Joint Open Genome and Omics Platform (JoGo)

Search by Variant

Regionname

e.g. ALDH2_chr12_111761933_111822532, HBB_chr11_5220464_5232071.

Chr

Chromosome name (e.g., chr11).

Snpeff genename

Exact SnpEff gene name.

Sampleids

Target sampleid (e.g. HG02615).

Snpeff haplotype class

Haplotype-annotation class (e.g., ahapid, ahapid+chapid).

Snpeff annotation impact

Exact impact level (e.g., HIGH, MODERATE, LOW).

Snpeff annotation impact detail

Keyword match in SnpEff annotation.

Hapid

One or more haplotype IDs (comma-separated; e.g., a0001, a01, a0001c0001, a01c02, a1c2, a0001c0001t0005, a0001c0001t0005g0018).

Samplehapid

Sample haplotype IDs to include (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

No_hapid

Haplotype IDs to exclude (comma-separated; e.g., a0001, a0002, a0001c0001, a0001c0001t0005, a1, a01).

No_samplehapid

Sample haplotype IDs to exclude (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

Start

Start position (GRCh38).

End

End position (GRCh38).

Minac

Minimum alternate allele count (≥).

Maxac

Maximum alternate allele count (≤).

Minlen

Minimum variant length (≥).

Maxlen

Maximum variant length (≤).

Sort By

Select column to sort.

Order by

Ascending or descending.

Show

Results per page.

regionname	pos	ref	alt	annotation	impact	samples	ahapids	achapids	acthapids	actghapids	ac	an	af	len	hgvs_c	hgvs_p	genename	geneid	featuretype	featureid	transcript_biotype	rank	cdna cdna pos length	cds cds pos length	aa aa pos length	status	chr	external
CSF2RA_chrX_1263814_1314935	1285910	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19087.hp2 NA19087.hp2	a0010 a0010	a0010c0012 a0010c0012	a0010c0012t0004 a0010c0012t0004	a0010c0012t0004g0089 a0010c0012t0004g0089	1	159	0.0063	1	c.211 others(4): Show c.211dupG	p.Glu others(4): Show p.Glu71fs	CSF2RA	ENSG00000198223.18	transcript	ENST00000381529.9	protein_coding	4/13	368/1815	212/1203	71/400	INFO_REALIGN_3_PRIME	chrX	TogoVar
CSF2RA_chrX_1263814_1314935	1285914	AC AC	A A	frameshift_variant frameshift_variant	HIGH	HG01169.hp1 HG01169.hp1	a0009 a0009	a0009c0013 a0009c0013	a0009c0013t0003 a0009c0013t0003	a0009c0013t0003g0153 a0009c0013t0003g0153	1	159	0.0063	-1	c.216 others(4): Show c.216delC	p.Arg others(4): Show p.Arg73fs	CSF2RA	ENSG00000198223.18	transcript	ENST00000381529.9	protein_coding	4/13	372/1815	216/1203	72/400	INFO_REALIGN_3_PRIME	chrX	TogoVar
CSF2RA_chrX_1263814_1314935	1288552	GA GA	G G	frameshift_variant frameshift_variant	HIGH	HG01169.hp1 HG01169.hp1	a0009 a0009	a0009c0013 a0009c0013	a0009c0013t0003 a0009c0013t0003	a0009c0013t0003g0153 a0009c0013t0003g0153	1	159	0.0063	-1	c.256 others(4): Show c.256delA	p.Ile others(4): Show p.Ile86fs	CSF2RA	ENSG00000198223.18	transcript	ENST00000381529.9	protein_coding	5/13	412/1815	256/1203	86/400	INFO_REALIGN_3_PRIME	chrX	TogoVar
CSF2RA_chrX_1263814_1314935	1288583	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19062.hp1 NA19062.hp1	a0012 a0012	a0012c0011 a0012c0011	a0012c0011t0010 a0012c0011t0010	a0012c0011t0010g0054 a0012c0011t0010g0054	1	159	0.0063	1	c.286 others(4): Show c.286dupG	p.Val others(4): Show p.Val96fs	CSF2RA	ENSG00000198223.18	transcript	ENST00000381529.9	protein_coding	5/13	443/1815	287/1203	96/400	INFO_REALIGN_3_PRIME	chrX	TogoVar
CSF2RA_chrX_1263814_1314935	1288845	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19062.hp1 NA19062.hp1	a0012 a0012	a0012c0011 a0012c0011	a0012c0011t0010 a0012c0011t0010	a0012c0011t0010g0054 a0012c0011t0010g0054	1	159	0.0063	1	c.436 others(4): Show c.436dupC	p.Arg others(5): Show p.Arg146fs	CSF2RA	ENSG00000198223.18	transcript	ENST00000381529.9	protein_coding	6/13	593/1815	437/1203	146/400	INFO_REALIGN_3_PRIME	chrX	TogoVar
CSF2RA_chrX_1263814_1314935	1290415	A A	AG AG	frameshift_variant frameshift_variant	HIGH	HG01169.hp1 HG01169.hp1	a0009 a0009	a0009c0013 a0009c0013	a0009c0013t0003 a0009c0013t0003	a0009c0013t0003g0153 a0009c0013t0003g0153	1	159	0.0063	1	c.554 others(4): Show c.554dupG	p.Leu others(5): Show p.Leu186fs	CSF2RA	ENSG00000198223.18	transcript	ENST00000381529.9	protein_coding	7/13	711/1815	555/1203	185/400	INFO_REALIGN_3_PRIME	chrX	TogoVar
CSF2RA_chrX_1263814_1314935	1305494	C C	CA CA	frameshift_variant frameshift_variant	HIGH	NA19062.hp1 NA19062.hp1	a0012 a0012	a0012c0011 a0012c0011	a0012c0011t0010 a0012c0011t0010	a0012c0011t0010g0054 a0012c0011t0010g0054	1	159	0.0063	1	c.109 others(5): Show c.1095dupA	p.Leu others(5): Show p.Leu366fs	CSF2RA	ENSG00000198223.18	transcript	ENST00000381529.9	protein_coding	12/13	1252/1815	1096/1203	366/400	INFO_REALIGN_3_PRIME	chrX	TogoVar
CSNK2A2_chr16_58152907_58203106	58167262	GCTAACAT others(3): Show GCTAACATACA	G G	frameshift_variant frameshift_variant	HIGH	HG01169.hp1 HG01169.hp1	a0002 a0002	a0002c0004 a0002c0004	a0002c0004t0001 a0002c0004t0001	a0002c0004t0001g0137 a0002c0004t0001g0137	1	400	0.0025	-10	c.661 others(17): Show c.661_670delTGTATGTTAG	p.Cys others(5): Show p.Cys221fs	CSNK2A2	ENSG00000070770.10	transcript	ENST00000262506.8	protein_coding	8/12	1040/1887	661/1053	221/350		chr16	TogoVar
CSNK2A3_chr11_11346942_11358250	11352670	CATGCTGT others(7): Show CATGCTGTGACAATA	C C	frameshift_variant frameshift_variant	HIGH	HG03688.hp1 HG03688.hp1	a0011 a0011	a0011c0017 a0011c0017	a0011c0017t0001 a0011c0017t0001	a0011c0017t0001g0000 a0011c0017t0001g0000	1	452	0.0022	-14	c.436 others(21): Show c.436_449delTATTGTCACAGCAT	p.Tyr others(5): Show p.Tyr146fs	CSNK2A3	ENSG00000254598.3	transcript	ENST00000528848.3	protein_coding	1/1	580/1309	436/1176	146/391		chr11	TogoVar
CSNKA2IP_chr3_88333456_88472594	88467364	TA TA	T T	frameshift_variant frameshift_variant	HIGH	HG00280.hp1 HG00639.hp1 HG01167.hp2 others(4): Show HG00280.hp1 HG00639.hp1 HG01167.hp2 HG01175.hp2 HG01256.hp1 HG01261.hp2 HG01433.hp2	a0005 a0005	a0005c0007 a0005c0007	a0005c0007t0002 a0005c0007t0002	a0005c0007t0002g0288 a0005c0007t0002g0306 a0005c0007t0002g0320 others(4): Show a0005c0007t0002g0288 a0005c0007t0002g0306 a0005c0007t0002g0320 a0005c0007t0002g0322 a0005c0007t0002g0324 a0005c0007t0002g0325 a0005c0007t0002g0335	7	386	0.0181	-1	c.200 others(5): Show c.2009delA	p.Lys others(5): Show p.Lys670fs	CSNKA2IP	ENSG00000283434.2	transcript	ENST00000637986.2	protein_coding	2/2	2467/2695	2009/2205	670/734	INFO_REALIGN_3_PRIME	chr3	TogoVar
CSTF2T_chr10_51690486_51704595	51697927	TCCTCCTT others(12): Show TCCTCCTTGTATACTGACTC	T T	frameshift_variant frameshift_variant	HIGH	HG01069.hp1 HG01069.hp1	a0004 a0004	a0004c0021 a0004c0021	a0004c0021t0001 a0004c0021t0001	a0004c0021t0001g0000 a0004c0021t0001g0000	1	428	0.0023	-19	c.160 others(28): Show c.1604_1622delGAGTCAGTATACAAGGAGG	p.Gly others(5): Show p.Gly535fs	CSTF2T	ENSG00000177613.9	transcript	ENST00000331173.6	protein_coding	1/1	1668/4110	1604/1851	535/616		chr10	TogoVar
CSTF2T_chr10_51690486_51704595	51699393	T T	TCCTCCCC others(15): Show TCCTCCCCCCCCCCCCCCCCCCC	frameshift_variant frameshift_variant	HIGH	HG01069.hp1 HG01069.hp1	a0004 a0004	a0004c0021 a0004c0021	a0004c0021t0001 a0004c0021t0001	a0004c0021t0001g0000 a0004c0021t0001g0000	1	428	0.0023	22	c.156 others(29): Show c.156_157insGGGGGGGGGGGGGGGGGGGAGG	p.Thr others(4): Show p.Thr53fs	CSTF2T	ENSG00000177613.9	transcript	ENST00000331173.6	protein_coding	1/1	202/4110	156/1851	52/616		chr10	TogoVar
CS_chr12_56266699_56305330	56282972	A A	AAGCCTCG others(42): Show AAGCCTCGGAAACGGATGCCCTTGAGAGAGGAGAGAGAGAATTACAACTC	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	HG01928.hp1 HG01928.hp1	a0002 a0002	a0002c0004 a0002c0004	a0002c0004t0001 a0002c0004t0001	a0002c0004t0001g0204 a0002c0004t0001g0204	1	316	0.0032	49	c.268 others(59): Show c.268-30_286dupGAGTTGTAATTCTCTCTCTCCTCTCTCAAGGGCAT CCGTTTCCGAGGCT	p.Phe others(4): Show p.Phe96fs	CS	ENSG00000062485.19	transcript	ENST00000351328.8	protein_coding	5/11	415/2915	286/1401	96/466		chr12	TogoVar
CT45A10_chrX_135876065_135898444	135882608	A A	AGCTTGTG others(28): Show AGCTTGTGCCCCCTTCTCTCACTCCCCACTCTTTTT	frameshift_variant frameshift_variant	HIGH	NA18906.hp1 NA18906.hp1	a0008 a0008	a0008c0008 a0008c0008	a0008c0008t0001 a0008c0008t0001	a0008c0008t0001g0101 a0008c0008t0001g0101	1	258	0.0039	35	c.439 others(42): Show c.439_440insAAAAAGAGTGGGGAGTGAGAGAAGGGGGCACAAGC	p.Met others(5): Show p.Met147fs	CT45A10	ENSG00000269586.8	transcript	ENST00000682849.1	protein_coding	4/5	545/869	439/570	147/189		chrX	TogoVar
CT45A10_chrX_135876065_135898444	135882625	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA18906.hp1 NA18906.hp1	a0008 a0008	a0008c0008 a0008c0008	a0008c0008t0001 a0008c0008t0001	a0008c0008t0001g0101 a0008c0008t0001g0101	1	258	0.0039	1	c.422 others(8): Show c.422_423insC	p.Glu others(5): Show p.Glu142fs	CT45A10	ENSG00000269586.8	transcript	ENST00000682849.1	protein_coding	4/5	528/869	422/570	141/189		chrX	TogoVar
CT45A1_chrX_135708639_135728228	135718988	T T	TA TA	frameshift_variant frameshift_variant	HIGH	NA18940.hp1 NA18940.hp1	a0005 a0005	a0005c0003 a0005c0003	a0005c0003t0002 a0005c0003t0002	a0005c0003t0002g0022 a0005c0003t0002g0022	1	57	0.0175	1	c.51d others(3): Show c.51dupA	p.Arg others(4): Show p.Arg18fs	CT45A1	ENSG00000268940.6	transcript	ENST00000594565.6	protein_coding	2/5	110/823	52/570	18/189	INFO_REALIGN_3_PRIME	chrX	TogoVar
CT45A1_chrX_135708639_135728228	135721209	A A	AAG AAG	frameshift_variant frameshift_variant	HIGH	HG03130.hp1 HG03130.hp1	a0003 a0003	a0003c0005 a0003c0005	a0003c0005t0002 a0003c0005t0002	a0003c0005t0002g0018 a0003c0005t0002g0018	1	57	0.0175	2	c.352 others(9): Show c.352_353dupAG	p.Ser others(5): Show p.Ser118fs	CT45A1	ENSG00000268940.6	transcript	ENST00000594565.6	protein_coding	3/5	412/823	354/570	118/189	INFO_REALIGN_3_PRIME	chrX	TogoVar
CT45A3_chrX_135755044_135773191	135764396	T T	TA TA	frameshift_variant frameshift_variant	HIGH	NA19074.hp1 NA19074.hp1	a0004 a0004	a0004c0005 a0004c0005	a0004c0005t0006 a0004c0005t0006	a0004c0005t0006g0082 a0004c0005t0006g0082	1	160	0.0063	1	c.48d others(3): Show c.48dupT	p.Lys others(4): Show p.Lys17fs	CT45A3	ENSG00000269096.7	transcript	ENST00000598716.3	protein_coding	2/5	138/968	48/570	16/189		chrX	TogoVar
CT45A5_chrX_135770852_135790503	135777637	CA CA	C C	frameshift_variant others(1): Show frameshift_variant stop_lost	HIGH	HG01361.hp1 HG01361.hp1	a0000 a0000	a0000c0006 a0000c0006	a0000c0006t0030 a0000c0006t0030	a0000c0006t0030g0077 a0000c0006t0030g0077	1	177	0.0057	-1	c.568 others(4): Show c.568delT	p.Ter others(5): Show p.Ter190fs	CT45A5	ENSG00000228836.9	transcript	ENST00000698999.1	protein_coding	5/5	841/2627	568/570	190/189		chrX	TogoVar
CT45A5_chrX_135770852_135790503	135777662	TA TA	T T	frameshift_variant frameshift_variant	HIGH	HG02896.hp2 HG02896.hp2	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0015 a0005c0005t0015	a0005c0005t0015g0101 a0005c0005t0015g0101	1	177	0.0057	-1	c.543 others(4): Show c.543delT	p.Lys others(5): Show p.Lys182fs	CT45A5	ENSG00000228836.9	transcript	ENST00000698999.1	protein_coding	5/5	816/2627	543/570	181/189		chrX	TogoVar
CT45A6_chrX_135789685_135807787	135794933	TA TA	T T	frameshift_variant frameshift_variant	HIGH	HG02300.hp1 HG02300.hp1	a0006 a0006	a0006c0005 a0006c0005	a0006c0005t0001 a0006c0005t0001	a0006c0005t0001g0025 a0006c0005t0001g0025	1	36	0.0278	-1	c.534 others(4): Show c.534delT	p.Lys others(5): Show p.Lys179fs	CT45A6	ENSG00000278289.5	transcript	ENST00000620654.2	protein_coding	5/5	817/1066	534/570	178/189		chrX	TogoVar
CT45A6_chrX_135789685_135807787	135796235	CT CT	C C	frameshift_variant frameshift_variant	HIGH	HG00099.hp2 HG00099.hp2	a0005 a0005	a0005c0004 a0005c0004	a0005c0004t0002 a0005c0004t0002	a0005c0004t0002g0017 a0005c0004t0002g0017	1	36	0.0278	-1	c.456 others(4): Show c.456delA	p.Gly others(5): Show p.Gly153fs	CT45A6	ENSG00000278289.5	transcript	ENST00000620654.2	protein_coding	4/5	739/1066	456/570	152/189		chrX	TogoVar
CT45A6_chrX_135789685_135807787	135796239	C C	CA CA	frameshift_variant frameshift_variant	HIGH	HG03942.hp1 HG03942.hp1	a0004 a0004	a0004c0006 a0004c0006	a0004c0006t0003 a0004c0006t0003	a0004c0006t0003g0023 a0004c0006t0003g0023	1	36	0.0278	1	c.452 others(4): Show c.452dupT	p.Gln others(5): Show p.Gln152fs	CT45A6	ENSG00000278289.5	transcript	ENST00000620654.2	protein_coding	4/5	735/1066	452/570	151/189		chrX	TogoVar
CT45A6_chrX_135789685_135807787	135796753	AG AG	A A	frameshift_variant frameshift_variant	HIGH	HG00099.hp2 HG00099.hp2	a0005 a0005	a0005c0004 a0005c0004	a0005c0004t0002 a0005c0004t0002	a0005c0004t0002g0017 a0005c0004t0002g0017	1	36	0.0278	-1	c.319 others(4): Show c.319delC	p.Leu others(5): Show p.Leu107fs	CT45A6	ENSG00000278289.5	transcript	ENST00000620654.2	protein_coding	3/5	602/1066	319/570	107/189		chrX	TogoVar
CT45A6_chrX_135789685_135807787	135796775	TG TG	T T	frameshift_variant frameshift_variant	HIGH	HG00099.hp2 HG00099.hp2	a0005 a0005	a0005c0004 a0005c0004	a0005c0004t0002 a0005c0004t0002	a0005c0004t0002g0017 a0005c0004t0002g0017	1	36	0.0278	-1	c.297 others(4): Show c.297delC	p.Ser others(5): Show p.Ser100fs	CT45A6	ENSG00000278289.5	transcript	ENST00000620654.2	protein_coding	3/5	580/1066	297/570	99/189		chrX	TogoVar
CT45A6_chrX_135789685_135807787	135796788	TC TC	T T	frameshift_variant frameshift_variant	HIGH	HG00099.hp2 HG00099.hp2	a0005 a0005	a0005c0004 a0005c0004	a0005c0004t0002 a0005c0004t0002	a0005c0004t0002g0017 a0005c0004t0002g0017	1	36	0.0278	-1	c.284 others(4): Show c.284delG	p.Gly others(4): Show p.Gly95fs	CT45A6	ENSG00000278289.5	transcript	ENST00000620654.2	protein_coding	3/5	567/1066	284/570	95/189		chrX	TogoVar
CT45A6_chrX_135789685_135807787	135796806	A A	AC AC	frameshift_variant frameshift_variant	HIGH	HG03942.hp1 HG03942.hp1	a0004 a0004	a0004c0006 a0004c0006	a0004c0006t0003 a0004c0006t0003	a0004c0006t0003g0023 a0004c0006t0003g0023	1	36	0.0278	1	c.266 others(4): Show c.266dupG	p.Ser others(4): Show p.Ser90fs	CT45A6	ENSG00000278289.5	transcript	ENST00000620654.2	protein_coding	3/5	549/1066	266/570	89/189		chrX	TogoVar
CT45A6_chrX_135789685_135807787	135798879	T T	TC TC	frameshift_variant frameshift_variant	HIGH	HG03942.hp1 HG03942.hp1	a0004 a0004	a0004c0006 a0004c0006	a0004c0006t0003 a0004c0006t0003	a0004c0006t0003g0023 a0004c0006t0003g0023	1	36	0.0278	1	c.114 others(4): Show c.114dupG	p.Lys others(4): Show p.Lys39fs	CT45A6	ENSG00000278289.5	transcript	ENST00000620654.2	protein_coding	2/5	397/1066	114/570	38/189		chrX	TogoVar
CT45A7_chrX_135824229_135842280	135829471	T T	TG TG	frameshift_variant frameshift_variant	HIGH	HG01175.hp1 HG01175.hp1	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0005 a0005c0005t0005	a0005c0005t0005g0019 a0005c0005t0005g0019	1	19	0.0526	1	c.538 others(4): Show c.538dupC	p.His others(5): Show p.His180fs	CT45A7	ENSG00000273696.5	transcript	ENST00000610598.5	protein_coding	5/5	783/1026	538/570	180/189		chrX	TogoVar
CT45A7_chrX_135824229_135842280	135830747	C C	CA CA	frameshift_variant frameshift_variant	HIGH	NA18985.hp1 NA18985.hp1	a0004 a0004	a0004c0004 a0004c0004	a0004c0004t0002 a0004c0004t0002	a0004c0004t0002g0018 a0004c0004t0002g0018	1	19	0.0526	1	c.486 others(4): Show c.486dupT	p.Glu others(5): Show p.Glu163fs	CT45A7	ENSG00000273696.5	transcript	ENST00000610598.5	protein_coding	4/5	731/1026	486/570	162/189		chrX	TogoVar
CT45A7_chrX_135824229_135842280	135831280	G G	GT GT	frameshift_variant frameshift_variant	HIGH	NA18985.hp1 NA18985.hp1	a0004 a0004	a0004c0004 a0004c0004	a0004c0004t0002 a0004c0004t0002	a0004c0004t0002g0018 a0004c0004t0002g0018	1	19	0.0526	1	c.334 others(4): Show c.334dupA	p.Thr others(5): Show p.Thr112fs	CT45A7	ENSG00000273696.5	transcript	ENST00000610598.5	protein_coding	3/5	579/1026	334/570	112/189		chrX	TogoVar
CT45A7_chrX_135824229_135842280	135831428	C C	CA CA	frameshift_variant frameshift_variant	HIGH	HG01175.hp1 HG01175.hp1	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0005 a0005c0005t0005	a0005c0005t0005g0019 a0005c0005t0005g0019	1	19	0.0526	1	c.186 others(4): Show c.186dupT	p.Ala others(4): Show p.Ala63fs	CT45A7	ENSG00000273696.5	transcript	ENST00000610598.5	protein_coding	3/5	431/1026	186/570	62/189		chrX	TogoVar
CT45A7_chrX_135824229_135842280	135833476	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA18985.hp1 NA18985.hp1	a0004 a0004	a0004c0004 a0004c0004	a0004c0004t0002 a0004c0004t0002	a0004c0004t0002g0018 a0004c0004t0002g0018	1	19	0.0526	-1	c.57d others(3): Show c.57delC	p.Arg others(4): Show p.Arg20fs	CT45A7	ENSG00000273696.5	transcript	ENST00000610598.5	protein_coding	2/5	302/1026	57/570	19/189		chrX	TogoVar
CT45A8_chrX_135841497_135859538	135846699	A A	AT AT	frameshift_variant frameshift_variant	HIGH	NA18983.hp1 NA18983.hp1	a0000 a0000	a0000c0005 a0000c0005	a0000c0005t0004 a0000c0005t0004	a0000c0005t0004g0006 a0000c0005t0004g0006	1	8	0.1250	1	c.562 others(4): Show c.562dupA	p.Met others(5): Show p.Met188fs	CT45A8	ENSG00000278085.5	transcript	ENST00000611660.5	protein_coding	5/5	807/1010	562/570	188/189		chrX	TogoVar
CT45A8_chrX_135841497_135859538	135848053	AT AT	A A	frameshift_variant frameshift_variant	HIGH	HG00280.hp1 HG00280.hp1	a0002 a0002	a0002c0004 a0002c0004	a0002c0004t0003 a0002c0004t0003	a0002c0004t0003g0003 a0002c0004t0003g0003	1	8	0.1250	-1	c.430 others(4): Show c.430delA	p.Ile others(5): Show p.Ile144fs	CT45A8	ENSG00000278085.5	transcript	ENST00000611660.5	protein_coding	4/5	675/1010	430/570	144/189		chrX	TogoVar
CT45A8_chrX_135841497_135859538	135848519	A A	AG AG	frameshift_variant frameshift_variant	HIGH	HG00280.hp1 HG00280.hp1	a0002 a0002	a0002c0004 a0002c0004	a0002c0004t0003 a0002c0004t0003	a0002c0004t0003g0003 a0002c0004t0003g0003	1	8	0.1250	1	c.344 others(4): Show c.344dupC	p.Pro others(5): Show p.Pro116fs	CT45A8	ENSG00000278085.5	transcript	ENST00000611660.5	protein_coding	3/5	589/1010	344/570	115/189		chrX	TogoVar
CT45A9_chrX_135858418_135876812	135865301	A A	AG AG	frameshift_variant frameshift_variant	HIGH	HG06807.hp2 HG06807.hp2	a0004 a0004	a0004c0005 a0004c0005	a0004c0005t0004 a0004c0005t0004	a0004c0005t0004g0009 a0004c0005t0004g0009	1	13	0.0769	1	c.461 others(4): Show c.461dupC	p.Thr others(5): Show p.Thr155fs	CT45A9	ENSG00000270946.6	transcript	ENST00000620704.5	protein_coding	4/5	706/1368	461/570	154/189		chrX	TogoVar
CT45A9_chrX_135858418_135876812	135865761	G G	GT GT	frameshift_variant frameshift_variant	HIGH	HG06807.hp2 HG06807.hp2	a0004 a0004	a0004c0005 a0004c0005	a0004c0005t0004 a0004c0005t0004	a0004c0005t0004g0009 a0004c0005t0004g0009	1	13	0.0769	1	c.381 others(4): Show c.381dupA	p.Arg others(5): Show p.Arg128fs	CT45A9	ENSG00000270946.6	transcript	ENST00000620704.5	protein_coding	3/5	626/1368	381/570	127/189		chrX	TogoVar
CT45A9_chrX_135858418_135876812	135865906	G G	GAA GAA	frameshift_variant frameshift_variant	HIGH	HG02965.hp1 HG02965.hp1	a0005 a0005	a0005c0004 a0005c0004	a0005c0004t0003 a0005c0004t0003	a0005c0004t0003g0001 a0005c0004t0003g0001	1	13	0.0769	2	c.235 others(9): Show c.235_236dupTT	p.Lys others(4): Show p.Lys81fs	CT45A9	ENSG00000270946.6	transcript	ENST00000620704.5	protein_coding	3/5	481/1368	236/570	79/189		chrX	TogoVar
CT47A10_chrX_120933701_120947023	120941045	T T	TG TG	frameshift_variant frameshift_variant	HIGH	HG00597.hp1 HG00597.hp1	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0001 a0002c0002t0001	a0002c0002t0001g0005 a0002c0002t0001g0005	1	7	0.1429	1	c.719 others(4): Show c.719dupC	p.Gln others(5): Show p.Gln241fs	CT47A10	ENSG00000224089.3	transcript	ENST00000430448.3	protein_coding	1/3	978/1298	719/867	240/288		chrX	TogoVar
CT47A10_chrX_120933701_120947023	120941059	C C	CTG CTG	frameshift_variant frameshift_variant	HIGH	HG00597.hp1 HG00597.hp1	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0001 a0002c0002t0001	a0002c0002t0001g0005 a0002c0002t0001g0005	1	7	0.1429	2	c.704 others(9): Show c.704_705dupCA	p.Glu others(5): Show p.Glu236fs	CT47A10	ENSG00000224089.3	transcript	ENST00000430448.3	protein_coding	1/3	964/1298	705/867	235/288		chrX	TogoVar
CT47A10_chrX_120933701_120947023	120941699	T T	TC TC	frameshift_variant frameshift_variant	HIGH	HG00597.hp1 HG00597.hp1	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0001 a0002c0002t0001	a0002c0002t0001g0005 a0002c0002t0001g0005	1	7	0.1429	1	c.65d others(3): Show c.65dupG	p.Ala others(4): Show p.Ala23fs	CT47A10	ENSG00000224089.3	transcript	ENST00000430448.3	protein_coding	1/3	324/1298	65/867	22/288		chrX	TogoVar
CT47A1_chrX_120977476_120990760	120983820	CT CT	C C	frameshift_variant frameshift_variant	HIGH	NA19057.hp2 NA19057.hp2	a0003 a0003	a0003c0010 a0003c0010	a0003c0010t0001 a0003c0010t0001	a0003c0010t0001g0026 a0003c0010t0001g0026	1	302	0.0033	-1	c.822 others(4): Show c.822delA	p.Glu others(5): Show p.Glu275fs	CT47A1	ENSG00000236371.6	transcript	ENST00000433030.4	protein_coding	2/3	1053/1260	822/867	274/288		chrX	TogoVar
CT47A1_chrX_120977476_120990760	120985029	CG CG	C C	frameshift_variant frameshift_variant	HIGH	HG03704.hp1 HG03704.hp1	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0001 a0005c0005t0001	a0005c0005t0001g0016 a0005c0005t0001g0016	1	302	0.0033	-1	c.500 others(4): Show c.500delC	p.Pro others(5): Show p.Pro167fs	CT47A1	ENSG00000236371.6	transcript	ENST00000433030.4	protein_coding	1/3	731/1260	500/867	167/288		chrX	TogoVar
CT47A1_chrX_120977476_120990760	120985185	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA18985.hp1 NA18985.hp1	a0006 a0006	a0006c0008 a0006c0008	a0006c0008t0001 a0006c0008t0001	a0006c0008t0001g0019 a0006c0008t0001g0019	1	302	0.0033	1	c.344 others(4): Show c.344dupC	p.Ala others(5): Show p.Ala116fs	CT47A1	ENSG00000236371.6	transcript	ENST00000433030.4	protein_coding	1/3	575/1260	344/867	115/288		chrX	TogoVar
CT47A2_chrX_120972606_120985928	120980095	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19009.hp1 NA19009.hp1	a0004 a0004	a0004c0010 a0004c0010	a0004c0010t0001 a0004c0010t0001	a0004c0010t0001g0028 a0004c0010t0001g0028	1	253	0.0040	1	c.574 others(4): Show c.574dupG	p.Ala others(5): Show p.Ala192fs	CT47A2	ENSG00000242362.2	transcript	ENST00000458218.3	protein_coding	1/3	833/1298	574/867	192/288		chrX	TogoVar
CT47A2_chrX_120972606_120985928	120980325	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA18992.hp2 NA18992.hp2	a0005 a0005	a0005c0007 a0005c0007	a0005c0007t0002 a0005c0007t0002	a0005c0007t0002g0035 a0005c0007t0002g0035	1	253	0.0040	1	c.344 others(4): Show c.344dupC	p.Ala others(5): Show p.Ala116fs	CT47A2	ENSG00000242362.2	transcript	ENST00000458218.3	protein_coding	1/3	603/1298	344/867	115/288		chrX	TogoVar
CT47A2_chrX_120972606_120985928	120980402	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA19082.hp1 NA19082.hp1	a0008 a0008	a0008c0006 a0008c0006	a0008c0006t0001 a0008c0006t0001	a0008c0006t0001g0018 a0008c0006t0001g0018	1	253	0.0040	1	c.267 others(4): Show c.267dupC	p.Ala others(4): Show p.Ala90fs	CT47A2	ENSG00000242362.2	transcript	ENST00000458218.3	protein_coding	1/3	526/1298	267/867	89/288		chrX	TogoVar
CT47A2_chrX_120972606_120985928	120980436	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA18957.hp2 NA18957.hp2	a0009 a0009	a0009c0013 a0009c0013	a0009c0013t0001 a0009c0013t0001	a0009c0013t0001g0031 a0009c0013t0001g0031	1	253	0.0040	1	c.233 others(4): Show c.233dupG	p.Gly others(4): Show p.Gly79fs	CT47A2	ENSG00000242362.2	transcript	ENST00000458218.3	protein_coding	1/3	492/1298	233/867	78/288		chrX	TogoVar
CT47A3_chrX_120967746_120981068	120974071	GT GT	G G	frameshift_variant frameshift_variant	HIGH	HG02818.hp2 HG02818.hp2	a0000 a0000	a0000c0015 a0000c0015	a0000c0015t0007 a0000c0015t0007	a0000c0015t0007g0033 a0000c0015t0007g0033	1	201	0.0050	-1	c.851 others(4): Show c.851delA	p.Asn others(5): Show p.Asn284fs	CT47A3	ENSG00000236126.3	transcript	ENST00000441330.3	protein_coding	2/3	1110/1298	851/867	284/288		chrX	TogoVar

Search by Variant

Search

Search Results (Total: 5828 hits)