Joint Open Genome and Omics Platform (JoGo)

Search by Variant

Regionname

e.g. ALDH2_chr12_111761933_111822532, HBB_chr11_5220464_5232071.

Chr

Chromosome name (e.g., chr11).

Snpeff genename

Exact SnpEff gene name.

Sampleids

Target sampleid (e.g. HG02615).

Snpeff haplotype class

Haplotype-annotation class (e.g., ahapid, ahapid+chapid).

Snpeff annotation impact

Exact impact level (e.g., HIGH, MODERATE, LOW).

Snpeff annotation impact detail

Keyword match in SnpEff annotation.

Hapid

One or more haplotype IDs (comma-separated; e.g., a0001, a01, a0001c0001, a01c02, a1c2, a0001c0001t0005, a0001c0001t0005g0018).

Samplehapid

Sample haplotype IDs to include (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

No_hapid

Haplotype IDs to exclude (comma-separated; e.g., a0001, a0002, a0001c0001, a0001c0001t0005, a1, a01).

No_samplehapid

Sample haplotype IDs to exclude (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

Start

Start position (GRCh38).

End

End position (GRCh38).

Minac

Minimum alternate allele count (≥).

Maxac

Maximum alternate allele count (≤).

Minlen

Minimum variant length (≥).

Maxlen

Maximum variant length (≤).

Sort By

Select column to sort.

Order by

Ascending or descending.

Show

Results per page.

regionname	pos	ref	alt	annotation	impact	samples	ahapids	achapids	acthapids	actghapids	ac	an	af	len	hgvs_c	hgvs_p	genename	geneid	featuretype	featureid	transcript_biotype	rank	cdna cdna pos length	cds cds pos length	aa aa pos length	status	chr	external
FXR2_chr17_7586230_7619897	7614454	T T	A A	stop_gained others(1): Show stop_gained splice_region_variant	HIGH	NA18906.hp1 NA18906.hp1	a0002 a0002	a0002c0007 a0002c0007	a0002c0007t0002 a0002c0007t0002	a0002c0007t0002g0058 a0002c0007t0002g0058	1	426	0.0024	0	c.79A others(2): Show c.79A>T	p.Lys others(3): Show p.Lys27*	FXR2	ENSG00000129245.13	transcript	ENST00000250113.12	protein_coding	1/17	444/2987	79/2022	27/673		chr17	TogoVar
FZD3_chr8_28489212_28579258	28562904	C C	T T	stop_gained stop_gained	HIGH	HG02523.hp2 HG02523.hp2	a0002 a0002	a0002c0007 a0002c0007	a0002c0007t0092 a0002c0007t0092	a0002c0007t0092g0160 a0002c0007t0092g0160	1	328	0.0031	0	c.189 others(4): Show c.1894C>T	p.Gln others(4): Show p.Gln632*	FZD3	ENSG00000104290.11	transcript	ENST00000240093.8	protein_coding	8/8	2416/13770	1894/2001	632/666		chr8	TogoVar
FZD7_chr2_202028855_202043441	202035079	G G	GGGCCCCC others(29): Show GGGCCCCCGGGGGGGCAGGGGACCCCCTGACTAGCGC	stop_gained others(1): Show stop_gained conservative_inframe_insertion	HIGH	HG03704.hp1 HG03704.hp1	a0003 a0003	a0003c0009 a0003c0009	a0003c0009t0001 a0003c0009t0001	a0003c0009t0001g0000 a0003c0009t0001g0000	1	420	0.0024	36	c.432 others(43): Show c.432_433insGGCCCCCGGGGGGGCAGGGGACCCCCTGACTAGCGC	p.Glu others(49): Show p.Glu144_Arg145insGlyProArgGlyGlyArgGlyProProAspTe rArg	FZD7	ENSG00000155760.3	transcript	ENST00000286201.3	protein_coding	1/1	1226/4587	433/1725	145/574		chr2	TogoVar
GAB4_chr22_16956936_17013222	16988159	C C	A A	stop_gained stop_gained	HIGH	HG00280.hp1 HG00544.hp2 HG00558.hp2 others(145): Show HG00280.hp1 HG00544.hp2 HG00558.hp2 HG00621.hp1 HG00741.hp2 HG01069.hp1 HG01071.hp1 HG01074.hp1 HG01081.hp1 HG01106.hp1 HG01167.hp2 HG01168.hp2 HG01255.hp2 HG01256.hp1 HG01257.hp2 HG01258.hp2 HG01261.hp2 HG01346.hp2 HG01358.hp1 HG01496.hp1 HG01496.hp2 HG01891.hp1 HG01928.hp1 HG01928.hp2 HG01934.hp2 HG01943.hp2 HG01952.hp1 HG01975.hp2 HG01981.hp1 HG01981.hp2 HG01993.hp1 HG01993.hp2 HG02004.hp1 HG02004.hp2 HG02015.hp1 HG02015.hp2 HG02027.hp2 HG02040.hp2 HG02056.hp1 HG02080.hp1 HG02083.hp1 HG02129.hp2 HG02132.hp2 HG02135.hp1 HG02145.hp2 HG02257.hp2 HG02258.hp1 HG02300.hp1 HG02300.hp2 HG02451.hp1 HG02486.hp1 HG02486.hp2 HG02572.hp1 HG02602.hp2 HG02683.hp2 HG02698.hp1 HG02717.hp1 HG02723.hp2 HG02738.hp1 HG03098.hp1 HG03139.hp1 HG03239.hp1 HG03471.hp2 HG03491.hp1 HG03516.hp1 HG03516.hp2 HG03654.hp1 HG03688.hp1 HG03688.hp2 HG03704.hp2 HG03710.hp2 HG03831.hp1 HG03831.hp2 HG03834.hp2 HG03927.hp1 HG03927.hp2 HG03942.hp2 HG04184.hp2 HG04199.hp1 HG04204.hp2 HG04228.hp2 HG06807.hp1 NA18522.hp1 NA18939.hp2 NA18941.hp1 NA18943.hp1 NA18945.hp2 NA18946.hp1 NA18947.hp2 NA18950.hp2 NA18952.hp1 NA18953.hp2 NA18956.hp2 NA18957.hp1 NA18959.hp1 NA18959.hp2 NA18960.hp1 NA18962.hp1 NA18965.hp1 NA18967.hp2 NA18968.hp1 NA18969.hp2 NA18970.hp1 NA18973.hp1 NA18973.hp2 NA18975.hp2 NA18978.hp1 NA18980.hp1 NA18981.hp1 NA18983.hp1 NA18983.hp2 NA18984.hp1 NA18986.hp2 NA18988.hp2 NA18993.hp2 NA18995.hp2 NA18997.hp1 NA18999.hp2 NA19000.hp2 NA19002.hp1 NA19003.hp2 NA19004.hp1 NA19004.hp2 NA19007.hp1 NA19010.hp1 NA19011.hp1 NA19012.hp1 NA19054.hp2 NA19055.hp1 NA19057.hp1 NA19060.hp2 NA19063.hp1 NA19064.hp2 NA19065.hp1 NA19066.hp2 NA19068.hp1 NA19070.hp1 NA19074.hp2 NA19076.hp2 NA19078.hp2 NA19081.hp2 NA19082.hp1 NA19082.hp2 NA19088.hp1 NA19090.hp1 NA20752.hp1 NA21309.hp1 homoSapiens_chm13v2.hp1	a0002 a0005 a0002 a0005	a0002c0002 a0002c0008 a0002c0013 others(5): Show a0002c0002 a0002c0008 a0002c0013 a0002c0014 a0002c0017 a0002c0021 a0002c0022 a0005c0011	a0002c0002t0001 a0002c0002t0002 a0002c0002t0004 others(9): Show a0002c0002t0001 a0002c0002t0002 a0002c0002t0004 a0002c0002t0007 a0002c0008t0001 a0002c0013t0005 a0002c0014t0001 a0002c0014t0003 a0002c0017t0001 a0002c0021t0001 a0002c0022t0001 a0005c0011t0001	a0002c0002t0001g0002 a0002c0002t0001g0005 a0002c0002t0001g0007 others(74): Show a0002c0002t0001g0002 a0002c0002t0001g0005 a0002c0002t0001g0007 a0002c0002t0001g0008 a0002c0002t0001g0009 a0002c0002t0001g0010 a0002c0002t0001g0011 a0002c0002t0001g0019 a0002c0002t0001g0020 a0002c0002t0001g0021 a0002c0002t0001g0037 a0002c0002t0001g0038 a0002c0002t0001g0039 a0002c0002t0001g0041 a0002c0002t0001g0058 a0002c0002t0001g0060 a0002c0002t0001g0061 a0002c0002t0001g0062 a0002c0002t0001g0063 a0002c0002t0001g0064 a0002c0002t0001g0066 a0002c0002t0001g0068 a0002c0002t0001g0080 a0002c0002t0001g0081 a0002c0002t0001g0082 a0002c0002t0001g0083 a0002c0002t0001g0086 a0002c0002t0001g0157 a0002c0002t0001g0160 a0002c0002t0001g0161 a0002c0002t0001g0162 a0002c0002t0001g0163 a0002c0002t0001g0164 a0002c0002t0001g0165 a0002c0002t0001g0168 a0002c0002t0001g0169 a0002c0002t0001g0171 a0002c0002t0001g0172 a0002c0002t0001g0173 a0002c0002t0001g0174 a0002c0002t0001g0177 a0002c0002t0001g0179 a0002c0002t0001g0180 a0002c0002t0001g0181 a0002c0002t0001g0182 a0002c0002t0001g0184 a0002c0002t0001g0185 a0002c0002t0001g0186 a0002c0002t0001g0187 a0002c0002t0001g0188 a0002c0002t0001g0189 a0002c0002t0001g0190 a0002c0002t0001g0191 a0002c0002t0001g0192 a0002c0002t0001g0193 a0002c0002t0001g0209 a0002c0002t0002g0170 a0002c0002t0002g0175 a0002c0002t0004g0155 a0002c0002t0004g0156 a0002c0002t0004g0158 a0002c0002t0004g0183 a0002c0002t0004g0201 a0002c0002t0007g0040 a0002c0002t0007g0065 a0002c0002t0007g0167 a0002c0008t0001g0045 a0002c0008t0001g0084 a0002c0008t0001g0085 a0002c0013t0005g0067 a0002c0014t0001g0159 a0002c0014t0003g0166 a0002c0017t0001g0076 a0002c0021t0001g0176 a0002c0022t0001g0178 a0005c0011t0001g0077 a0005c0011t0001g0078	148	430	0.3442	0	c.487 others(3): Show c.487G>T	p.Gly others(4): Show p.Gly163*	GAB4	ENSG00000215568.9	transcript	ENST00000400588.5	protein_coding	3/10	595/2630	487/1725	163/574		chr22	TogoVar
GABPB2_chr1_151065761_151130542	151118095	C C	T T	stop_gained stop_gained	HIGH	NA18980.hp1 NA18980.hp1	a0007 a0007	a0007c0010 a0007c0010	a0007c0010t0001 a0007c0010t0001	a0007c0010t0001g0247 a0007c0010t0001g0247	1	264	0.0038	0	c.118 others(4): Show c.1186C>T	p.Gln others(4): Show p.Gln396*	GABPB2	ENSG00000143458.12	transcript	ENST00000368918.8	protein_coding	9/9	1360/8807	1186/1347	396/448		chr1	TogoVar
GABRR3_chr3_97980102_98040315	98007903	A A	T T	stop_gained others(1): Show stop_gained splice_region_variant	HIGH	HG00280.hp2 HG00323.hp2 HG00642.hp1 others(43): Show HG00280.hp2 HG00323.hp2 HG00642.hp1 HG00642.hp2 HG00735.hp1 HG00738.hp2 HG01069.hp1 HG01071.hp1 HG01081.hp1 HG01109.hp2 HG01192.hp1 HG01256.hp2 HG01257.hp1 HG01346.hp2 HG01433.hp1 HG01516.hp2 HG01943.hp2 HG01952.hp1 HG02165.hp2 HG02257.hp2 HG02258.hp2 HG02280.hp1 HG02451.hp1 HG02717.hp2 HG02723.hp2 HG02809.hp1 HG02886.hp2 HG02895.hp1 HG02897.hp2 HG02965.hp2 HG02970.hp2 HG03041.hp2 HG03209.hp2 HG03225.hp1 HG03239.hp1 HG03239.hp2 HG03669.hp1 HG03704.hp2 HG03710.hp2 NA18906.hp2 NA18942.hp1 NA19030.hp1 NA19043.hp2 NA19240.hp1 NA20752.hp2 NA21309.hp1	a0002 a0002	a0002c0002 a0002c0007 a0002c0002 a0002c0007	a0002c0002t0001 a0002c0002t0002 a0002c0002t0003 others(10): Show a0002c0002t0001 a0002c0002t0002 a0002c0002t0003 a0002c0002t0006 a0002c0002t0007 a0002c0002t0008 a0002c0002t0013 a0002c0002t0014 a0002c0002t0015 a0002c0002t0018 a0002c0002t0020 a0002c0002t0026 a0002c0007t0002	a0002c0002t0001g0271 a0002c0002t0002g0002 a0002c0002t0002g0004 others(40): Show a0002c0002t0001g0271 a0002c0002t0002g0002 a0002c0002t0002g0004 a0002c0002t0002g0034 a0002c0002t0002g0036 a0002c0002t0002g0038 a0002c0002t0002g0042 a0002c0002t0002g0045 a0002c0002t0002g0047 a0002c0002t0002g0049 a0002c0002t0002g0050 a0002c0002t0002g0052 a0002c0002t0002g0053 a0002c0002t0002g0055 a0002c0002t0002g0056 a0002c0002t0002g0058 a0002c0002t0002g0062 a0002c0002t0002g0064 a0002c0002t0002g0066 a0002c0002t0003g0029 a0002c0002t0003g0044 a0002c0002t0003g0051 a0002c0002t0003g0057 a0002c0002t0003g0060 a0002c0002t0003g0166 a0002c0002t0006g0039 a0002c0002t0006g0059 a0002c0002t0007g0033 a0002c0002t0007g0035 a0002c0002t0007g0168 a0002c0002t0008g0226 a0002c0002t0008g0269 a0002c0002t0008g0272 a0002c0002t0008g0273 a0002c0002t0013g0037 a0002c0002t0013g0167 a0002c0002t0014g0046 a0002c0002t0014g0054 a0002c0002t0015g0330 a0002c0002t0018g0021 a0002c0002t0020g0061 a0002c0002t0026g0341 a0002c0007t0002g0065	46	382	0.1204	0	c.615 others(3): Show c.615T>A	p.Tyr others(4): Show p.Tyr205*	GABRR3	ENSG00000183185.10	transcript	ENST00000472788.6	protein_coding	7/10	743/3113	615/1404	205/467		chr3	TogoVar
GAGE12F_chrX_49555842_49573205	49565545	T T	TA TA	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA18978.hp2 NA18978.hp2	a0013 a0013	a0013c0012 a0013c0012	a0013c0012t0001 a0013c0012t0001	a0013c0012t0001g0088 a0013c0012t0001g0088	1	99	0.0101	1	c.256 others(8): Show c.256_257insA	p.Cys others(4): Show p.Cys86fs	GAGE12F	ENSG00000236362.9	transcript	ENST00000440137.2	protein_coding	4/5	373/561	257/354	86/117		chrX	TogoVar
GAGE1_chrX_49594020_49613538	49600742	G G	T T	stop_gained stop_gained	HIGH	HG02280.hp1 HG02280.hp1	a0007 a0007	a0007c0012 a0007c0012	a0007c0012t0001 a0007c0012t0001	a0007c0012t0001g0081 a0007c0012t0001g0081	1	311	0.0032	0	c.103 others(3): Show c.103G>T	p.Glu others(3): Show p.Glu35*	GAGE1	ENSG00000205777.19	transcript	ENST00000381700.11	protein_coding	3/5	219/2993	103/354	35/117		chrX	TogoVar
GAGE1_chrX_49594020_49613538	49600811	G G	T T	stop_gained stop_gained	HIGH	NA19030.hp1 NA19030.hp1	a0008 a0008	a0008c0010 a0008c0010	a0008c0010t0001 a0008c0010t0001	a0008c0010t0001g0080 a0008c0010t0001g0080	1	311	0.0032	0	c.172 others(3): Show c.172G>T	p.Glu others(3): Show p.Glu58*	GAGE1	ENSG00000205777.19	transcript	ENST00000381700.11	protein_coding	3/5	288/2993	172/354	58/117		chrX	TogoVar
GAL3ST3_chr11_66035765_66054161	66043233	G G	T T	stop_gained stop_gained	HIGH	HG02622.hp2 HG02622.hp2	a0009 a0009	a0009c0021 a0009c0021	a0009c0021t0001 a0009c0021t0001	a0009c0021t0001g0075 a0009c0021t0001g0075	1	394	0.0025	0	c.570 others(3): Show c.570C>A	p.Tyr others(4): Show p.Tyr190*	GAL3ST3	ENSG00000175229.7	transcript	ENST00000312006.5	protein_coding	3/3	833/3301	570/1296	190/431		chr11	TogoVar
GAL3ST4_chr7_100154244_100173617	100160311	G G	A A	stop_gained stop_gained	HIGH	HG03486.hp1 HG03486.hp1	a0009 a0009	a0009c0012 a0009c0012	a0009c0012t0003 a0009c0012t0003	a0009c0012t0003g0155 a0009c0012t0003g0155	1	402	0.0025	0	c.107 others(4): Show c.1078C>T	p.Arg others(4): Show p.Arg360*	GAL3ST4	ENSG00000197093.11	transcript	ENST00000360039.9	protein_coding	4/4	1338/2405	1078/1461	360/486		chr7	TogoVar
GAL3ST4_chr7_100154244_100173617	100160522	C C	T T	stop_gained stop_gained	HIGH	HG02818.hp1 NA20300.hp2 HG02818.hp1 NA20300.hp2	a0007 a0007	a0007c0009 a0007c0009	a0007c0009t0001 a0007c0009t0001	a0007c0009t0001g0064 a0007c0009t0001g0081 a0007c0009t0001g0064 a0007c0009t0001g0081	2	402	0.0050	0	c.867 others(3): Show c.867G>A	p.Trp others(4): Show p.Trp289*	GAL3ST4	ENSG00000197093.11	transcript	ENST00000360039.9	protein_coding	4/4	1127/2405	867/1461	289/486		chr7	TogoVar
GALNT2_chr1_230062238_230287122	230265281	C C	T T	stop_gained stop_gained	HIGH	HG01358.hp2 HG01358.hp2	a0004 a0004	a0004c0013 a0004c0013	a0004c0013t0047 a0004c0013t0047	a0004c0013t0047g0006 a0004c0013t0047g0006	1	324	0.0031	0	c.135 others(4): Show c.1354C>T	p.Gln others(4): Show p.Gln452*	GALNT2	ENSG00000143641.10	transcript	ENST00000366672.5	protein_coding	14/16	1397/4423	1354/1716	452/571		chr1	TogoVar
GALNT8_chr12_4715400_4777726	4761075	C C	T T	stop_gained stop_gained	HIGH	HG02056.hp2 HG02056.hp2	a0017 a0017	a0017c0026 a0017c0026	a0017c0026t0001 a0017c0026t0001	a0017c0026t0001g0078 a0017c0026t0001g0078	1	338	0.0030	0	c.129 others(4): Show c.1291C>T	p.Arg others(4): Show p.Arg431*	GALNT8	ENSG00000130035.9	transcript	ENST00000252318.7	protein_coding	7/11	1569/2321	1291/1914	431/637		chr12	TogoVar
GBGT1_chr9_133147948_133168914	133154258	G G	T T	stop_gained stop_gained	HIGH	HG01243.hp2 HG01261.hp2 HG01884.hp2 others(5): Show HG01243.hp2 HG01261.hp2 HG01884.hp2 HG02976.hp2 HG03486.hp2 NA20300.hp2 NA20805.hp2 NA21309.hp2	a0004 a0010 a0018 others(1): Show a0004 a0010 a0018 a0028	a0004c0008 a0004c0026 a0010c0032 others(2): Show a0004c0008 a0004c0026 a0010c0032 a0018c0018 a0028c0029	a0004c0008t0001 a0004c0008t0002 a0004c0008t0009 others(4): Show a0004c0008t0001 a0004c0008t0002 a0004c0008t0009 a0004c0026t0001 a0010c0032t0002 a0018c0018t0001 a0028c0029t0001	a0004c0008t0001g0063 a0004c0008t0001g0192 a0004c0008t0002g0183 others(5): Show a0004c0008t0001g0063 a0004c0008t0001g0192 a0004c0008t0002g0183 a0004c0008t0009g0196 a0004c0026t0001g0094 a0010c0032t0002g0180 a0018c0018t0001g0195 a0028c0029t0001g0062	8	446	0.0179	0	c.363 others(3): Show c.363C>A	p.Tyr others(4): Show p.Tyr121*	GBGT1	ENSG00000148288.13	transcript	ENST00000372040.9	protein_coding	7/7	644/1954	363/1044	121/347		chr9	TogoVar
GBP1_chr1_89047319_89070208	89059015	G G	A A	stop_gained stop_gained	HIGH	NA18973.hp2 NA18973.hp2	a0011 a0011	a0011c0016 a0011c0016	a0011c0016t0001 a0011c0016t0001	a0011c0016t0001g0143 a0011c0016t0001g0143	1	430	0.0023	0	c.457 others(3): Show c.457C>T	p.Arg others(4): Show p.Arg153*	GBP1	ENSG00000117228.11	transcript	ENST00000370473.5	protein_coding	5/11	525/2883	457/1779	153/592		chr1	TogoVar
GCKR_chr2_27491839_27528684	27503548	C C	T T	stop_gained stop_gained	HIGH	HG02523.hp2 HG02523.hp2	a0009 a0009	a0009c0018 a0009c0018	a0009c0018t0001 a0009c0018t0001	a0009c0018t0001g0182 a0009c0018t0001g0182	1	324	0.0031	0	c.679 others(3): Show c.679C>T	p.Arg others(4): Show p.Arg227*	GCKR	ENSG00000084734.9	transcript	ENST00000264717.7	protein_coding	9/19	745/2189	679/1878	227/625		chr2	TogoVar
GCKR_chr2_27491839_27528684	27522505	C C	T T	stop_gained stop_gained	HIGH	HG01358.hp1 HG01358.hp1	a0010 a0010	a0010c0017 a0010c0017	a0010c0017t0001 a0010c0017t0001	a0010c0017t0001g0221 a0010c0017t0001g0221	1	324	0.0031	0	c.161 others(4): Show c.1618C>T	p.Arg others(4): Show p.Arg540*	GCKR	ENSG00000084734.9	transcript	ENST00000264717.7	protein_coding	18/19	1684/2189	1618/1878	540/625		chr2	TogoVar
GCNT3_chr15_59606783_59627723	59618450	C C	G G	stop_gained stop_gained	HIGH	homoSapiens_chm13v2.hp1 homoSapiens_chm13v2.hp1	a0003 a0003	a0003c0014 a0003c0014	a0003c0014t0002 a0003c0014t0002	a0003c0014t0002g0001 a0003c0014t0002g0001	1	428	0.0023	0	c.212 others(3): Show c.212C>G	p.Ser others(3): Show p.Ser71*	GCNT3	ENSG00000140297.13	transcript	ENST00000396065.3	protein_coding	3/3	661/4934	212/1317	71/438		chr15	TogoVar
GDI1_chrX_154432154_154448467	154440127	A A	AAC AAC	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA19006.hp1 NA19006.hp1	a0005 a0005	a0005c0008 a0005c0008	a0005c0008t0005 a0005c0008t0005	a0005c0008t0005g0024 a0005c0008t0005g0024	1	283	0.0035	2	c.575 others(9): Show c.575_576insAC	p.Tyr others(5): Show p.Tyr192fs	GDI1	ENSG00000203879.12	transcript	ENST00000447750.7	protein_coding	5/11	677/2240	576/1344	192/447		chrX	TogoVar
GDI1_chrX_154432154_154448467	154442194	A A	ACCACGGA others(21): Show ACCACGGACCCTGAAAAGGAGGTGGGAGC	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA19006.hp1 NA19006.hp1	a0005 a0005	a0005c0008 a0005c0008	a0005c0008t0005 a0005c0008t0005	a0005c0008t0005g0024 a0005c0008t0005g0024	1	283	0.0035	28	c.109 others(37): Show c.1099_1100insGAGCCCACGGACCCTGAAAAGGAGGTGG	p.Glu others(5): Show p.Glu367fs	GDI1	ENSG00000203879.12	transcript	ENST00000447750.7	protein_coding	9/11	1201/2240	1100/1344	367/447	INFO_REALIGN_3_PRIME	chrX	TogoVar
GGTLC3_chr22_18511344_18523161	18517489	G G	T T	stop_gained others(1): Show stop_gained splice_region_variant	HIGH	HG02738.hp2 HG02738.hp2	a0004 a0004	a0004c0006 a0004c0006	a0004c0006t0003 a0004c0006t0003	a0004c0006t0003g0006 a0004c0006t0003g0006	1	34	0.0294	0	c.177 others(3): Show c.177C>A	p.Tyr others(3): Show p.Tyr59*	GGTLC3	ENSG00000274252.1	transcript	ENST00000619998.1	protein_coding	3/6	310/968	177/678	59/225		chr22	TogoVar
GHDC_chr17_42184087_42199494	42189819	G G	A A	stop_gained stop_gained	HIGH	HG01123.hp1 HG01123.hp1	a0007 a0007	a0007c0009 a0007c0009	a0007c0009t0001 a0007c0009t0001	a0007c0009t0001g0034 a0007c0009t0001g0034	1	374	0.0027	0	c.147 others(4): Show c.1477C>T	p.Arg others(4): Show p.Arg493*	GHDC	ENSG00000167925.17	transcript	ENST00000587427.6	protein_coding	10/10	1676/2408	1477/1593	493/530		chr17	TogoVar
GINS4_chr8_41524261_41550030	41541856	C C	T T	stop_gained stop_gained	HIGH	HG02129.hp1 HG02129.hp1	a0003 a0003	a0003c0004 a0003c0004	a0003c0004t0006 a0003c0004t0006	a0003c0004t0006g0007 a0003c0004t0006g0007	1	426	0.0024	0	c.532 others(3): Show c.532C>T	p.Arg others(4): Show p.Arg178*	GINS4	ENSG00000147536.12	transcript	ENST00000276533.4	protein_coding	7/8	687/3770	532/672	178/223		chr8	TogoVar
GJA10_chr6_89889469_89901120	89895945	C C	T T	stop_gained stop_gained	HIGH	HG01257.hp2 HG02293.hp2 HG01257.hp2 HG02293.hp2	a0003 a0003	a0003c0003 a0003c0003	a0003c0003t0002 a0003c0003t0002	a0003c0003t0002g0000 a0003c0003t0002g0000	2	386	0.0052	0	c.147 others(4): Show c.1477C>T	p.Gln others(4): Show p.Gln493*	GJA10	ENSG00000135355.4	transcript	ENST00000369352.1	protein_coding	1/1	1477/1652	1477/1632	493/543		chr6	TogoVar
GJB4_chr1_34754740_34767327	34761492	C C	T T	stop_gained stop_gained	HIGH	HG01109.hp1 HG02647.hp1 HG02886.hp2 others(5): Show HG01109.hp1 HG02647.hp1 HG02886.hp2 HG02922.hp1 HG03130.hp2 HG03195.hp2 HG03516.hp2 HG06807.hp1	a0005 a0005	a0005c0006 a0005c0009 a0005c0006 a0005c0009	a0005c0006t0001 a0005c0006t0004 a0005c0009t0001 a0005c0006t0001 a0005c0006t0004 a0005c0009t0001	a0005c0006t0001g0002 a0005c0006t0004g0002 a0005c0009t0001g0002 a0005c0006t0001g0002 a0005c0006t0004g0002 a0005c0009t0001g0002	8	462	0.0173	0	c.238 others(3): Show c.238C>T	p.Gln others(3): Show p.Gln80*	GJB4	ENSG00000189433.7	transcript	ENST00000339480.3	protein_coding	2/2	609/1444	238/801	80/266		chr1	TogoVar
GK2_chr4_79401361_79413228	79406745	G G	A A	stop_gained stop_gained	HIGH	HG02040.hp2 HG02040.hp2	a0003 a0003	a0003c0006 a0003c0006	a0003c0006t0001 a0003c0006t0001	a0003c0006t0001g0000 a0003c0006t0001g0000	1	402	0.0025	0	c.145 others(4): Show c.1456C>T	p.Arg others(4): Show p.Arg486*	GK2	ENSG00000196475.6	transcript	ENST00000358842.5	protein_coding	1/1	1484/1868	1456/1662	486/553		chr4	TogoVar
GK3_chr4_165272807_165284704	165278433	G G	A A	stop_gained stop_gained	HIGH	NA18978.hp2 NA18978.hp2	a0013 a0013	a0013c0023 a0013c0023	a0013c0023t0001 a0013c0023t0001	a0013c0023t0001g0000 a0013c0023t0001g0000	1	384	0.0026	0	c.121 others(4): Show c.1213C>T	p.Arg others(4): Show p.Arg405*	GK3	ENSG00000229894.5	transcript	ENST00000505354.3	protein_coding	1/1	1272/1898	1213/1662	405/553		chr4	TogoVar
GK3_chr4_165272807_165284704	165279103	C C	T T	stop_gained stop_gained	HIGH	NA19063.hp2 NA19063.hp2	a0009 a0009	a0009c0025 a0009c0025	a0009c0025t0001 a0009c0025t0001	a0009c0025t0001g0000 a0009c0025t0001g0000	1	384	0.0026	0	c.543 others(3): Show c.543G>A	p.Trp others(4): Show p.Trp181*	GK3	ENSG00000229894.5	transcript	ENST00000505354.3	protein_coding	1/1	602/1898	543/1662	181/553		chr4	TogoVar
GLB1L2_chr11_134326988_134381324	134356357	T T	A A	stop_gained stop_gained	HIGH	NA18985.hp1 NA18990.hp1 NA18985.hp1 NA18990.hp1	a0008 a0011 a0008 a0011	a0008c0035 a0011c0021 a0008c0035 a0011c0021	a0008c0035t0001 a0011c0021t0002 a0008c0035t0001 a0011c0021t0002	a0008c0035t0001g0279 a0011c0021t0002g0267 a0008c0035t0001g0279 a0011c0021t0002g0267	2	414	0.0048	0	c.615 others(3): Show c.615T>A	p.Tyr others(4): Show p.Tyr205*	GLB1L2	ENSG00000149328.16	transcript	ENST00000535456.7	protein_coding	6/19	689/3251	615/1911	205/636		chr11	TogoVar
GLB1L3_chr11_134271379_134324564	134277444	C C	T T	stop_gained stop_gained	HIGH	HG03927.hp1 HG03927.hp1	a0006 a0006	a0006c0021 a0006c0021	a0006c0021t0001 a0006c0021t0001	a0006c0021t0001g0235 a0006c0021t0001g0235	1	422	0.0024	0	c.142 others(3): Show c.142C>T	p.Gln others(3): Show p.Gln48*	GLB1L3	ENSG00000166105.16	transcript	ENST00000431683.7	protein_coding	2/20	504/2946	142/1962	48/653		chr11	TogoVar
GLDC_chr9_6527467_6650729	6610328	C C	A A	stop_gained stop_gained	HIGH	HG00642.hp2 HG00642.hp2	a0010 a0010	a0010c0039 a0010c0039	a0010c0039t0006 a0010c0039t0006	a0010c0039t0006g0227 a0010c0039t0006g0227	1	342	0.0029	0	c.499 others(3): Show c.499G>T	p.Glu others(4): Show p.Glu167*	GLDC	ENSG00000178445.10	transcript	ENST00000321612.8	protein_coding	4/25	729/3843	499/3063	167/1020		chr9	TogoVar
GLOD5_chrX_48756747_48778648	48773385	C C	T T	stop_gained stop_gained	HIGH	NA18981.hp1 NA18981.hp1	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0001 a0005c0005t0001	a0005c0005t0001g0177 a0005c0005t0001g0177	1	269	0.0037	0	c.433 others(3): Show c.433C>T	p.Arg others(4): Show p.Arg145*	GLOD5	ENSG00000171433.12	transcript	ENST00000303227.11	protein_coding	4/4	477/740	433/483	145/160		chrX	TogoVar
GNAZ_chr22_23065519_23130032	23123154	C C	G G	stop_gained stop_gained	HIGH	HG03490.hp1 HG03490.hp1	a0002 a0002	a0002c0013 a0002c0013	a0002c0013t0001 a0002c0013t0001	a0002c0013t0001g0187 a0002c0013t0001g0187	1	334	0.0030	0	c.791 others(3): Show c.791C>G	p.Ser others(4): Show p.Ser264*	GNAZ	ENSG00000128266.9	transcript	ENST00000615612.2	protein_coding	3/3	1292/3170	791/1068	264/355		chr22	TogoVar
GNB5_chr15_52110100_52196392	52133444	C C	T T	stop_gained stop_gained	HIGH	NA18940.hp1 NA18940.hp1	a0004 a0004	a0004c0008 a0004c0008	a0004c0008t0005 a0004c0008t0005	a0004c0008t0005g0234 a0004c0008t0005g0234	1	366	0.0027	0	c.797 others(3): Show c.797G>A	p.Trp others(4): Show p.Trp266*	GNB5	ENSG00000069966.19	transcript	ENST00000261837.12	protein_coding	9/13	886/8934	797/1188	266/395		chr15	TogoVar
GNG14_chr19_12682998_12693422	12688096	G G	A A	stop_gained stop_gained	HIGH	HG01081.hp2 HG01081.hp2	a0006 a0006	a0006c0006 a0006c0006	a0006c0006t0004 a0006c0006t0004	a0006c0006t0004g0000 a0006c0006t0004g0000	1	370	0.0027	0	c.48G others(2): Show c.48G>A	p.Trp others(3): Show p.Trp16*	GNG14	ENSG00000283980.1	transcript	ENST00000640151.1	protein_coding	1/1	99/425	48/324	16/107		chr19	TogoVar
GNG14_chr19_12682998_12693422	12688133	C C	T T	stop_gained stop_gained	HIGH	HG01884.hp1 HG01884.hp1	a0007 a0007	a0007c0009 a0007c0009	a0007c0009t0002 a0007c0009t0002	a0007c0009t0002g0000 a0007c0009t0002g0000	1	370	0.0027	0	c.85C others(2): Show c.85C>T	p.Gln others(3): Show p.Gln29*	GNG14	ENSG00000283980.1	transcript	ENST00000640151.1	protein_coding	1/1	136/425	85/324	29/107		chr19	TogoVar
GNLY_chr2_85689358_85703852	85694429	G G	A A	stop_gained stop_gained	HIGH	HG00735.hp2 HG01109.hp2 HG02572.hp1 others(5): Show HG00735.hp2 HG01109.hp2 HG02572.hp1 HG02818.hp1 HG03041.hp2 HG03453.hp1 HG03453.hp2 NA18906.hp1	a0003 a0003	a0003c0003 a0003c0003	a0003c0003t0003 a0003c0003t0003	a0003c0003t0003g0007 a0003c0003t0003g0020 a0003c0003t0003g0007 a0003c0003t0003g0020	8	398	0.0201	0	c.11G others(2): Show c.11G>A	p.Trp others(2): Show p.Trp4*	GNLY	ENSG00000115523.17	transcript	ENST00000263863.9	protein_coding	1/5	72/777	11/438	4/145		chr2	TogoVar
GNPDA1_chr5_141995671_142018027	142002082	T T	A A	stop_gained stop_gained	HIGH	NA18997.hp2 NA18997.hp2	a0003 a0003	a0003c0005 a0003c0005	a0003c0005t0001 a0003c0005t0001	a0003c0005t0001g0068 a0003c0005t0001g0068	1	423	0.0024	0	c.817 others(3): Show c.817A>T	p.Lys others(4): Show p.Lys273*	GNPDA1	ENSG00000113552.16	transcript	ENST00000311337.11	protein_coding	7/7	856/2267	817/870	273/289		chr5	TogoVar
GNRHR_chr4_67732118_67759388	67753821	C C	CTAGTTAG others(51): Show CTAGTTAGATCAGCCTAGGATCTGAGCATGATCTCGTTGTGTATCCATGC TACCTGTGT	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	HG02717.hp2 HG02717.hp2	a0003 a0003	a0003c0006 a0003c0006	a0003c0006t0006 a0003c0006t0006	a0003c0006t0006g0150 a0003c0006t0006g0150	1	388	0.0026	58	c.514 others(65): Show c.514_515insACACAGGTAGCATGGATACACAACGAGATCATGCTCAG ATCCTAGGCTGATCTAACTA	p.Gly others(5): Show p.Gly172fs	GNRHR	ENSG00000109163.7	transcript	ENST00000226413.5	protein_coding	1/3	567/4402	514/987	172/328		chr4	TogoVar
GOLGA6A_chr15_74064857_74087550	74074705	G G	A A	stop_gained stop_gained	HIGH	HG02647.hp2 HG02647.hp2	a0019 a0019	a0019c0027 a0019c0027	a0019c0027t0001 a0019c0027t0001	a0019c0027t0001g0115 a0019c0027t0001g0115	1	137	0.0073	0	c.114 others(4): Show c.1144C>T	p.Arg others(4): Show p.Arg382*	GOLGA6A	ENSG00000159289.6	transcript	ENST00000290438.3	protein_coding	11/18	1185/3176	1144/2082	382/693		chr15	TogoVar
GOLGA6A_chr15_74064857_74087550	74082504	C C	T T	stop_gained stop_gained	HIGH	HG01884.hp2 HG02109.hp2 HG01884.hp2 HG02109.hp2	a0010 a0010	a0010c0010 a0010c0010	a0010c0010t0001 a0010c0010t0001	a0010c0010t0001g0002 a0010c0010t0001g0002	2	137	0.0146	0	c.6G> others(1): Show c.6G>A	p.Trp others(2): Show p.Trp2*	GOLGA6A	ENSG00000159289.6	transcript	ENST00000290438.3	protein_coding	1/18	47/3176	6/2082	2/693		chr15	TogoVar
GOLGA6B_chr15_72649697_72674599	72662674	C C	T T	stop_gained stop_gained	HIGH	HG02895.hp1 HG02895.hp1	a0023 a0023	a0023c0018 a0023c0018	a0023c0018t0006 a0023c0018t0006	a0023c0018t0006g0087 a0023c0018t0006g0087	1	333	0.0030	0	c.127 others(4): Show c.1270C>T	p.Gln others(4): Show p.Gln424*	GOLGA6B	ENSG00000215186.7	transcript	ENST00000421285.4	protein_coding	11/18	1311/5380	1270/2082	424/693		chr15	TogoVar
GOLGA6D_chr15_75277835_75300530	75289625	C C	T T	stop_gained stop_gained	HIGH	HG02056.hp2 NA18961.hp2 NA19090.hp1 HG02056.hp2 NA18961.hp2 NA19090.hp1	a0008 a0008	a0008c0009 a0008c0009	a0008c0009t0001 a0008c0009t0001	a0008c0009t0001g0004 a0008c0009t0001g0082 a0008c0009t0001g0004 a0008c0009t0001g0082	3	234	0.0128	0	c.685 others(3): Show c.685C>T	p.Arg others(4): Show p.Arg229*	GOLGA6D	ENSG00000140478.17	transcript	ENST00000434739.4	protein_coding	9/18	726/3178	685/2082	229/693		chr15	TogoVar
GOLGA6L10_chr15_82334993_82354475	82344824	G G	A A	stop_gained stop_gained	HIGH	HG02572.hp2 HG02723.hp2 HG02970.hp2 others(3): Show HG02572.hp2 HG02723.hp2 HG02970.hp2 HG02976.hp2 HG03041.hp1 HG03225.hp2	a0011 a0053 a0011 a0053	a0011c0010 a0053c0049 a0011c0010 a0053c0049	a0011c0010t0010 a0053c0049t0045 a0011c0010t0010 a0053c0049t0045	a0011c0010t0010g0017 a0011c0010t0010g0123 a0011c0010t0010g0125 others(1): Show a0011c0010t0010g0017 a0011c0010t0010g0123 a0011c0010t0010g0125 a0053c0049t0045g0124	6	301	0.0199	0	c.103 others(4): Show c.1036C>T	p.Gln others(4): Show p.Gln346*	GOLGA6L10	ENSG00000278662.6	transcript	ENST00000610657.2	protein_coding	6/9	1136/4452	1036/1569	346/522		chr15	TogoVar
GOLGA6L10_chr15_82334993_82354475	82345107	A A	ACGTAGCC others(12): Show ACGTAGCCTCTCCTCCTGTT	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	HG03579.hp2 HG03579.hp2	a0042 a0042	a0042c0062 a0042c0062	a0042c0062t0041 a0042c0062t0041	a0042c0062t0041g0157 a0042c0062t0041g0157	1	301	0.0033	19	c.752 others(26): Show c.752_753insAACAGGAGGAGAGGCTACG	p.Cys others(5): Show p.Cys251fs	GOLGA6L10	ENSG00000278662.6	transcript	ENST00000610657.2	protein_coding	6/9	852/4452	752/1569	251/522		chr15	TogoVar
GOLGA6L10_chr15_82334993_82354475	82345107	A A	ATGTAGCC others(33): Show ATGTAGCCTCTCCTCCTGTACACGTAGCCTCTCCTCCTGTT	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	HG00099.hp2 HG00140.hp1 HG00280.hp2 others(57): Show HG00099.hp2 HG00140.hp1 HG00280.hp2 HG00408.hp1 HG00438.hp1 HG00642.hp2 HG01099.hp2 HG01168.hp2 HG01169.hp1 HG01192.hp1 HG01346.hp1 HG01346.hp2 HG01515.hp2 HG01952.hp2 HG02080.hp1 HG02523.hp2 HG02559.hp1 HG02622.hp1 HG02683.hp2 HG02698.hp1 HG02735.hp1 HG02738.hp1 HG02738.hp2 HG02809.hp2 HG02886.hp1 HG03098.hp2 HG03130.hp2 HG03195.hp2 HG03453.hp2 HG03490.hp1 HG03491.hp1 HG03491.hp2 HG03492.hp1 HG03654.hp2 HG03669.hp1 HG03669.hp2 HG03834.hp1 HG04115.hp1 HG04204.hp1 HG04228.hp2 NA18949.hp2 NA18952.hp2 NA18964.hp2 NA18965.hp1 NA18966.hp1 NA18972.hp1 NA18980.hp2 NA18983.hp2 NA18986.hp2 NA18989.hp1 NA18994.hp2 NA18998.hp1 NA18999.hp2 NA19004.hp1 NA19004.hp2 NA19055.hp1 NA19060.hp2 NA19062.hp2 NA19090.hp1 NA20805.hp2	a0003 a0005 a0043 a0003 a0005 a0043	a0003c0003 a0003c0061 a0005c0005 others(1): Show a0003c0003 a0003c0061 a0005c0005 a0043c0057	a0003c0003t0002 a0003c0003t0015 a0003c0003t0019 others(7): Show a0003c0003t0002 a0003c0003t0015 a0003c0003t0019 a0003c0003t0020 a0003c0003t0024 a0003c0061t0002 a0005c0005t0002 a0005c0005t0013 a0005c0005t0023 a0043c0057t0026	a0003c0003t0002g0001 a0003c0003t0002g0018 a0003c0003t0002g0041 others(23): Show a0003c0003t0002g0001 a0003c0003t0002g0018 a0003c0003t0002g0041 a0003c0003t0002g0042 a0003c0003t0002g0128 a0003c0003t0002g0130 a0003c0003t0002g0136 a0003c0003t0002g0142 a0003c0003t0002g0145 a0003c0003t0002g0146 a0003c0003t0002g0148 a0003c0003t0002g0150 a0003c0003t0002g0151 a0003c0003t0015g0135 a0003c0003t0015g0141 a0003c0003t0019g0138 a0003c0003t0019g0147 a0003c0003t0020g0044 a0003c0003t0024g0152 a0003c0061t0002g0144 a0005c0005t0002g0004 a0005c0005t0002g0149 a0005c0005t0013g0040 a0005c0005t0013g0134 a0005c0005t0023g0133 a0043c0057t0026g0137	60	301	0.1993	40	c.752 others(47): Show c.752_753insAACAGGAGGAGAGGCTACGTGTACAGGAGGAGAGGCTA CA	p.Cys others(5): Show p.Cys251fs	GOLGA6L10	ENSG00000278662.6	transcript	ENST00000610657.2	protein_coding	6/9	852/4452	752/1569	251/522		chr15	TogoVar
GOLGA6L10_chr15_82334993_82354475	82345107	A A	ATGTAGCC others(12): Show ATGTAGCCTCTCCTCCTGTT	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA19043.hp1 NA19043.hp1	a0055 a0055	a0055c0052 a0055c0052	a0055c0052t0001 a0055c0052t0001	a0055c0052t0001g0091 a0055c0052t0001g0091	1	301	0.0033	19	c.752 others(26): Show c.752_753insAACAGGAGGAGAGGCTACA	p.Cys others(5): Show p.Cys251fs	GOLGA6L10	ENSG00000278662.6	transcript	ENST00000610657.2	protein_coding	6/9	852/4452	752/1569	251/522		chr15	TogoVar
GOLGA6L10_chr15_82334993_82354475	82345107	A A	ATGTAGCC others(54): Show ATGTAGCCTCTCCTCCTGTTCATGTAGCCTCTCCTCCTGTACACGTAGCC TCTCCTCCTGTT	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	HG00733.hp1 HG01433.hp2 HG03225.hp1 HG00733.hp1 HG01433.hp2 HG03225.hp1	a0016 a0016	a0016c0015 a0016c0015	a0016c0015t0002 a0016c0015t0002	a0016c0015t0002g0019 a0016c0015t0002g0019	3	301	0.0100	61	c.752 others(68): Show c.752_753insAACAGGAGGAGAGGCTACGTGTACAGGAGGAGAGGCTA CATGAACAGGAGGAGAGGCTACA	p.Cys others(5): Show p.Cys251fs	GOLGA6L10	ENSG00000278662.6	transcript	ENST00000610657.2	protein_coding	6/9	852/4452	752/1569	251/522		chr15	TogoVar
GOLGA6L1_chr15_23122066_23141822	23129472	G G	A A	stop_gained others(1): Show stop_gained splice_region_variant	HIGH	HG00408.hp1 HG00438.hp2 HG00544.hp2 others(52): Show HG00408.hp1 HG00438.hp2 HG00544.hp2 HG00621.hp2 HG01069.hp2 HG01074.hp2 HG01081.hp2 HG01106.hp2 HG01175.hp1 HG01192.hp1 HG01192.hp2 HG01884.hp2 HG01928.hp1 HG01928.hp2 HG01952.hp2 HG01981.hp1 HG01981.hp2 HG01993.hp1 HG02132.hp1 HG02135.hp1 HG02155.hp1 HG02155.hp2 HG02165.hp1 HG02165.hp2 HG02258.hp1 HG02273.hp1 HG02300.hp2 HG02451.hp1 HG02486.hp1 HG02559.hp1 HG02572.hp1 HG02572.hp2 HG02622.hp2 HG02647.hp1 HG02818.hp2 HG02965.hp1 HG02970.hp2 HG03041.hp2 HG03130.hp2 HG03453.hp1 HG03486.hp1 HG03492.hp2 HG03540.hp2 HG03579.hp1 HG03688.hp2 HG03831.hp1 HG06807.hp1 NA18906.hp1 NA18906.hp2 NA18974.hp1 NA18977.hp2 NA19043.hp1 NA19043.hp2 NA19077.hp2 NA20905.hp1	a0002 a0004 a0006 others(22): Show a0002 a0004 a0006 a0010 a0015 a0016 a0018 a0036 a0037 a0038 a0039 a0041 a0042 a0044 a0046 a0048 a0052 a0054 a0056 a0059 a0060 a0061 a0063 a0067 a0070	a0002c0003 a0002c0046 a0002c0048 others(24): Show a0002c0003 a0002c0046 a0002c0048 a0004c0004 a0006c0006 a0010c0010 a0015c0013 a0016c0014 a0018c0018 a0036c0024 a0037c0041 a0038c0038 a0039c0026 a0041c0028 a0042c0030 a0044c0031 a0046c0033 a0048c0035 a0052c0040 a0054c0050 a0056c0047 a0059c0043 a0060c0051 a0061c0054 a0063c0052 a0067c0058 a0070c0060	a0002c0003t0002 a0002c0003t0018 a0002c0046t0002 others(27): Show a0002c0003t0002 a0002c0003t0018 a0002c0046t0002 a0002c0048t0002 a0004c0004t0003 a0006c0006t0001 a0010c0010t0003 a0010c0010t0006 a0015c0013t0010 a0016c0014t0003 a0018c0018t0006 a0018c0018t0009 a0036c0024t0022 a0037c0041t0003 a0038c0038t0003 a0039c0026t0003 a0041c0028t0003 a0042c0030t0002 a0044c0031t0003 a0046c0033t0006 a0048c0035t0003 a0052c0040t0003 a0054c0050t0009 a0056c0047t0002 a0059c0043t0006 a0060c0051t0006 a0061c0054t0019 a0063c0052t0010 a0067c0058t0003 a0070c0060t0009	a0002c0003t0002g0005 a0002c0003t0002g0015 a0002c0003t0002g0016 others(40): Show a0002c0003t0002g0005 a0002c0003t0002g0015 a0002c0003t0002g0016 a0002c0003t0002g0017 a0002c0003t0002g0035 a0002c0003t0002g0040 a0002c0003t0002g0041 a0002c0003t0002g0044 a0002c0003t0002g0045 a0002c0003t0018g0039 a0002c0046t0002g0043 a0002c0048t0002g0037 a0004c0004t0003g0006 a0004c0004t0003g0054 a0004c0004t0003g0057 a0006c0006t0001g0014 a0006c0006t0001g0134 a0010c0010t0003g0079 a0010c0010t0003g0081 a0010c0010t0006g0078 a0015c0013t0010g0021 a0016c0014t0003g0070 a0016c0014t0003g0074 a0018c0018t0006g0086 a0018c0018t0009g0082 a0036c0024t0022g0047 a0037c0041t0003g0076 a0038c0038t0003g0063 a0039c0026t0003g0049 a0041c0028t0003g0051 a0042c0030t0002g0033 a0044c0031t0003g0053 a0046c0033t0006g0060 a0048c0035t0003g0055 a0052c0040t0003g0064 a0054c0050t0009g0087 a0056c0047t0002g0036 a0059c0043t0006g0085 a0060c0051t0006g0080 a0061c0054t0019g0046 a0063c0052t0010g0095 a0067c0058t0003g0096 a0070c0060t0009g0103	55	204	0.2696	0	c.198 others(4): Show c.1981C>T	p.Gln others(4): Show p.Gln661*	GOLGA6L1	ENSG00000273976.2	transcript	ENST00000614055.2	protein_coding	8/9	2072/3822	1981/2007	661/668		chr15	TogoVar

Search by Variant

Search

Search Results (Total: 3004 hits)