Joint Open Genome and Omics Platform (JoGo)

Search by Variant

Regionname

e.g. ALDH2_chr12_111761933_111822532, HBB_chr11_5220464_5232071.

Chr

Chromosome name (e.g., chr11).

Snpeff genename

Exact SnpEff gene name.

Sampleids

Target sampleid (e.g. HG02615).

Snpeff haplotype class

Haplotype-annotation class (e.g., ahapid, ahapid+chapid).

Snpeff annotation impact

Exact impact level (e.g., HIGH, MODERATE, LOW).

Snpeff annotation impact detail

Keyword match in SnpEff annotation.

Hapid

One or more haplotype IDs (comma-separated; e.g., a0001, a01, a0001c0001, a01c02, a1c2, a0001c0001t0005, a0001c0001t0005g0018).

Samplehapid

Sample haplotype IDs to include (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

No_hapid

Haplotype IDs to exclude (comma-separated; e.g., a0001, a0002, a0001c0001, a0001c0001t0005, a1, a01).

No_samplehapid

Sample haplotype IDs to exclude (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

Start

Start position (GRCh38).

End

End position (GRCh38).

Minac

Minimum alternate allele count (≥).

Maxac

Maximum alternate allele count (≤).

Minlen

Minimum variant length (≥).

Maxlen

Maximum variant length (≤).

Sort By

Select column to sort.

Order by

Ascending or descending.

Show

Results per page.

regionname	pos	ref	alt	annotation	impact	samples	ahapids	achapids	acthapids	actghapids	ac	an	af	len	hgvs_c	hgvs_p	genename	geneid	featuretype	featureid	transcript_biotype	rank	cdna cdna pos length	cds cds pos length	aa aa pos length	status	chr	external
COL9A3_chr20_62812050_62846159	62822600	GGAGTCCT others(4): Show GGAGTCCTCCCT	G G	frameshift_variant frameshift_variant	HIGH	NA19003.hp2 NA19003.hp2	a0018 a0018	a0018c0045 a0018c0045	a0018c0045t0001 a0018c0045t0001	a0018c0045t0001g0202 a0018c0045t0001g0202	1	412	0.0024	-11	c.490 others(18): Show c.490_500delGTCCTCCCTGA	p.Val others(5): Show p.Val164fs	COL9A3	ENSG00000092758.18	transcript	ENST00000649368.1	protein_coding	10/32	505/2497	490/2055	164/684	INFO_REALIGN_3_PRIME	chr20	TogoVar
COLGALT1_chr19_17550649_17588157	17577397	C C	CG CG	frameshift_variant frameshift_variant	HIGH	HG01099.hp2 HG01109.hp1 NA18956.hp2 others(5): Show HG01099.hp2 HG01109.hp1 NA18956.hp2 NA18964.hp2 NA19063.hp1 NA19067.hp1 NA19067.hp2 NA19090.hp1	a0002 a0002	a0002c0006 a0002c0010 a0002c0014 a0002c0006 a0002c0010 a0002c0014	a0002c0006t0001 a0002c0006t0009 a0002c0006t0014 others(5): Show a0002c0006t0001 a0002c0006t0009 a0002c0006t0014 a0002c0006t0015 a0002c0006t0060 a0002c0010t0002 a0002c0010t0021 a0002c0014t0025	a0002c0006t0001g0209 a0002c0006t0009g0157 a0002c0006t0014g0198 others(5): Show a0002c0006t0001g0209 a0002c0006t0009g0157 a0002c0006t0014g0198 a0002c0006t0015g0173 a0002c0006t0060g0162 a0002c0010t0002g0071 a0002c0010t0021g0235 a0002c0014t0025g0082	8	396	0.0202	1	c.106 others(5): Show c.1066dupG	p.Glu others(5): Show p.Glu356fs	COLGALT1	ENSG00000130309.12	transcript	ENST00000252599.9	protein_coding	8/12	1132/3647	1067/1869	356/622	INFO_REALIGN_3_PRIME	chr19	TogoVar
COPS6_chr7_100083969_100097187	100090902	C C	CTTCCTGT others(9): Show CTTCCTGTCAGCGTTTT	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA19006.hp2 NA19006.hp2	a0002 a0002	a0002c0007 a0002c0007	a0002c0007t0002 a0002c0007t0002	a0002c0007t0002g0003 a0002c0007t0002g0003	1	422	0.0024	16	c.489 others(23): Show c.489_504dupTCCTGTCAGCGTTTTT	p.Glu others(5): Show p.Glu169fs	COPS6	ENSG00000168090.10	transcript	ENST00000303904.8	protein_coding	6/10	527/1404	505/984	169/327	INFO_REALIGN_3_PRIME	chr7	TogoVar
COQ6_chr14_73945302_73968670	73958272	TTGTTGGT others(9): Show TTGTTGGTAGTTGAAGA	T T	frameshift_variant others(3): Show frameshift_variant splice_donor_variant splice_region_variant intron_variant	HIGH	NA19075.hp2 NA19075.hp2	a0008 a0008	a0008c0010 a0008c0010	a0008c0010t0001 a0008c0010t0001	a0008c0010t0001g0073 a0008c0010t0001g0073	1	456	0.0022	-16	c.609 others(26): Show c.609_612+12delGTTGGTAGTTGAAGAT	p.Leu others(5): Show p.Leu204fs	COQ6	ENSG00000119723.17	transcript	ENST00000334571.7	protein_coding	5/12	640/2109	609/1407	203/468	INFO_REALIGN_3_PRIME	chr14	TogoVar
CORO1B_chr11_67430510_67448476	67439841	A A	AACCTGGG others(24): Show AACCTGGGGATGCAAGGAGGAGCCACGGGTGG	frameshift_variant others(1): Show frameshift_variant splice_region_variant	HIGH	HG02647.hp2 HG02647.hp2	a0007 a0007	a0007c0009 a0007c0009	a0007c0009t0004 a0007c0009t0004	a0007c0009t0004g0034 a0007c0009t0004g0034	1	354	0.0028	31	c.100 others(43): Show c.1008-29_1009dupCCACCCGTGGCTCCTCCTTGCATCCCCAGGT	p.Phe others(5): Show p.Phe337fs	CORO1B	ENSG00000172725.14	transcript	ENST00000341356.10	protein_coding	9/11	1084/4411	1009/1470	337/489		chr11	TogoVar
COX7B2_chr4_46729827_46914245	46734988	G G	GGGATAGG others(9): Show GGGATAGGTTCCATTCT	frameshift_variant frameshift_variant	HIGH	NA18972.hp2 NA18972.hp2	a0000 a0000	a0000c0002 a0000c0002	a0000c0002t0003 a0000c0002t0003	a0000c0002t0003g0233 a0000c0002t0003g0233	1	300	0.0033	16	c.189 others(23): Show c.189_204dupAGAATGGAACCTATCC	p.Pro others(4): Show p.Pro69fs	COX7B2	ENSG00000170516.17	transcript	ENST00000355591.8	protein_coding	3/3	394/556	204/246	68/81		chr4	TogoVar
COX8C_chr14_93342182_93353356	93347347	C C	CACGCAGG others(4): Show CACGCAGGAGAG	frameshift_variant frameshift_variant	HIGH	NA19043.hp1 NA19043.hp1	a0005 a0005	a0005c0004 a0005c0004	a0005c0004t0001 a0005c0004t0001	a0005c0004t0001g0013 a0005c0004t0001g0013	1	427	0.0023	11	c.79_ others(16): Show c.79_80insACGCAGGAGAG	p.Arg others(4): Show p.Arg27fs	COX8C	ENSG00000187581.3	transcript	ENST00000342144.3	protein_coding	1/2	167/542	80/219	27/72		chr14	TogoVar
CPNE1_chr20_35621044_35669900	35627312	C C	CA CA	frameshift_variant frameshift_variant	HIGH	HG00408.hp1 HG00597.hp2 HG00642.hp1 others(43): Show HG00408.hp1 HG00597.hp2 HG00642.hp1 HG00738.hp1 HG01069.hp2 HG01071.hp2 HG01109.hp2 HG01175.hp1 HG01192.hp1 HG01346.hp1 HG01433.hp1 HG01952.hp1 HG02004.hp2 HG02015.hp2 HG02040.hp1 HG02109.hp1 HG02145.hp1 HG02257.hp1 HG02258.hp2 HG02293.hp1 HG02717.hp1 HG03017.hp1 HG03139.hp2 HG03195.hp1 HG03490.hp2 HG04115.hp1 HG04228.hp2 NA18947.hp2 NA18950.hp1 NA18951.hp1 NA18953.hp2 NA18955.hp2 NA18959.hp1 NA18964.hp2 NA18972.hp1 NA18979.hp1 NA18988.hp2 NA19011.hp2 NA19055.hp1 NA19057.hp2 NA19058.hp2 NA19077.hp1 NA19090.hp2 NA20300.hp1 NA20752.hp1 NA20805.hp2	a0002 a0002	a0002c0002 a0002c0011 a0002c0002 a0002c0011	a0002c0002t0001 a0002c0011t0001 a0002c0002t0001 a0002c0011t0001	a0002c0002t0001g0017 a0002c0002t0001g0018 a0002c0002t0001g0079 others(41): Show a0002c0002t0001g0017 a0002c0002t0001g0018 a0002c0002t0001g0079 a0002c0002t0001g0080 a0002c0002t0001g0081 a0002c0002t0001g0082 a0002c0002t0001g0083 a0002c0002t0001g0084 a0002c0002t0001g0085 a0002c0002t0001g0086 a0002c0002t0001g0087 a0002c0002t0001g0088 a0002c0002t0001g0089 a0002c0002t0001g0090 a0002c0002t0001g0091 a0002c0002t0001g0092 a0002c0002t0001g0093 a0002c0002t0001g0094 a0002c0002t0001g0095 a0002c0002t0001g0096 a0002c0002t0001g0097 a0002c0002t0001g0098 a0002c0002t0001g0099 a0002c0002t0001g0100 a0002c0002t0001g0101 a0002c0002t0001g0102 a0002c0002t0001g0103 a0002c0002t0001g0104 a0002c0002t0001g0105 a0002c0002t0001g0106 a0002c0002t0001g0107 a0002c0002t0001g0108 a0002c0002t0001g0109 a0002c0002t0001g0110 a0002c0002t0001g0111 a0002c0002t0001g0112 a0002c0002t0001g0113 a0002c0002t0001g0114 a0002c0002t0001g0115 a0002c0002t0001g0118 a0002c0002t0001g0119 a0002c0002t0001g0120 a0002c0002t0001g0121 a0002c0011t0001g0078	46	272	0.1691	1	c.120 others(5): Show c.1203dupT	p.Ala others(5): Show p.Ala402fs	CPNE1	ENSG00000214078.13	transcript	ENST00000397443.7	protein_coding	14/16	1344/1952	1203/1614	401/537		chr20	TogoVar
CPNE3_chr8_86509435_86566498	86548378	TAATGAGT others(36): Show TAATGAGTATTTGACTGCTCTCTGGTCTGTGGGACTGGTCATTC	T T	frameshift_variant frameshift_variant	HIGH	HG00609.hp2 HG00609.hp2	a0009 a0009	a0009c0015 a0009c0015	a0009c0015t0001 a0009c0015t0001	a0009c0015t0001g0048 a0009c0015t0001g0048	1	340	0.0029	-43	c.960 others(51): Show c.960_1002delTGAGTATTTGACTGCTCTCTGGTCTGTGGGACTGGTC ATTCAA	p.Asn others(5): Show p.Asn320fs	CPNE3	ENSG00000085719.13	transcript	ENST00000517490.6	protein_coding	12/17	1115/4857	960/1614	320/537	INFO_REALIGN_3_PRIME	chr8	TogoVar
CPNE7_chr16_89570758_89602246	89585766	AGGCCTTT others(67): Show AGGCCTTTGAGGAGGGGCAGGTGAGCAGGACGGGGTAGGGGGTCCTCCAG GGAGGGTCAGGTGGGGGTGGAGGGG	A A	frameshift_variant others(3): Show frameshift_variant splice_donor_variant splice_region_variant intron_variant	HIGH	NA18747.hp2 NA18747.hp2	a0009 a0009	a0009c0019 a0009c0019	a0009c0019t0002 a0009c0019t0002	a0009c0019t0002g0253 a0009c0019t0002g0253	1	348	0.0029	-74	c.768 others(84): Show c.768_780+61delTGAGGAGGGGCAGGTGAGCAGGACGGGGTAGGGGG TCCTCCAGGGAGGGTCAGGTGGGGGTGGAGGGGGGCCTT	p.Phe others(5): Show p.Phe256fs	CPNE7	ENSG00000178773.15	transcript	ENST00000319518.13	protein_coding	7/15	908/2442	768/1677	256/558	INFO_REALIGN_3_PRIME	chr16	TogoVar
CPT1B_chr22_50563861_50583427	50571519	A A	ACTCTCGA others(16): Show ACTCTCGATGACCGCCTGGCACTG	frameshift_variant frameshift_variant	HIGH	NA19003.hp1 NA19003.hp1	a0010 a0010	a0010c0023 a0010c0023	a0010c0023t0001 a0010c0023t0001	a0010c0023t0001g0056 a0010c0023t0001g0056	1	414	0.0024	23	c.157 others(34): Show c.1576-3_1595dupCAGTGCCAGGCGGTCATCGAGAG	p.Tyr others(5): Show p.Tyr534fs	CPT1B	ENSG00000205560.13	transcript	ENST00000312108.12	protein_coding	14/20	1656/2603	1595/2319	532/772		chr22	TogoVar
CPT1C_chr19_49686116_49718731	49705086	A A	AC AC	frameshift_variant frameshift_variant	HIGH	HG00423.hp2 HG00544.hp2 HG00735.hp2 others(14): Show HG00423.hp2 HG00544.hp2 HG00735.hp2 HG00738.hp2 HG01099.hp2 HG01106.hp1 HG01175.hp2 HG01496.hp1 HG01928.hp1 HG02109.hp1 HG02109.hp2 HG02622.hp2 HG03927.hp2 NA18967.hp2 NA19062.hp1 NA19062.hp2 NA19082.hp1	a0002 a0003 a0002 a0003	a0002c0003 a0002c0005 a0003c0007 a0002c0003 a0002c0005 a0003c0007	a0002c0003t0001 a0002c0003t0002 a0002c0003t0003 others(3): Show a0002c0003t0001 a0002c0003t0002 a0002c0003t0003 a0002c0003t0004 a0002c0005t0002 a0003c0007t0002	a0002c0003t0001g0138 a0002c0003t0001g0142 a0002c0003t0001g0230 others(14): Show a0002c0003t0001g0138 a0002c0003t0001g0142 a0002c0003t0001g0230 a0002c0003t0001g0242 a0002c0003t0001g0245 a0002c0003t0001g0267 a0002c0003t0002g0051 a0002c0003t0002g0055 a0002c0003t0002g0067 a0002c0003t0002g0210 a0002c0003t0003g0089 a0002c0003t0003g0099 a0002c0003t0004g0311 a0002c0005t0002g0195 a0002c0005t0002g0200 a0002c0005t0002g0205 a0003c0007t0002g0208	17	350	0.0486	1	c.853 others(4): Show c.853dupC	p.Arg others(5): Show p.Arg285fs	CPT1C	ENSG00000169169.15	transcript	ENST00000598293.6	protein_coding	9/20	1162/2846	854/2412	285/803	INFO_REALIGN_3_PRIME	chr19	TogoVar
CRELD1_chr3_9928834_9950406	9940914	A A	AG AG	frameshift_variant frameshift_variant	HIGH	HG00673.hp1 HG01175.hp2 HG01255.hp1 others(7): Show HG00673.hp1 HG01175.hp2 HG01255.hp1 HG02257.hp1 HG03098.hp1 HG03516.hp1 HG03654.hp1 HG03927.hp1 NA18966.hp2 NA19006.hp1	a0002 a0002	a0002c0003 a0002c0003	a0002c0003t0001 a0002c0003t0001	a0002c0003t0001g0001 a0002c0003t0001g0003 a0002c0003t0001g0007 others(7): Show a0002c0003t0001g0001 a0002c0003t0001g0003 a0002c0003t0001g0007 a0002c0003t0001g0008 a0002c0003t0001g0012 a0002c0003t0001g0022 a0002c0003t0001g0050 a0002c0003t0001g0052 a0002c0003t0001g0154 a0002c0003t0001g0156	10	402	0.0249	1	c.530 others(4): Show c.530dupG	p.Ser others(5): Show p.Ser178fs	CRELD1	ENSG00000163703.20	transcript	ENST00000452070.6	protein_coding	6/11	637/2196	531/1263	177/420	INFO_REALIGN_3_PRIME	chr3	TogoVar
CRLF2_chrX_1185490_1217649	1190979	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0010 a0010	a0010c0033 a0010c0033	a0010c0033t0001 a0010c0033t0001	a0010c0033t0001g0131 a0010c0033t0001g0131	1	167	0.0060	-1	c.103 others(5): Show c.1033delC	p.His others(5): Show p.His345fs	CRLF2	ENSG00000205755.13	transcript	ENST00000400841.8	protein_coding	8/8	1048/1538	1033/1116	345/371		chrX	TogoVar
CRLF2_chrX_1185490_1217649	1191026	TG TG	T T	frameshift_variant frameshift_variant	HIGH	HG01981.hp2 HG01981.hp2	a0016 a0016	a0016c0030 a0016c0030	a0016c0030t0003 a0016c0030t0003	a0016c0030t0003g0126 a0016c0030t0003g0126	1	167	0.0060	-1	c.986 others(4): Show c.986delC	p.Pro others(5): Show p.Pro329fs	CRLF2	ENSG00000205755.13	transcript	ENST00000400841.8	protein_coding	8/8	1001/1538	986/1116	329/371		chrX	TogoVar
CRLF2_chrX_1185490_1217649	1191040	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19082.hp1 NA19082.hp1	a0014 a0014	a0014c0027 a0014c0027	a0014c0027t0007 a0014c0027t0007	a0014c0027t0007g0068 a0014c0027t0007g0068	1	167	0.0060	-1	c.972 others(4): Show c.972delC	p.Arg others(5): Show p.Arg325fs	CRLF2	ENSG00000205755.13	transcript	ENST00000400841.8	protein_coding	8/8	987/1538	972/1116	324/371		chrX	TogoVar
CRLF2_chrX_1185490_1217649	1191066	A A	AC AC	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0010 a0010	a0010c0033 a0010c0033	a0010c0033t0001 a0010c0033t0001	a0010c0033t0001g0131 a0010c0033t0001g0131	1	167	0.0060	1	c.946 others(8): Show c.946_947insG	p.Leu others(5): Show p.Leu316fs	CRLF2	ENSG00000205755.13	transcript	ENST00000400841.8	protein_coding	8/8	961/1538	946/1116	316/371		chrX	TogoVar
CRLF2_chrX_1185490_1217649	1191092	GC GC	G G	frameshift_variant frameshift_variant	HIGH	HG01981.hp2 HG01981.hp2	a0016 a0016	a0016c0030 a0016c0030	a0016c0030t0003 a0016c0030t0003	a0016c0030t0003g0126 a0016c0030t0003g0126	1	167	0.0060	-1	c.920 others(4): Show c.920delG	p.Gly others(5): Show p.Gly307fs	CRLF2	ENSG00000205755.13	transcript	ENST00000400841.8	protein_coding	8/8	935/1538	920/1116	307/371		chrX	TogoVar
CRLF2_chrX_1185490_1217649	1193280	TG TG	T T	frameshift_variant frameshift_variant	HIGH	HG02818.hp1 HG02818.hp1	a0018 a0018	a0018c0022 a0018c0022	a0018c0022t0001 a0018c0022t0001	a0018c0022t0001g0101 a0018c0022t0001g0101	1	167	0.0060	-1	c.789 others(4): Show c.789delC	p.Ser others(5): Show p.Ser264fs	CRLF2	ENSG00000205755.13	transcript	ENST00000400841.8	protein_coding	7/8	804/1538	789/1116	263/371		chrX	TogoVar
CRLF2_chrX_1185490_1217649	1198666	T T	TA TA	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0010 a0010	a0010c0033 a0010c0033	a0010c0033t0001 a0010c0033t0001	a0010c0033t0001g0131 a0010c0033t0001g0131	1	167	0.0060	1	c.541 others(4): Show c.541dupT	p.Tyr others(5): Show p.Tyr181fs	CRLF2	ENSG00000205755.13	transcript	ENST00000400841.8	protein_coding	5/8	556/1538	541/1116	181/371		chrX	TogoVar
CRLF2_chrX_1185490_1217649	1198710	A A	AT AT	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0010 a0010	a0010c0033 a0010c0033	a0010c0033t0001 a0010c0033t0001	a0010c0033t0001g0131 a0010c0033t0001g0131	1	167	0.0060	1	c.497 others(4): Show c.497dupA	p.Asn others(5): Show p.Asn166fs	CRLF2	ENSG00000205755.13	transcript	ENST00000400841.8	protein_coding	5/8	512/1538	497/1116	166/371		chrX	TogoVar
CRLF2_chrX_1185490_1217649	1202410	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0010 a0010	a0010c0033 a0010c0033	a0010c0033t0001 a0010c0033t0001	a0010c0033t0001g0131 a0010c0033t0001g0131	1	167	0.0060	1	c.474 others(4): Show c.474dupC	p.Glu others(5): Show p.Glu159fs	CRLF2	ENSG00000205755.13	transcript	ENST00000400841.8	protein_coding	4/8	489/1538	474/1116	158/371		chrX	TogoVar
CRLF2_chrX_1185490_1217649	1202419	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0010 a0010	a0010c0033 a0010c0033	a0010c0033t0001 a0010c0033t0001	a0010c0033t0001g0131 a0010c0033t0001g0131	1	167	0.0060	1	c.465 others(4): Show c.465dupC	p.Phe others(5): Show p.Phe156fs	CRLF2	ENSG00000205755.13	transcript	ENST00000400841.8	protein_coding	4/8	480/1538	465/1116	155/371		chrX	TogoVar
CRLF2_chrX_1185490_1217649	1202519	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0010 a0010	a0010c0033 a0010c0033	a0010c0033t0001 a0010c0033t0001	a0010c0033t0001g0131 a0010c0033t0001g0131	1	167	0.0060	1	c.365 others(4): Show c.365dupC	p.Lys others(5): Show p.Lys123fs	CRLF2	ENSG00000205755.13	transcript	ENST00000400841.8	protein_coding	4/8	380/1538	365/1116	122/371		chrX	TogoVar
CRLF2_chrX_1185490_1217649	1206461	G G	GA GA	frameshift_variant frameshift_variant	HIGH	NA19077.hp1 NA19077.hp1	a0011 a0011	a0011c0032 a0011c0032	a0011c0032t0001 a0011c0032t0001	a0011c0032t0001g0029 a0011c0032t0001g0029	1	167	0.0060	1	c.320 others(4): Show c.320dupT	p.Thr others(5): Show p.Thr108fs	CRLF2	ENSG00000205755.13	transcript	ENST00000400841.8	protein_coding	3/8	335/1538	320/1116	107/371		chrX	TogoVar
CRLF2_chrX_1185490_1217649	1208849	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0010 a0010	a0010c0033 a0010c0033	a0010c0033t0001 a0010c0033t0001	a0010c0033t0001g0131 a0010c0033t0001g0131	1	167	0.0060	1	c.138 others(4): Show c.138dupG	p.Asn others(4): Show p.Asn47fs	CRLF2	ENSG00000205755.13	transcript	ENST00000400841.8	protein_coding	2/8	153/1538	138/1116	46/371		chrX	TogoVar
CRLF2_chrX_1185490_1217649	1212557	T T	TG TG	frameshift_variant others(1): Show frameshift_variant splice_region_variant	HIGH	NA18980.hp2 NA18980.hp2	a0019 a0019	a0019c0034 a0019c0034	a0019c0034t0001 a0019c0034t0001	a0019c0034t0001g0134 a0019c0034t0001g0134	1	167	0.0060	1	c.77d others(3): Show c.77dupC	p.Ala others(4): Show p.Ala27fs	CRLF2	ENSG00000205755.13	transcript	ENST00000400841.8	protein_coding	1/8	92/1538	77/1116	26/371		chrX	TogoVar
CRLF2_chrX_1185490_1217649	1212558	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA18988.hp1 NA18988.hp1	a0020 a0020	a0020c0035 a0020c0035	a0020c0035t0001 a0020c0035t0001	a0020c0035t0001g0135 a0020c0035t0001g0135	1	167	0.0060	1	c.76d others(3): Show c.76dupG	p.Ala others(4): Show p.Ala26fs	CRLF2	ENSG00000205755.13	transcript	ENST00000400841.8	protein_coding	1/8	91/1538	76/1116	26/371		chrX	TogoVar
CRLF2_chrX_1185490_1217649	1212560	T T	TC TC	frameshift_variant frameshift_variant	HIGH	HG01071.hp1 HG01071.hp1	a0021 a0021	a0021c0036 a0021c0036	a0021c0036t0011 a0021c0036t0011	a0021c0036t0011g0167 a0021c0036t0011g0167	1	167	0.0060	1	c.74d others(3): Show c.74dupG	p.Ala others(4): Show p.Ala26fs	CRLF2	ENSG00000205755.13	transcript	ENST00000400841.8	protein_coding	1/8	89/1538	74/1116	25/371		chrX	TogoVar
CRLF2_chrX_1185490_1217649	1212568	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA18999.hp1 NA18999.hp1	a0009 a0009	a0009c0037 a0009c0037	a0009c0037t0001 a0009c0037t0001	a0009c0037t0001g0136 a0009c0037t0001g0136	1	167	0.0060	-1	c.66d others(3): Show c.66delG	p.Gln others(4): Show p.Gln23fs	CRLF2	ENSG00000205755.13	transcript	ENST00000400841.8	protein_coding	1/8	81/1538	66/1116	22/371		chrX	TogoVar
CRLF2_chrX_1185490_1217649	1212576	GC GC	G G	frameshift_variant frameshift_variant	HIGH	HG00558.hp1 HG00558.hp1	a0022 a0022	a0022c0020 a0022c0020	a0022c0020t0001 a0022c0020t0001	a0022c0020t0001g0004 a0022c0020t0001g0004	1	167	0.0060	-1	c.58d others(3): Show c.58delG	p.Ala others(4): Show p.Ala20fs	CRLF2	ENSG00000205755.13	transcript	ENST00000400841.8	protein_coding	1/8	73/1538	58/1116	20/371		chrX	TogoVar
CRLF2_chrX_1185490_1217649	1212608	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19000.hp2 NA19000.hp2	a0023 a0023	a0023c0046 a0023c0046	a0023c0046t0001 a0023c0046t0001	a0023c0046t0001g0164 a0023c0046t0001g0164	1	167	0.0060	1	c.26d others(3): Show c.26dupG	p.Ala others(4): Show p.Ala10fs	CRLF2	ENSG00000205755.13	transcript	ENST00000400841.8	protein_coding	1/8	41/1538	26/1116	9/371		chrX	TogoVar
CRLF2_chrX_1185490_1217649	1212615	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19058.hp1 NA19058.hp1	a0024 a0024	a0024c0019 a0024c0019	a0024c0019t0002 a0024c0019t0002	a0024c0019t0002g0003 a0024c0019t0002g0003	1	167	0.0060	1	c.19d others(3): Show c.19dupC	p.Leu others(3): Show p.Leu7fs	CRLF2	ENSG00000205755.13	transcript	ENST00000400841.8	protein_coding	1/8	34/1538	19/1116	7/371		chrX	TogoVar
CRLF2_chrX_1185490_1217649	1212628	G G	GC GC	frameshift_variant frameshift_variant	HIGH	HG03516.hp2 HG03516.hp2	a0007 a0007	a0007c0047 a0007c0047	a0007c0047t0003 a0007c0047t0003	a0007c0047t0003g0165 a0007c0047t0003g0165	1	167	0.0060	1	c.6du others(2): Show c.6dupG	p.Arg others(3): Show p.Arg3fs	CRLF2	ENSG00000205755.13	transcript	ENST00000400841.8	protein_coding	1/8	21/1538	6/1116	2/371		chrX	TogoVar
CRLF2_chrX_1185490_1217649	1212628	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA18959.hp2 NA18959.hp2	a0008 a0008	a0008c0017 a0008c0017	a0008c0017t0002 a0008c0017t0002	a0008c0017t0002g0001 a0008c0017t0002g0001	1	167	0.0060	-1	c.6de others(2): Show c.6delG	p.Arg others(3): Show p.Arg3fs	CRLF2	ENSG00000205755.13	transcript	ENST00000400841.8	protein_coding	1/8	21/1538	6/1116	2/371		chrX	TogoVar
CROCC2_chr2_240901336_240998311	240932891	C C	CG CG	frameshift_variant frameshift_variant	HIGH	HG00735.hp1 HG01952.hp1 HG02559.hp2 others(6): Show HG00735.hp1 HG01952.hp1 HG02559.hp2 HG02895.hp1 NA18967.hp1 NA19012.hp2 NA19082.hp1 NA19087.hp2 NA19240.hp2	a0011 a0021 a0022 a0011 a0021 a0022	a0011c0043 a0011c0044 a0011c0045 others(5): Show a0011c0043 a0011c0044 a0011c0045 a0011c0079 a0011c0080 a0021c0019 a0022c0038 a0022c0042	a0011c0043t0001 a0011c0044t0002 a0011c0045t0002 others(5): Show a0011c0043t0001 a0011c0044t0002 a0011c0045t0002 a0011c0079t0001 a0011c0080t0001 a0021c0019t0001 a0022c0038t0001 a0022c0042t0002	a0011c0043t0001g0171 a0011c0044t0002g0317 a0011c0045t0002g0320 others(6): Show a0011c0043t0001g0171 a0011c0044t0002g0317 a0011c0045t0002g0320 a0011c0079t0001g0018 a0011c0080t0001g0142 a0021c0019t0001g0220 a0021c0019t0001g0227 a0022c0038t0001g0050 a0022c0042t0002g0282	9	350	0.0257	1	c.123 others(5): Show c.1236dupG	p.Trp others(5): Show p.Trp413fs	CROCC2	ENSG00000226321.6	transcript	ENST00000690015.1	protein_coding	9/32	1415/5370	1237/4962	413/1653	INFO_REALIGN_3_PRIME	chr2	TogoVar
CRTC3_chr15_90524923_90650345	90638514	A A	AC AC	frameshift_variant frameshift_variant	HIGH	HG00438.hp1 HG00558.hp2 HG00735.hp1 others(28): Show HG00438.hp1 HG00558.hp2 HG00735.hp1 HG00735.hp2 HG00738.hp1 HG01099.hp2 HG01109.hp1 HG01192.hp1 HG01243.hp2 HG01255.hp2 HG02027.hp2 HG02055.hp2 HG02056.hp2 HG02080.hp2 HG02135.hp1 HG02258.hp2 HG02572.hp2 HG02602.hp2 HG02615.hp2 HG02630.hp1 HG02809.hp2 HG03098.hp1 HG03540.hp1 HG03831.hp2 NA18949.hp2 NA18954.hp1 NA19030.hp2 NA19077.hp2 NA19083.hp1 NA19083.hp2 NA19086.hp2	a0003 a0004 a0003 a0004	a0003c0003 a0003c0013 a0003c0014 others(1): Show a0003c0003 a0003c0013 a0003c0014 a0004c0005	a0003c0003t0001 a0003c0003t0002 a0003c0003t0003 others(10): Show a0003c0003t0001 a0003c0003t0002 a0003c0003t0003 a0003c0003t0009 a0003c0003t0027 a0003c0003t0036 a0003c0003t0039 a0003c0013t0005 a0003c0014t0030 a0004c0005t0001 a0004c0005t0003 a0004c0005t0026 a0004c0005t0045	a0003c0003t0001g0045 a0003c0003t0001g0060 a0003c0003t0001g0184 others(28): Show a0003c0003t0001g0045 a0003c0003t0001g0060 a0003c0003t0001g0184 a0003c0003t0001g0204 a0003c0003t0001g0210 a0003c0003t0001g0215 a0003c0003t0001g0217 a0003c0003t0001g0218 a0003c0003t0001g0220 a0003c0003t0001g0234 a0003c0003t0001g0243 a0003c0003t0001g0262 a0003c0003t0001g0266 a0003c0003t0002g0162 a0003c0003t0002g0242 a0003c0003t0003g0019 a0003c0003t0003g0145 a0003c0003t0003g0174 a0003c0003t0003g0247 a0003c0003t0003g0267 a0003c0003t0009g0032 a0003c0003t0027g0022 a0003c0003t0036g0031 a0003c0003t0039g0144 a0003c0013t0005g0014 a0003c0014t0030g0253 a0004c0005t0001g0084 a0004c0005t0001g0091 a0004c0005t0003g0086 a0004c0005t0026g0088 a0004c0005t0045g0132	31	276	0.1123	1	c.134 others(5): Show c.1340dupC	p.Tyr others(5): Show p.Tyr448fs	CRTC3	ENSG00000140577.17	transcript	ENST00000268184.11	protein_coding	12/15	1490/5214	1341/1860	447/619	INFO_REALIGN_3_PRIME	chr15	TogoVar
CRYAA_chr21_43164008_43177805	43172111	A A	AC AC	frameshift_variant frameshift_variant	HIGH	HG00673.hp2 HG00741.hp1 HG01978.hp2 others(1): Show HG00673.hp2 HG00741.hp1 HG01978.hp2 HG03579.hp2	a0000 a0000	a0000c0003 a0000c0004 a0000c0003 a0000c0004	a0000c0003t0001 a0000c0004t0001 a0000c0004t0007 a0000c0003t0001 a0000c0004t0001 a0000c0004t0007	a0000c0003t0001g0001 a0000c0003t0001g0005 a0000c0004t0001g0016 others(1): Show a0000c0003t0001g0001 a0000c0003t0001g0005 a0000c0004t0001g0016 a0000c0004t0007g0014	4	40	0.1000	1	c.355 others(4): Show c.355dupC	p.Arg others(5): Show p.Arg119fs	CRYAA	ENSG00000160202.7	transcript	ENST00000291554.6	protein_coding	3/3	448/1139	356/522	119/173	INFO_REALIGN_3_PRIME	chr21	TogoVar
CRYAA_chr21_43164008_43177805	43172123	C C	CCAACGTG others(16): Show CCAACGTGGACCAGTCGGCCCTCT	frameshift_variant frameshift_variant	HIGH	HG00609.hp2 HG00609.hp2	a0004 a0004	a0004c0005 a0004c0005	a0004c0005t0001 a0004c0005t0001	a0004c0005t0001g0003 a0004c0005t0001g0003	1	40	0.0250	23	c.367 others(30): Show c.367_389dupAACGTGGACCAGTCGGCCCTCTC	p.Cys others(5): Show p.Cys131fs	CRYAA	ENSG00000160202.7	transcript	ENST00000291554.6	protein_coding	3/3	482/1139	390/522	130/173	INFO_REALIGN_3_PRIME	chr21	TogoVar
CRYBB1_chr22_26594278_26623027	26616260	G G	GAAGGGGG others(7): Show GAAGGGGGCCCCACT	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0003 a0003	a0003c0002 a0003c0002	a0003c0002t0003 a0003c0002t0003	a0003c0002t0003g0171 a0003c0002t0003g0171	1	426	0.0024	14	c.59_ others(19): Show c.59_60insAGTGGGGCCCCCTT	p.Asp others(4): Show p.Asp20fs	CRYBB1	ENSG00000100122.7	transcript	ENST00000647684.1	protein_coding	2/6	129/1041	59/759	20/252		chr22	TogoVar
CSAG2_chrX_152703261_152714273	152708819	AG AG	A A	frameshift_variant frameshift_variant	HIGH	NA18962.hp1 NA18962.hp1	a0003 a0003	a0003c0009 a0003c0009	a0003c0009t0008 a0003c0009t0008	a0003c0009t0008g0023 a0003c0009t0008g0023	1	211	0.0047	-1	c.293 others(4): Show c.293delC	p.Pro others(4): Show p.Pro98fs	CSAG2	ENSG00000268902.4	transcript	ENST00000638741.2	protein_coding	1/2	454/855	293/384	98/127		chrX	TogoVar
CSAG2_chrX_152703261_152714273	152709011	AC AC	A A	frameshift_variant frameshift_variant	HIGH	NA19064.hp1 NA19064.hp1	a0007 a0007	a0007c0008 a0007c0008	a0007c0008t0001 a0007c0008t0001	a0007c0008t0001g0022 a0007c0008t0001g0022	1	211	0.0047	-1	c.101 others(4): Show c.101delG	p.Cys others(4): Show p.Cys34fs	CSAG2	ENSG00000268902.4	transcript	ENST00000638741.2	protein_coding	1/2	262/855	101/384	34/127		chrX	TogoVar
CSAG2_chrX_152703261_152714273	152709041	G G	GA GA	frameshift_variant frameshift_variant	HIGH	NA18962.hp1 NA18962.hp1	a0003 a0003	a0003c0009 a0003c0009	a0003c0009t0008 a0003c0009t0008	a0003c0009t0008g0023 a0003c0009t0008g0023	1	211	0.0047	1	c.71d others(3): Show c.71dupT	p.Tyr others(4): Show p.Tyr25fs	CSAG2	ENSG00000268902.4	transcript	ENST00000638741.2	protein_coding	1/2	232/855	71/384	24/127		chrX	TogoVar
CSE1L_chr20_49041312_49101949	49068771	GTTTTCTT others(19): Show GTTTTCTTCCCTGATCCTGATCTCAAA	G G	frameshift_variant frameshift_variant	HIGH	NA18956.hp1 NA18956.hp1	a0006 a0006	a0006c0004 a0006c0004	a0006c0004t0002 a0006c0004t0002	a0006c0004t0002g0046 a0006c0004t0002g0046	1	386	0.0026	-26	c.625 others(33): Show c.625_650delTTTTCTTCCCTGATCCTGATCTCAAA	p.Phe others(5): Show p.Phe209fs	CSE1L	ENSG00000124207.17	transcript	ENST00000262982.3	protein_coding	7/25	748/3550	625/2916	209/971		chr20	TogoVar
CSF1_chr1_109905849_109935992	109923714	A A	AC AC	frameshift_variant frameshift_variant	HIGH	HG00673.hp1 HG01106.hp1 HG01123.hp1 others(27): Show HG00673.hp1 HG01106.hp1 HG01123.hp1 HG02080.hp1 HG02486.hp1 HG02602.hp2 HG02717.hp1 HG02818.hp2 HG03098.hp2 HG03130.hp2 HG03471.hp1 HG03516.hp1 NA18522.hp1 NA18949.hp1 NA18963.hp2 NA18968.hp1 NA18974.hp1 NA18988.hp1 NA18992.hp2 NA18994.hp1 NA18994.hp2 NA19004.hp1 NA19010.hp1 NA19030.hp1 NA19030.hp2 NA19062.hp2 NA19063.hp2 NA19064.hp1 NA19066.hp1 NA20129.hp1	a0004 a0005 a0008 others(2): Show a0004 a0005 a0008 a0009 a0013	a0004c0007 a0004c0010 a0004c0013 others(6): Show a0004c0007 a0004c0010 a0004c0013 a0004c0020 a0004c0021 a0005c0008 a0008c0025 a0009c0024 a0013c0016	a0004c0007t0001 a0004c0007t0002 a0004c0007t0004 others(12): Show a0004c0007t0001 a0004c0007t0002 a0004c0007t0004 a0004c0010t0001 a0004c0010t0002 a0004c0010t0013 a0004c0013t0001 a0004c0013t0004 a0004c0020t0003 a0004c0021t0002 a0005c0008t0002 a0005c0008t0004 a0008c0025t0002 a0009c0024t0001 a0013c0016t0006	a0004c0007t0001g0015 a0004c0007t0002g0002 a0004c0007t0002g0005 others(25): Show a0004c0007t0001g0015 a0004c0007t0002g0002 a0004c0007t0002g0005 a0004c0007t0002g0011 a0004c0007t0002g0027 a0004c0007t0002g0086 a0004c0007t0002g0095 a0004c0007t0002g0096 a0004c0007t0002g0102 a0004c0007t0002g0103 a0004c0007t0004g0128 a0004c0010t0001g0008 a0004c0010t0001g0022 a0004c0010t0002g0079 a0004c0010t0013g0022 a0004c0013t0001g0111 a0004c0013t0004g0016 a0004c0020t0003g0009 a0004c0021t0002g0018 a0005c0008t0002g0003 a0005c0008t0002g0013 a0005c0008t0002g0050 a0005c0008t0002g0051 a0005c0008t0002g0099 a0005c0008t0004g0152 a0008c0025t0002g0148 a0009c0024t0001g0036 a0013c0016t0006g0014	30	434	0.0691	1	c.109 others(5): Show c.1095dupC	p.Ala others(5): Show p.Ala366fs	CSF1	ENSG00000184371.14	transcript	ENST00000329608.11	protein_coding	6/9	1271/3994	1096/1665	366/554	INFO_REALIGN_3_PRIME	chr1	TogoVar
CSF2RA_chrX_1263814_1314935	1282705	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19063.hp1 NA19063.hp1	a0006 a0006	a0006c0022 a0006c0022	a0006c0022t0004 a0006c0022t0004	a0006c0022t0004g0073 a0006c0022t0004g0073	1	159	0.0063	1	c.3du others(2): Show c.3dupG	p.Leu others(3): Show p.Leu2fs	CSF2RA	ENSG00000198223.18	transcript	ENST00000381529.9	protein_coding	3/13	160/1815	4/1203	2/400	INFO_REALIGN_3_PRIME	chrX	TogoVar
CSF2RA_chrX_1263814_1314935	1282747	AC AC	A A	frameshift_variant frameshift_variant	HIGH	NA19062.hp1 NA19063.hp1 NA19062.hp1 NA19063.hp1	a0006 a0012 a0006 a0012	a0006c0022 a0012c0011 a0006c0022 a0012c0011	a0006c0022t0004 a0012c0011t0010 a0006c0022t0004 a0012c0011t0010	a0006c0022t0004g0073 a0012c0011t0010g0054 a0006c0022t0004g0073 a0012c0011t0010g0054	2	159	0.0126	-1	c.47d others(3): Show c.47delC	p.Pro others(4): Show p.Pro16fs	CSF2RA	ENSG00000198223.18	transcript	ENST00000381529.9	protein_coding	3/13	203/1815	47/1203	16/400	INFO_REALIGN_3_PRIME	chrX	TogoVar
CSF2RA_chrX_1263814_1314935	1282750	CA CA	C C	frameshift_variant frameshift_variant	HIGH	NA19010.hp2 NA19010.hp2	a0011 a0011	a0011c0021 a0011c0021	a0011c0021t0004 a0011c0021t0004	a0011c0021t0004g0074 a0011c0021t0004g0074	1	159	0.0063	-1	c.48d others(3): Show c.48delA	p.Ala others(4): Show p.Ala17fs	CSF2RA	ENSG00000198223.18	transcript	ENST00000381529.9	protein_coding	3/13	204/1815	48/1203	16/400		chrX	TogoVar
CSF2RA_chrX_1263814_1314935	1282778	G G	GA GA	frameshift_variant others(1): Show frameshift_variant splice_region_variant	HIGH	NA19087.hp2 NA19087.hp2	a0010 a0010	a0010c0012 a0010c0012	a0010c0012t0004 a0010c0012t0004	a0010c0012t0004g0089 a0010c0012t0004g0089	1	159	0.0063	1	c.75_ others(6): Show c.75_76insA	p.Asp others(4): Show p.Asp26fs	CSF2RA	ENSG00000198223.18	transcript	ENST00000381529.9	protein_coding	3/13	232/1815	76/1203	26/400		chrX	TogoVar
CSF2RA_chrX_1263814_1314935	1285822	G G	GA GA	frameshift_variant frameshift_variant	HIGH	HG01169.hp1 HG01169.hp1	a0009 a0009	a0009c0013 a0009c0013	a0009c0013t0003 a0009c0013t0003	a0009c0013t0003g0153 a0009c0013t0003g0153	1	159	0.0063	1	c.122 others(4): Show c.122dupA	p.Asp others(4): Show p.Asp41fs	CSF2RA	ENSG00000198223.18	transcript	ENST00000381529.9	protein_coding	4/13	279/1815	123/1203	41/400	INFO_REALIGN_3_PRIME	chrX	TogoVar

Search by Variant

Search

Search Results (Total: 5828 hits)