.2	protein_coding	1/5	3665	chrX	TogoVar
CT45A3_chrX_135755044_135773191	135768123	C C	CT CT	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	NA19074.hp1 NA19074.hp1	a0004 a0004	a0004c0005 a0004c0005	a0004c0005t0006 a0004c0005t0006	a0004c0005t0006g0082 a0004c0005t0006g0082	1	160	0.0063	1	c.-23 others(8): Show c.-23_-22insA	CT45A3	ENSG00000269096.7	transcript	ENST00000598716.3	protein_coding	1/5	3680	chrX	TogoVar
CT45A3_chrX_135755044_135773191	135768157	A A	AT AT	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	NA19074.hp1 NA19074.hp1	a0004 a0004	a0004c0005 a0004c0005	a0004c0005t0006 a0004c0005t0006	a0004c0005t0006g0082 a0004c0005t0006g0082	1	160	0.0063	1	c.-57 others(8): Show c.-57_-56insA	CT45A3	ENSG00000269096.7	transcript	ENST00000598716.3	protein_coding	1/5	3714	chrX	TogoVar
CT45A3_chrX_135755044_135773191	135768168	G G	GC GC	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	NA19074.hp1 NA19074.hp1	a0004 a0004	a0004c0005 a0004c0005	a0004c0005t0006 a0004c0005t0006	a0004c0005t0006g0082 a0004c0005t0006g0082	1	160	0.0063	1	c.-68 others(4): Show c.-68dupG	CT45A3	ENSG00000269096.7	transcript	ENST00000598716.3	protein_coding	1/5	3725	chrX	TogoVar
CT45A5_chrX_135770852_135790503	135785250	A A	AG AG	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG02809.hp1 HG02809.hp1	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0014 a0001c0001t0014	a0001c0001t0014g0029 a0001c0001t0014g0029	1	177	0.0057	1	c.-21 others(4): Show c.-21dupC	CT45A5	ENSG00000228836.9	transcript	ENST00000698999.1	protein_coding	1/5	3522	chrX	TogoVar
CT45A5_chrX_135770852_135790503	135785256	C C	CG CG	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	NA18984.hp1 NA18984.hp1	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0013 a0001c0001t0013	a0001c0001t0013g0028 a0001c0001t0013g0028	1	177	0.0057	1	c.-27 others(4): Show c.-27dupC	CT45A5	ENSG00000228836.9	transcript	ENST00000698999.1	protein_coding	1/5	3528	chrX	TogoVar
CT45A5_chrX_135770852_135790503	135785378	G G	T T	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	NA19001.hp1 NA19001.hp1	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0012 a0001c0001t0012	a0001c0001t0012g0027 a0001c0001t0012g0027	1	177	0.0057	0	c.-14 others(4): Show c.-148C>A	CT45A5	ENSG00000228836.9	transcript	ENST00000698999.1	protein_coding	1/5	3649	chrX	TogoVar
CT45A6_chrX_135789685_135807787	135802666	C C	T T	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG06807.hp2 HG06807.hp2	a0003 a0003	a0003c0002 a0003c0002	a0003c0002t0004 a0003c0002t0004	a0003c0002t0004g0031 a0003c0002t0004g0031	1	36	0.0278	0	c.-16 others(4): Show c.-162G>A	CT45A6	ENSG00000278289.5	transcript	ENST00000620654.2	protein_coding	1/5	3673	chrX	TogoVar
CT45A6_chrX_135789685_135807787	135802774	C C	T T	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG00099.hp1 HG00099.hp2 HG00558.hp1 others(32): Show HG00099.hp1 HG00099.hp2 HG00558.hp1 HG00558.hp2 HG00621.hp1 HG00642.hp1 HG01081.hp1 HG01081.hp2 HG01258.hp1 HG01928.hp1 HG02056.hp1 HG02071.hp1 HG02165.hp1 HG02165.hp2 HG02300.hp1 HG02486.hp1 HG02922.hp1 HG02922.hp2 HG03453.hp1 HG03453.hp2 HG03669.hp1 HG03669.hp2 HG03831.hp1 HG03831.hp2 HG03834.hp1 HG03834.hp2 HG03942.hp1 HG06807.hp1 NA18522.hp1 NA18952.hp1 NA19030.hp1 NA19030.hp2 NA19043.hp1 NA19056.hp1 NA20805.hp1	a0001 a0002 a0003 others(3): Show a0001 a0002 a0003 a0004 a0005 a0006	a0001c0001 a0002c0003 a0003c0002 others(3): Show a0001c0001 a0002c0003 a0003c0002 a0004c0006 a0005c0004 a0006c0005	a0001c0001t0001 a0002c0003t0001 a0003c0002t0001 others(3): Show a0001c0001t0001 a0002c0003t0001 a0003c0002t0001 a0004c0006t0003 a0005c0004t0002 a0006c0005t0001	a0001c0001t0001g0001 a0001c0001t0001g0002 a0001c0001t0001g0003 others(27): Show a0001c0001t0001g0001 a0001c0001t0001g0002 a0001c0001t0001g0003 a0001c0001t0001g0004 a0001c0001t0001g0005 a0001c0001t0001g0006 a0001c0001t0001g0007 a0001c0001t0001g0009 a0001c0001t0001g0010 a0001c0001t0001g0011 a0001c0001t0001g0012 a0001c0001t0001g0013 a0001c0001t0001g0014 a0001c0001t0001g0016 a0001c0001t0001g0018 a0001c0001t0001g0019 a0001c0001t0001g0020 a0001c0001t0001g0021 a0001c0001t0001g0022 a0001c0001t0001g0024 a0001c0001t0001g0026 a0001c0001t0001g0027 a0001c0001t0001g0029 a0001c0001t0001g0030 a0002c0003t0001g0008 a0002c0003t0001g0015 a0003c0002t0001g0028 a0004c0006t0003g0023 a0005c0004t0002g0017 a0006c0005t0001g0025	35	36	0.9722	0	c.-27 others(4): Show c.-270G>A	CT45A6	ENSG00000278289.5	transcript	ENST00000620654.2	protein_coding	1/5	3781	chrX	TogoVar
CT45A7_chrX_135824229_135842280	135837061	C C	CG CG	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG01175.hp1 HG01175.hp1	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0005 a0005c0005t0005	a0005c0005t0005g0019 a0005c0005t0005g0019	1	19	0.0526	1	c.-27 others(4): Show c.-27dupC	CT45A7	ENSG00000273696.5	transcript	ENST00000610598.5	protein_coding	1/5	3529	chrX	TogoVar
CT45A7_chrX_135824229_135842280	135837094	G G	GC GC	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG01175.hp1 HG01175.hp1	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0005 a0005c0005t0005	a0005c0005t0005g0019 a0005c0005t0005g0019	1	19	0.0526	1	c.-60 others(4): Show c.-60dupG	CT45A7	ENSG00000273696.5	transcript	ENST00000610598.5	protein_coding	1/5	3562	chrX	TogoVar
CT45A7_chrX_135824229_135842280	135837132	TG TG	T T	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG01109.hp1 HG01109.hp1	a0003 a0003	a0003c0003 a0003c0003	a0003c0003t0004 a0003c0003t0004	a0003c0003t0004g0002 a0003c0003t0004g0002	1	19	0.0526	-1	c.-98 others(4): Show c.-98delC	CT45A7	ENSG00000273696.5	transcript	ENST00000610598.5	protein_coding	1/5	3600	chrX	TogoVar
CT45A7_chrX_135824229_135842280	135837223	A A	AG AG	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG01175.hp2 HG01175.hp2	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0003 a0001c0001t0003	a0001c0001t0003g0001 a0001c0001t0003g0001	1	19	0.0526	1	c.-18 others(5): Show c.-189dupC	CT45A7	ENSG00000273696.5	transcript	ENST00000610598.5	protein_coding	1/5	3691	chrX	TogoVar
CT45A8_chrX_135841497_135859538	135854464	C C	G G	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG03139.hp1 HG03139.hp1	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0002 a0001c0001t0002	a0001c0001t0002g0002 a0001c0001t0002g0002	1	8	0.1250	0	c.-17 others(4): Show c.-171G>C	CT45A8	ENSG00000278085.5	transcript	ENST00000611660.5	protein_coding	1/5	3681	chrX	TogoVar
CT47A1_chrX_120977476_120990760	120985550	T T	TG TG	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	NA19082.hp1 NA19082.hp1	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0004 a0001c0001t0004	a0001c0001t0004g0036 a0001c0001t0004g0036	1	302	0.0033	1	c.-22 others(4): Show c.-22dupC	CT47A1	ENSG00000236371.6	transcript	ENST00000433030.4	protein_coding	1/3	22	chrX	TogoVar
CT47A1_chrX_120977476_120990760	120985644	A A	G G	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG02109.hp2 NA19090.hp1 HG02109.hp2 NA19090.hp1	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0003 a0001c0001t0003	a0001c0001t0003g0014 a0001c0001t0003g0014	2	302	0.0066	0	c.-11 others(4): Show c.-115T>C	CT47A1	ENSG00000236371.6	transcript	ENST00000433030.4	protein_coding	1/3	115	chrX	TogoVar
CT47A1_chrX_120977476_120990760	120985689	C C	T T	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG02818.hp2 HG03041.hp1 HG02818.hp2 HG03041.hp1	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0002 a0001c0001t0002	a0001c0001t0002g0013 a0001c0001t0002g0013	2	302	0.0066	0	c.-16 others(4): Show c.-160G>A	CT47A1	ENSG00000236371.6	transcript	ENST00000433030.4	protein_coding	1/3	160	chrX	TogoVar
CT47A2_chrX_120972606_120985928	120980775	G G	A A	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG04228.hp1 HG04228.hp1	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0008 a0001c0001t0008	a0001c0001t0008g0032 a0001c0001t0008g0032	1	253	0.0040	0	c.-10 others(4): Show c.-106C>T	CT47A2	ENSG00000242362.2	transcript	ENST00000458218.3	protein_coding	1/3	106	chrX	TogoVar
CT47A2_chrX_120972606_120985928	120980776	C C	CTGAGGGA others(20): Show CTGAGGGAATAAGAGTCTCTCTCTTTAT	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG01346.hp1 HG01346.hp1	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0009 a0001c0001t0009	a0001c0001t0009g0033 a0001c0001t0009g0033	1	253	0.0040	27	c.-13 others(36): Show c.-134_-108dupATAAAGAGAGAGACTCTTATTCCCTCA	CT47A2	ENSG00000242362.2	transcript	ENST00000458218.3	protein_coding	1/3	108	chrX	TogoVar
CT47A2_chrX_120972606_120985928	120980820	T T	G G	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG02630.hp2 HG02630.hp2	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0010 a0001c0001t0010	a0001c0001t0010g0040 a0001c0001t0010g0040	1	253	0.0040	0	c.-15 others(4): Show c.-151A>C	CT47A2	ENSG00000242362.2	transcript	ENST00000458218.3	protein_coding	1/3	151	chrX	TogoVar
CT47A2_chrX_120972606_120985928	120980829	C C	T T	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	NA19030.hp2 NA19030.hp2	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0005 a0001c0001t0005	a0001c0001t0005g0017 a0001c0001t0005g0017	1	253	0.0040	0	c.-16 others(4): Show c.-160G>A	CT47A2	ENSG00000242362.2	transcript	ENST00000458218.3	protein_coding	1/3	160	chrX	TogoVar
CT47A2_chrX_120972606_120985928	120980925	T T	C C	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG00280.hp1 HG00544.hp1 HG00673.hp1 others(96): Show HG00280.hp1 HG00544.hp1 HG00673.hp1 HG00741.hp2 HG01071.hp2 HG01106.hp1 HG01109.hp1 HG01123.hp1 HG01167.hp1 HG01168.hp2 HG01169.hp1 HG01169.hp2 HG01175.hp1 HG01175.hp2 HG01243.hp1 HG01261.hp1 HG01346.hp1 HG01346.hp2 HG01358.hp1 HG01361.hp1 HG01433.hp1 HG01515.hp1 HG01517.hp2 HG01884.hp1 HG01891.hp1 HG01934.hp1 HG01943.hp1 HG01981.hp2 HG01993.hp2 HG02040.hp1 HG02055.hp1 HG02080.hp1 HG02080.hp2 HG02109.hp1 HG02109.hp2 HG02132.hp1 HG02145.hp1 HG02148.hp1 HG02148.hp2 HG02155.hp2 HG02165.hp1 HG02257.hp1 HG02559.hp2 HG02572.hp1 HG02630.hp1 HG02630.hp2 HG02647.hp1 HG02717.hp1 HG02723.hp1 HG02809.hp2 HG02886.hp1 HG02895.hp1 HG02922.hp1 HG02965.hp1 HG02976.hp1 HG03017.hp1 HG03098.hp1 HG03195.hp2 HG03209.hp1 HG03225.hp1 HG03453.hp2 HG03486.hp1 HG03486.hp2 HG03490.hp1 HG03491.hp1 HG03492.hp1 HG03516.hp1 HG03516.hp2 HG03540.hp2 HG03579.hp1 HG03654.hp1 HG03834.hp2 HG04184.hp2 HG04199.hp1 HG06807.hp1 NA18522.hp1 NA18612.hp1 NA18747.hp1 NA18947.hp2 NA18949.hp1 NA18949.hp2 NA18962.hp1 NA18966.hp1 NA18969.hp1 NA18977.hp1 NA18982.hp1 NA18984.hp1 NA18992.hp2 NA19000.hp2 NA19002.hp2 NA19003.hp1 NA19011.hp2 NA19030.hp1 NA19065.hp2 NA19074.hp1 NA19085.hp1 NA19240.hp1 NA20752.hp1 NA20905.hp1	a0001 a0003 a0005 others(1): Show a0001 a0003 a0005 a0010	a0001c0001 a0001c0004 a0003c0009 others(2): Show a0001c0001 a0001c0004 a0003c0009 a0005c0007 a0010c0005	a0001c0001t0002 a0001c0001t0003 a0001c0001t0004 others(6): Show a0001c0001t0002 a0001c0001t0003 a0001c0001t0004 a0001c0001t0009 a0001c0001t0010 a0001c0004t0002 a0003c0009t0002 a0005c0007t0002 a0010c0005t0002	a0001c0001t0002g0001 a0001c0001t0002g0011 a0001c0001t0002g0036 others(9): Show a0001c0001t0002g0001 a0001c0001t0002g0011 a0001c0001t0002g0036 a0001c0001t0003g0016 a0001c0001t0004g0038 a0001c0001t0004g0039 a0001c0001t0009g0033 a0001c0001t0010g0040 a0001c0004t0002g0012 a0003c0009t0002g0037 a0005c0007t0002g0035 a0010c0005t0002g0034	99	253	0.3913	0	c.-25 others(4): Show c.-256A>G	CT47A2	ENSG00000242362.2	transcript	ENST00000458218.3	protein_coding	1/3	256	chrX	TogoVar
CT47A3_chrX_120967746_120981068	120975842	C C	CG CG	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG00140.hp1 HG00140.hp1	a0012 a0012	a0012c0017 a0012c0017	a0012c0017t0008 a0012c0017t0008	a0012c0017t0008g0036 a0012c0017t0008g0036	1	201	0.0050	1	c.-34 others(4): Show c.-34dupC	CT47A3	ENSG00000236126.3	transcript	ENST00000441330.3	protein_coding	1/3	34	chrX	TogoVar
CT47A3_chrX_120967746_120981068	120975862	G G	GA GA	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG00140.hp1 HG00140.hp1	a0012 a0012	a0012c0017 a0012c0017	a0012c0017t0008 a0012c0017t0008	a0012c0017t0008g0036 a0012c0017t0008g0036	1	201	0.0050	1	c.-54 others(4): Show c.-54dupT	CT47A3	ENSG00000236126.3	transcript	ENST00000441330.3	protein_coding	1/3	54	chrX	TogoVar
CT47A3_chrX_120967746_120981068	120975919	AG AG	A A	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG00140.hp1 HG00140.hp1	a0012 a0012	a0012c0017 a0012c0017	a0012c0017t0008 a0012c0017t0008	a0012c0017t0008g0036 a0012c0017t0008g0036	1	201	0.0050	-1	c.-11 others(5): Show c.-111delC	CT47A3	ENSG00000236126.3	transcript	ENST00000441330.3	protein_coding	1/3	111	chrX	TogoVar
CT47A3_chrX_120967746_120981068	120975934	C C	T T	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG00140.hp1 HG00140.hp1	a0012 a0012	a0012c0017 a0012c0017	a0012c0017t0008 a0012c0017t0008	a0012c0017t0008g0036 a0012c0017t0008g0036	1	201	0.0050	0	c.-12 others(4): Show c.-125G>A	CT47A3	ENSG00000236126.3	transcript	ENST00000441330.3	protein_coding	1/3	125	chrX	TogoVar
CT47A3_chrX_120967746_120981068	120975949	G G	A A	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG00140.hp1 HG00140.hp1	a0012 a0012	a0012c0017 a0012c0017	a0012c0017t0008 a0012c0017t0008	a0012c0017t0008g0036 a0012c0017t0008g0036	1	201	0.0050	0	c.-14 others(4): Show c.-140C>T	CT47A3	ENSG00000236126.3	transcript	ENST00000441330.3	protein_coding	1/3	140	chrX	TogoVar
CT47A3_chrX_120967746_120981068	120975969	C C	G G	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG00140.hp1 HG00140.hp1	a0012 a0012	a0012c0017 a0012c0017	a0012c0017t0008 a0012c0017t0008	a0012c0017t0008g0036 a0012c0017t0008g0036	1	201	0.0050	0	c.-16 others(4): Show c.-160G>C	CT47A3	ENSG00000236126.3	transcript	ENST00000441330.3	protein_coding	1/3	160	chrX	TogoVar
CT47A3_chrX_120967746_120981068	120975981	A A	G G	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG00140.hp1 HG02630.hp1 HG03486.hp2 HG00140.hp1 HG02630.hp1 HG03486.hp2	a0001 a0012 a0001 a0012	a0001c0001 a0012c0017 a0001c0001 a0012c0017	a0001c0001t0003 a0012c0017t0008 a0001c0001t0003 a0012c0017t0008	a0001c0001t0003g0015 a0012c0017t0008g0036 a0001c0001t0003g0015 a0012c0017t0008g0036	3	201	0.0149	0	c.-17 others(4): Show c.-172T>C	CT47A3	ENSG00000236126.3	transcript	ENST00000441330.3	protein_coding	1/3	172	chrX	TogoVar
CT47A3_chrX_120967746_120981068	120976008	A A	G G	5_prime_UTR_variant 5_prime_UTR_variant	MODIFIER	HG00140.hp1 HG00140.hp1	a0012 a0012	a0012c0017 a0012c0017	a0012c0017t0008 a0012c0017t0008	a0012c0017t0008g0036 a0012c0017t0008g0036	1	201	0.0050	0	c.-19 others(4): Show c.-199T>C	CT47A3	ENSG00000236126.3	transcript	ENST00000441330.3	protein_coding	1/3	199	chrX	TogoVar

Search by Variant

Search

Search Results (Total: 10000 hits)