Joint Open Genome and Omics Platform (JoGo)

Search by Variant

Regionname

e.g. ALDH2_chr12_111761933_111822532, HBB_chr11_5220464_5232071.

Chr

Chromosome name (e.g., chr11).

Snpeff genename

Exact SnpEff gene name.

Sampleids

Target sampleid (e.g. HG02615).

Snpeff haplotype class

Haplotype-annotation class (e.g., ahapid, ahapid+chapid).

Snpeff annotation impact

Exact impact level (e.g., HIGH, MODERATE, LOW).

Snpeff annotation impact detail

Keyword match in SnpEff annotation.

Hapid

One or more haplotype IDs (comma-separated; e.g., a0001, a01, a0001c0001, a01c02, a1c2, a0001c0001t0005, a0001c0001t0005g0018).

Samplehapid

Sample haplotype IDs to include (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

No_hapid

Haplotype IDs to exclude (comma-separated; e.g., a0001, a0002, a0001c0001, a0001c0001t0005, a1, a01).

No_samplehapid

Sample haplotype IDs to exclude (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

Start

Start position (GRCh38).

End

End position (GRCh38).

Minac

Minimum alternate allele count (≥).

Maxac

Maximum alternate allele count (≤).

Minlen

Minimum variant length (≥).

Maxlen

Maximum variant length (≤).

Sort By

Select column to sort.

Order by

Ascending or descending.

Show

Results per page.

regionname	pos	ref	alt	annotation	impact	samples	ahapids	achapids	acthapids	actghapids	ac	an	af	len	hgvs_c	hgvs_p	genename	geneid	featuretype	featureid	transcript_biotype	rank	cdna cdna pos length	cds cds pos length	aa aa pos length	status	chr	external
ACTN3_chr11_66541903_66568334	66563053	G G	T T	stop_gained stop_gained	HIGH	HG02615.hp1 HG02647.hp2 HG02615.hp1 HG02647.hp2	a0007 a0007	a0007c0009 a0007c0009	a0007c0009t0001 a0007c0009t0001	a0007c0009t0001g0183 a0007c0009t0001g0184 a0007c0009t0001g0183 a0007c0009t0001g0184	2	400	0.0050	0	c.256 others(4): Show c.2566G>T	p.Glu others(4): Show p.Glu856*	ACTN3	ENSG00000248746.6	transcript	ENST00000513398.2	protein_coding	21/21	2601/2882	2566/2706	856/901		chr11	TogoVar
ACTR3C_chr7_150242212_150328545	150286477	G G	A A	stop_gained stop_gained	HIGH	HG00741.hp1 HG02698.hp1 HG02976.hp1 others(5): Show HG00741.hp1 HG02698.hp1 HG02976.hp1 HG03239.hp1 HG03834.hp1 HG03942.hp2 NA18977.hp2 NA18978.hp1	a0003 a0003	a0003c0003 a0003c0003	a0003c0003t0001 a0003c0003t0002 a0003c0003t0001 a0003c0003t0002	a0003c0003t0001g0095 a0003c0003t0001g0136 a0003c0003t0001g0177 others(5): Show a0003c0003t0001g0095 a0003c0003t0001g0136 a0003c0003t0001g0177 a0003c0003t0001g0179 a0003c0003t0001g0186 a0003c0003t0001g0189 a0003c0003t0002g0187 a0003c0003t0002g0212	8	294	0.0272	0	c.361 others(3): Show c.361C>T	p.Gln others(4): Show p.Gln121*	ACTR3C	ENSG00000106526.12	transcript	ENST00000683684.1	protein_coding	5/8	489/1157	361/633	121/210		chr7	TogoVar
ACY3_chr11_67637555_67655730	67644840	C C	CTTCCATC others(27): Show CTTCCATCTCAAAGGCAGGAAAGGCCGTACCTGTG	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	HG02083.hp1 HG02083.hp1	a0004 a0004	a0004c0010 a0004c0010	a0004c0010t0012 a0004c0010t0012	a0004c0010t0012g0080 a0004c0010t0012g0080	1	396	0.0025	34	c.635 others(43): Show c.635-5_663dupCACAGGTACGGCCTTTCCTGCCTTTGAGATGGAA	p.Ala others(5): Show p.Ala222fs	ACY3	ENSG00000132744.8	transcript	ENST00000255082.8	protein_coding	7/8	905/1371	663/960	221/319		chr11	TogoVar
ACYP2_chr2_53966113_54310300	54057304	G G	A A	stop_gained stop_gained	HIGH	HG00408.hp1 HG00438.hp2 HG01169.hp1 others(11): Show HG00408.hp1 HG00438.hp2 HG01169.hp1 HG01175.hp2 HG01515.hp1 HG01928.hp2 HG01934.hp1 HG01952.hp2 HG01978.hp2 HG03239.hp2 HG03490.hp1 HG04115.hp1 NA18967.hp1 NA19000.hp1	a0002 a0002	a0002c0003 a0002c0005 a0002c0003 a0002c0005	a0002c0003t0002 a0002c0003t0005 a0002c0005t0002 a0002c0003t0002 a0002c0003t0005 a0002c0005t0002	a0002c0003t0002g0007 a0002c0003t0002g0008 a0002c0003t0002g0012 others(11): Show a0002c0003t0002g0007 a0002c0003t0002g0008 a0002c0003t0002g0012 a0002c0003t0002g0019 a0002c0003t0002g0021 a0002c0003t0002g0029 a0002c0003t0002g0030 a0002c0003t0002g0031 a0002c0003t0002g0032 a0002c0003t0002g0049 a0002c0003t0002g0090 a0002c0003t0002g0093 a0002c0003t0005g0015 a0002c0005t0002g0168	14	272	0.0515	0	c.221 others(3): Show c.221G>A	p.Trp others(3): Show p.Trp74*	ACYP2	ENSG00000170634.13	transcript	ENST00000607452.6	protein_coding	4/7	466/1262	221/519	74/172		chr2	TogoVar
ADAM29_chr4_174913358_174983180	174977749	C C	T T	stop_gained stop_gained	HIGH	NA18973.hp2 NA18973.hp2	a0009 a0009	a0009c0017 a0009c0017	a0009c0017t0002 a0009c0017t0002	a0009c0017t0002g0282 a0009c0017t0002g0282	1	330	0.0030	0	c.222 others(4): Show c.2224C>T	p.Gln others(4): Show p.Gln742*	ADAM29	ENSG00000168594.15	transcript	ENST00000359240.7	protein_coding	5/5	2894/3325	2224/2463	742/820		chr4	TogoVar
ADAM29_chr4_174913358_174983180	174977937	G G	GCAACCTC others(47): Show GCAACCTCAGTTGATGCCTTCCCAGGGTCAACCTCCTGTGACGCCCTCCT AGAGC	stop_gained others(1): Show stop_gained conservative_inframe_insertion	HIGH	HG02886.hp1 HG02895.hp1 HG02897.hp1 others(1): Show HG02886.hp1 HG02895.hp1 HG02897.hp1 NA19043.hp2	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0002 a0005c0005t0002	a0005c0005t0002g0022 a0005c0005t0002g0231 a0005c0005t0002g0235 a0005c0005t0002g0022 a0005c0005t0002g0231 a0005c0005t0002g0235	4	330	0.0121	54	c.243 others(63): Show c.2436_2437insGGTCAACCTCCTGTGACGCCCTCCTAGAGCCAACCT CAGTTGATGCCTTCCCAG	p.Gln others(67): Show p.Gln812_Ser813insGlyGlnProProValThrProSerTerSerGl nProGlnLeuMetProSerGln	ADAM29	ENSG00000168594.15	transcript	ENST00000359240.7	protein_coding	5/5	3107/3325	2437/2463	813/820	INFO_REALIGN_3_PRIME	chr4	TogoVar
ADAM8_chr10_133257423_133281868	133271663	G G	T T	stop_gained stop_gained	HIGH	NA18939.hp1 NA18939.hp1	a0028 a0028	a0028c0038 a0028c0038	a0028c0038t0002 a0028c0038t0002	a0028c0038t0002g0161 a0028c0038t0002g0161	1	386	0.0026	0	c.114 others(4): Show c.1149C>A	p.Tyr others(4): Show p.Tyr383*	ADAM8	ENSG00000151651.16	transcript	ENST00000445355.8	protein_coding	12/23	1200/3259	1149/2475	383/824		chr10	TogoVar
ADAMTS16_chr5_5135330_5325304	5200168	C C	A A	stop_gained stop_gained	HIGH	NA18978.hp2 NA18978.hp2	a0017 a0017	a0017c0051 a0017c0051	a0017c0051t0001 a0017c0051t0001	a0017c0051t0001g0009 a0017c0051t0001g0009	1	332	0.0030	0	c.135 others(4): Show c.1350C>A	p.Cys others(4): Show p.Cys450*	ADAMTS16	ENSG00000145536.15	transcript	ENST00000274181.7	protein_coding	9/23	1488/4979	1350/3675	450/1224		chr5	TogoVar
ADAMTS7_chr15_78754206_78816464	78767018	G G	A A	stop_gained stop_gained	HIGH	HG01358.hp1 HG01358.hp1	a0041 a0041	a0041c0118 a0041c0118	a0041c0118t0001 a0041c0118t0001	a0041c0118t0001g0132 a0041c0118t0001g0132	1	380	0.0026	0	c.289 others(4): Show c.2893C>T	p.Arg others(4): Show p.Arg965*	ADAMTS7	ENSG00000136378.15	transcript	ENST00000388820.5	protein_coding	19/24	3137/5520	2893/5061	965/1686		chr15	TogoVar
ADAMTS9_chr3_64510654_64693000	64658506	G G	C C	stop_gained stop_gained	HIGH	NA18968.hp2 NA18968.hp2	a0018 a0018	a0018c0048 a0018c0048	a0018c0048t0002 a0018c0048t0002	a0018c0048t0002g0081 a0018c0048t0002g0081	1	286	0.0035	0	c.965 others(3): Show c.965C>G	p.Ser others(4): Show p.Ser322*	ADAMTS9	ENSG00000163638.13	transcript	ENST00000498707.5	protein_coding	4/40	1308/7624	965/5808	322/1935		chr3	TogoVar
ADAP2_chr17_30916945_30964322	30931899	G G	T T	stop_gained stop_gained	HIGH	NA18951.hp2 NA18951.hp2	a0003 a0003	a0003c0003 a0003c0003	a0003c0003t0001 a0003c0003t0001	a0003c0003t0001g0187 a0003c0003t0001g0187	1	282	0.0036	0	c.328 others(3): Show c.328G>T	p.Glu others(4): Show p.Glu110*	ADAP2	ENSG00000184060.11	transcript	ENST00000330889.8	protein_coding	4/11	398/2669	328/1146	110/381		chr17	TogoVar
ADAR_chr1_154577057_154613186	154589452	A A	T T	stop_gained stop_gained	HIGH	NA19068.hp2 NA19068.hp2	a0008 a0008	a0008c0010 a0008c0010	a0008c0010t0001 a0008c0010t0001	a0008c0010t0001g0212 a0008c0010t0001g0212	1	416	0.0024	0	c.267 others(4): Show c.2679T>A	p.Cys others(4): Show p.Cys893*	ADAR	ENSG00000160710.18	transcript	ENST00000368474.9	protein_coding	9/15	2859/6610	2679/3681	893/1226		chr1	TogoVar
ADCY7_chr16_50261551_50323135	50300716	C C	T T	stop_gained others(1): Show stop_gained splice_region_variant	HIGH	NA19065.hp1 NA19065.hp1	a0006 a0006	a0006c0027 a0006c0027	a0006c0027t0005 a0006c0027t0005	a0006c0027t0005g0090 a0006c0027t0005g0090	1	338	0.0030	0	c.107 others(4): Show c.1078C>T	p.Gln others(4): Show p.Gln360*	ADCY7	ENSG00000121281.13	transcript	ENST00000673801.1	protein_coding	9/26	1476/6271	1078/3243	360/1080		chr16	TogoVar
ADCY7_chr16_50261551_50323135	50312075	A A	T T	stop_gained stop_gained	HIGH	HG02273.hp1 HG02273.hp1	a0010 a0010	a0010c0023 a0010c0023	a0010c0023t0001 a0010c0023t0001	a0010c0023t0001g0187 a0010c0023t0001g0187	1	338	0.0030	0	c.248 others(4): Show c.2488A>T	p.Lys others(4): Show p.Lys830*	ADCY7	ENSG00000121281.13	transcript	ENST00000673801.1	protein_coding	21/26	2886/6271	2488/3243	830/1080		chr16	TogoVar
ADGRE2_chr19_14727392_14783560	14767029	G G	A A	stop_gained stop_gained	HIGH	HG02976.hp2 HG02976.hp2	a0013 a0013	a0013c0031 a0013c0031	a0013c0031t0053 a0013c0031t0053	a0013c0031t0053g0137 a0013c0031t0053g0137	1	218	0.0046	0	c.436 others(3): Show c.436C>T	p.Gln others(4): Show p.Gln146*	ADGRE2	ENSG00000127507.18	transcript	ENST00000315576.8	protein_coding	6/21	911/6791	436/2472	146/823		chr19	TogoVar
ADGRF1_chr6_46992708_47047332	47009865	T T	A A	stop_gained stop_gained	HIGH	HG03471.hp1 HG03471.hp1	a0010 a0010	a0010c0022 a0010c0022	a0010c0022t0006 a0010c0022t0006	a0010c0022t0006g0307 a0010c0022t0006g0307	1	400	0.0025	0	c.157 others(4): Show c.1570A>T	p.Lys others(4): Show p.Lys524*	ADGRF1	ENSG00000153292.16	transcript	ENST00000371253.7	protein_coding	11/15	1755/5432	1570/2733	524/910		chr6	TogoVar
ADH1C_chr4_99331497_99357746	99347033	C C	A A	stop_gained stop_gained	HIGH	HG01257.hp1 HG01258.hp2 HG02698.hp2 HG01257.hp1 HG01258.hp2 HG02698.hp2	a0003 a0003	a0003c0005 a0003c0005	a0003c0005t0001 a0003c0005t0001	a0003c0005t0001g0026 a0003c0005t0001g0026	3	360	0.0083	0	c.232 others(3): Show c.232G>T	p.Gly others(3): Show p.Gly78*	ADH1C	ENSG00000248144.6	transcript	ENST00000515683.6	protein_coding	3/9	303/1454	232/1128	78/375		chr4	TogoVar
ADH6_chr4_99197639_99224246	99213679	A A	T T	stop_gained stop_gained	HIGH	HG02572.hp2 HG02572.hp2	a0003 a0003	a0003c0004 a0003c0004	a0003c0004t0004 a0003c0004t0004	a0003c0004t0004g0053 a0003c0004t0004g0053	1	312	0.0032	0	c.189 others(3): Show c.189T>A	p.Tyr others(3): Show p.Tyr63*	ADH6	ENSG00000172955.17	transcript	ENST00000394899.6	protein_coding	3/9	283/2802	189/1128	63/375		chr4	TogoVar
ADH7_chr4_99407263_99440342	99435221	C C	A A	stop_gained stop_gained	HIGH	NA18965.hp2 NA18965.hp2	a0016 a0016	a0016c0017 a0016c0017	a0016c0017t0001 a0016c0017t0001	a0016c0017t0001g0220 a0016c0017t0001g0220	1	416	0.0024	0	c.13G others(2): Show c.13G>T	p.Gly others(2): Show p.Gly5*	ADH7	ENSG00000196344.12	transcript	ENST00000437033.7	protein_coding	1/9	122/2119	13/1125	5/374		chr4	TogoVar
ADHFE1_chr8_66427504_66473907	66457139	C C	T T	stop_gained stop_gained	HIGH	HG01081.hp1 HG01081.hp1	a0003 a0003	a0003c0006 a0003c0006	a0003c0006t0001 a0003c0006t0001	a0003c0006t0001g0008 a0003c0006t0001g0008	1	402	0.0025	0	c.113 others(4): Show c.1135C>T	p.Arg others(4): Show p.Arg379*	ADHFE1	ENSG00000147576.17	transcript	ENST00000396623.8	protein_coding	12/14	1148/1972	1135/1404	379/467		chr8	TogoVar
ADI1_chr2_3492366_3524531	3513880	T T	A A	stop_gained stop_gained	HIGH	NA18997.hp2 NA18997.hp2	a0006 a0006	a0006c0009 a0006c0009	a0006c0009t0006 a0006c0009t0006	a0006c0009t0006g0150 a0006c0009t0006g0150	1	392	0.0026	0	c.217 others(3): Show c.217A>T	p.Lys others(3): Show p.Lys73*	ADI1	ENSG00000182551.14	transcript	ENST00000327435.11	protein_coding	2/4	261/2181	217/540	73/179		chr2	TogoVar
ADORA2B_chr17_15940130_15980746	15975097	G G	GCTGTTAA others(70): Show GCTGTTAACTGTGTCACTCTTTTCCAGCCAGCTCAGGGTAAAAATAAGCC CAAGTGGGCAATGAATATGGCCATTCTT	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA18998.hp1 NA18998.hp1	a0004 a0004	a0004c0011 a0004c0011	a0004c0011t0001 a0004c0011t0001	a0004c0011t0001g0152 a0004c0011t0001g0152	1	346	0.0029	77	c.759 others(84): Show c.759_835dupTAACTGTGTCACTCTTTTCCAGCCAGCTCAGGGTAAAA ATAAGCCCAAGTGGGCAATGAATATGGCCATTCTTCTGT	p.Ser others(5): Show p.Ser279fs	ADORA2B	ENSG00000170425.4	transcript	ENST00000304222.3	protein_coding	2/2	955/1522	836/999	279/332	INFO_REALIGN_3_PRIME	chr17	TogoVar
ADSS1_chr14_104719229_104752310	104744825	A A	T T	stop_gained stop_gained	HIGH	NA18982.hp1 NA18982.hp1	a0006 a0006	a0006c0009 a0006c0009	a0006c0009t0001 a0006c0009t0001	a0006c0009t0001g0098 a0006c0009t0001g0098	1	402	0.0025	0	c.108 others(4): Show c.1087A>T	p.Lys others(4): Show p.Lys363*	ADSS1	ENSG00000185100.12	transcript	ENST00000330877.7	protein_coding	11/13	1129/1723	1087/1374	363/457		chr14	TogoVar
AGAP5_chr10_73669295_73703109	73674703	G G	A A	stop_gained stop_gained	HIGH	HG00544.hp1 HG02074.hp2 HG02258.hp2 others(11): Show HG00544.hp1 HG02074.hp2 HG02258.hp2 NA18612.hp2 NA18946.hp2 NA18961.hp1 NA18965.hp2 NA18971.hp1 NA18987.hp2 NA19001.hp1 NA19012.hp2 NA19057.hp2 NA19076.hp2 NA19078.hp1	a0004 a0004	a0004c0004 a0004c0004	a0004c0004t0001 a0004c0004t0002 a0004c0004t0001 a0004c0004t0002	a0004c0004t0001g0214 a0004c0004t0002g0008 a0004c0004t0002g0022 others(7): Show a0004c0004t0001g0214 a0004c0004t0002g0008 a0004c0004t0002g0022 a0004c0004t0002g0044 a0004c0004t0002g0045 a0004c0004t0002g0046 a0004c0004t0002g0047 a0004c0004t0002g0048 a0004c0004t0002g0049 a0004c0004t0002g0050	14	368	0.0380	0	c.195 others(4): Show c.1957C>T	p.Arg others(4): Show p.Arg653*	AGAP5	ENSG00000172650.15	transcript	ENST00000374094.9	protein_coding	8/8	2311/2719	1957/2061	653/686		chr10	TogoVar
AGAP5_chr10_73669295_73703109	73675786	G G	A A	stop_gained stop_gained	HIGH	HG02055.hp2 HG02055.hp2	a0011 a0011	a0011c0019 a0011c0019	a0011c0019t0001 a0011c0019t0001	a0011c0019t0001g0111 a0011c0019t0001g0111	1	368	0.0027	0	c.874 others(3): Show c.874C>T	p.Arg others(4): Show p.Arg292*	AGAP5	ENSG00000172650.15	transcript	ENST00000374094.9	protein_coding	8/8	1228/2719	874/2061	292/686		chr10	TogoVar
AGAP5_chr10_73669295_73703109	73675791	A A	C C	stop_gained stop_gained	HIGH	HG02523.hp2 HG02523.hp2	a0010 a0010	a0010c0016 a0010c0016	a0010c0016t0001 a0010c0016t0001	a0010c0016t0001g0132 a0010c0016t0001g0132	1	368	0.0027	0	c.869 others(3): Show c.869T>G	p.Leu others(4): Show p.Leu290*	AGAP5	ENSG00000172650.15	transcript	ENST00000374094.9	protein_coding	8/8	1223/2719	869/2061	290/686		chr10	TogoVar
AGAP6_chr10_49983406_50015499	50002020	C C	T T	stop_gained stop_gained	HIGH	NA18986.hp1 NA18986.hp1	a0020 a0020	a0020c0016 a0020c0016	a0020c0016t0002 a0020c0016t0002	a0020c0016t0002g0177 a0020c0016t0002g0177	1	406	0.0025	0	c.421 others(3): Show c.421C>T	p.Gln others(4): Show p.Gln141*	AGAP6	ENSG00000204149.16	transcript	ENST00000412531.7	protein_coding	5/8	731/2684	421/2061	141/686		chr10	TogoVar
AGAP6_chr10_49983406_50015499	50002025	C C	A A	stop_gained stop_gained	HIGH	NA18986.hp1 NA18986.hp1	a0020 a0020	a0020c0016 a0020c0016	a0020c0016t0002 a0020c0016t0002	a0020c0016t0002g0177 a0020c0016t0002g0177	1	406	0.0025	0	c.426 others(3): Show c.426C>A	p.Tyr others(4): Show p.Tyr142*	AGAP6	ENSG00000204149.16	transcript	ENST00000412531.7	protein_coding	5/8	736/2684	426/2061	142/686		chr10	TogoVar
AGAP6_chr10_49983406_50015499	50009986	G G	T T	stop_gained stop_gained	HIGH	HG02055.hp2 HG02109.hp1 HG02717.hp2 others(5): Show HG02055.hp2 HG02109.hp1 HG02717.hp2 HG02723.hp1 HG02886.hp2 HG02965.hp1 NA19030.hp1 NA19043.hp2	a0005 a0012 a0005 a0012	a0005c0007 a0012c0012 a0005c0007 a0012c0012	a0005c0007t0004 a0012c0012t0005 a0005c0007t0004 a0012c0012t0005	a0005c0007t0004g0051 a0005c0007t0004g0202 a0005c0007t0004g0203 others(4): Show a0005c0007t0004g0051 a0005c0007t0004g0202 a0005c0007t0004g0203 a0005c0007t0004g0206 a0005c0007t0004g0209 a0012c0012t0005g0204 a0012c0012t0005g0205	8	406	0.0197	0	c.186 others(4): Show c.1861G>T	p.Glu others(4): Show p.Glu621*	AGAP6	ENSG00000204149.16	transcript	ENST00000412531.7	protein_coding	8/8	2171/2684	1861/2061	621/686		chr10	TogoVar
AGMO_chr7_15195317_15567015	15365564	G G	A A	stop_gained stop_gained	HIGH	NA19030.hp1 NA19030.hp1	a0015 a0015	a0015c0020 a0015c0020	a0015c0020t0002 a0015c0020t0002	a0015c0020t0002g0202 a0015c0020t0002g0202	1	236	0.0042	0	c.121 others(4): Show c.1213C>T	p.Arg others(4): Show p.Arg405*	AGMO	ENSG00000187546.14	transcript	ENST00000342526.8	protein_coding	12/13	1383/2476	1213/1338	405/445		chr7	TogoVar
AHNAK2_chr14_104932253_104983374	104948543	T T	TCCCCCTC others(489): Show TCCCCCTCCAGCCGCGCACCATCCAGCTTGGCTCCTGGGGCCTTGACGTC CACCTCCACGCTGGGCAGAGACACCTCCACATCAGGGGCTGTCACTTCCA CCTTGGGGTCTTTTAGGTCCAGCTTGGGGCCCTTGATGTCTATTTCGGGG CCCTTGAGGTCCACTTTGGGCACCTTGAAACTGGGCATCTGCAGCTTGGG CAGGTGCCCTTTGAGGCCGACTTCCTCGGGCACAGGGCCCTCCAGGAGTT TCACGTCCACCTGGCCAGCCTGGACCTTCACGTCGGCGGAAAGGGGCTGA ATGCTGAGGTCAGTGGTCTTGAGGTCCCCCTGCATGGAGGGGAGGCTCAC GTCGGCCTCCACCTTCAACGCAGACACATCCGCTGAGGCCTCGATGGACT TGCCAAGGGCAGACACCCCAAACGACAGCATCTTGAACTTGGGCATTTTG AACTTGCTGTCTTTGGCAGTCACGTCCTTGTCGGCCAGGGACATGTC	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	HG02615.hp2 HG02615.hp2	a0210 a0210	a0210c0055 a0210c0055	a0210c0055t0003 a0210c0055t0003	a0210c0055t0003g0114 a0210c0055t0003g0114	1	356	0.0028	496	c.690 others(505): Show c.6907_6908insGACATGTCCCTGGCCGACAAGGACGTGACTGCCAAA GACAGCAAGTTCAAAATGCCCAAGTTCAAGATGCTGTCGTTTGGGGTGTC TGCCCTTGGCAAGTCCATCGAGGCCTCAGCGGATGTGTCTGCGTTGAAGG TGGAGGCCGACGTGAGCCTCCCCTCCATGCAGGGGGACCTCAAGACCACT GACCTCAGCATTCAGCCCCTTTCCGCCGACGTGAAGGTCCAGGCTGGCCA GGTGGACGTGAAACTCCTGGAGGGCCCTGTGCCCGAGGAAGTCGGCCTCA AAGGGCACCTGCCCAAGCTGCAGATGCCCAGTTTCAAGGTGCCCAAAGTG GACCTCAAGGGCCCCGAAATAGACATCAAGGGCCCCAAGCTGGACCTAAA AGACCCCAAGGTGGAAGTGACAGCCCCTGATGTGGAGGTGTCTCTGCCCA GCGTGGAGGTGGACGTCAAGGCCCCAGGAGCCAAGCTGGATGGTGCGCGG CTGGAGGGGG	p.Asp others(6): Show p.Asp2303fs	AHNAK2	ENSG00000185567.7	transcript	ENST00000333244.6	protein_coding	7/7	7044/18335	6907/17388	2303/5795		chr14	TogoVar
AHNAK2_chr14_104932253_104983374	104950536	G G	A A	stop_gained stop_gained	HIGH	HG02630.hp2 HG02630.hp2	a0133 a0133	a0133c0097 a0133c0097	a0133c0097t0001 a0133c0097t0001	a0133c0097t0001g0116 a0133c0097t0001g0116	1	356	0.0028	0	c.491 others(4): Show c.4915C>T	p.Gln others(5): Show p.Gln1639*	AHNAK2	ENSG00000185567.7	transcript	ENST00000333244.6	protein_coding	7/7	5052/18335	4915/17388	1639/5795		chr14	TogoVar
AHRR_chr5_316714_443285	422822	C C	T T	stop_gained stop_gained	HIGH	NA19083.hp1 NA19083.hp1	a0009 a0009	a0009c0022 a0009c0022	a0009c0022t0001 a0009c0022t0001	a0009c0022t0001g0023 a0009c0022t0001g0023	1	268	0.0037	0	c.535 others(3): Show c.535C>T	p.Gln others(4): Show p.Gln179*	AHRR	ENSG00000063438.20	transcript	ENST00000684583.1	protein_coding	6/11	651/5661	535/2094	179/697		chr5	TogoVar
AIMP2_chr7_6004272_6028834	6023464	G G	GAGGGAAG others(12): Show GAGGGAAGCAGTAAAGAAAA	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	HG01517.hp2 HG01517.hp2	a0007 a0007	a0007c0007 a0007c0007	a0007c0007t0001 a0007c0007t0001	a0007c0007t0001g0020 a0007c0007t0001g0020	1	442	0.0023	19	c.739 others(26): Show c.739_757dupGGAAGCAGTAAAGAAAAAG	p.Ala others(5): Show p.Ala253fs	AIMP2	ENSG00000106305.10	transcript	ENST00000223029.8	protein_coding	4/4	850/1198	758/963	253/320	INFO_REALIGN_3_PRIME	chr7	TogoVar
AKR1B15_chr7_134544110_134584869	134575486	C C	T T	stop_gained stop_gained	HIGH	HG02735.hp1 HG02735.hp1	a0006 a0006	a0006c0012 a0006c0012	a0006c0012t0001 a0006c0012t0001	a0006c0012t0001g0135 a0006c0012t0001g0135	1	404	0.0025	0	c.580 others(3): Show c.580C>T	p.Gln others(4): Show p.Gln194*	AKR1B15	ENSG00000227471.9	transcript	ENST00000457545.7	protein_coding	7/12	866/1641	580/1035	194/344		chr7	TogoVar
AKR1C1_chr10_4958415_4988283	4966960	C C	T T	stop_gained stop_gained	HIGH	HG03041.hp1 HG03041.hp1	a0004 a0004	a0004c0011 a0004c0011	a0004c0011t0065 a0004c0011t0065	a0004c0011t0065g0007 a0004c0011t0065g0007	1	426	0.0024	0	c.286 others(3): Show c.286C>T	p.Arg others(3): Show p.Arg96*	AKR1C1	ENSG00000187134.14	transcript	ENST00000380872.9	protein_coding	3/9	316/6543	286/972	96/323		chr10	TogoVar
AKR1C1_chr10_4958415_4988283	4977739	T T	G G	stop_gained stop_gained	HIGH	NA18993.hp2 NA19086.hp2 NA18993.hp2 NA19086.hp2	a0003 a0003	a0003c0009 a0003c0009	a0003c0009t0002 a0003c0009t0002	a0003c0009t0002g0003 a0003c0009t0002g0003	2	426	0.0047	0	c.969 others(3): Show c.969T>G	p.Tyr others(4): Show p.Tyr323*	AKR1C1	ENSG00000187134.14	transcript	ENST00000380872.9	protein_coding	9/9	999/6543	969/972	323/323		chr10	TogoVar
AKR1E2_chr10_4821207_4853062	4847211	C C	T T	stop_gained stop_gained	HIGH	HG01175.hp2 HG01346.hp2 HG01928.hp1 others(8): Show HG01175.hp2 HG01346.hp2 HG01928.hp1 HG01928.hp2 HG01981.hp2 HG03209.hp1 HG03239.hp1 HG03490.hp2 HG03492.hp2 NA18522.hp2 NA20905.hp1	a0003 a0003	a0003c0004 a0003c0004	a0003c0004t0005 a0003c0004t0007 a0003c0004t0005 a0003c0004t0007	a0003c0004t0005g0023 a0003c0004t0005g0039 a0003c0004t0005g0045 others(6): Show a0003c0004t0005g0023 a0003c0004t0005g0039 a0003c0004t0005g0045 a0003c0004t0005g0144 a0003c0004t0005g0146 a0003c0004t0005g0147 a0003c0004t0007g0023 a0003c0004t0007g0078 a0003c0004t0007g0145	11	358	0.0307	0	c.901 others(3): Show c.901C>T	p.Arg others(4): Show p.Arg301*	AKR1E2	ENSG00000165568.18	transcript	ENST00000298375.12	protein_coding	9/10	1019/1613	901/963	301/320		chr10	TogoVar
ALDH18A1_chr10_95600941_95661711	95621177	G G	A A	stop_gained stop_gained	HIGH	NA19063.hp1 NA19063.hp1	a0005 a0005	a0005c0011 a0005c0011	a0005c0011t0001 a0005c0011t0001	a0005c0011t0001g0115 a0005c0011t0001g0115	1	372	0.0027	0	c.132 others(4): Show c.1321C>T	p.Arg others(4): Show p.Arg441*	ALDH18A1	ENSG00000059573.9	transcript	ENST00000371224.7	protein_coding	12/18	1464/3352	1321/2388	441/795		chr10	TogoVar
ALDH1L2_chr12_105014790_105089458	105070617	A A	T T	stop_gained stop_gained	HIGH	HG02572.hp1 HG03516.hp2 HG02572.hp1 HG03516.hp2	a0004 a0004	a0004c0008 a0004c0008	a0004c0008t0012 a0004c0008t0018 a0004c0008t0012 a0004c0008t0018	a0004c0008t0012g0236 a0004c0008t0018g0235 a0004c0008t0012g0236 a0004c0008t0018g0235	2	386	0.0052	0	c.381 others(3): Show c.381T>A	p.Tyr others(4): Show p.Tyr127*	ALDH1L2	ENSG00000136010.14	transcript	ENST00000258494.14	protein_coding	3/23	403/7428	381/2772	127/923		chr12	TogoVar
ALDH3B1_chr11_68005327_68034276	68015325	C C	T T	stop_gained stop_gained	HIGH	HG03453.hp1 HG03453.hp1	a0004 a0004	a0004c0021 a0004c0021	a0004c0021t0002 a0004c0021t0002	a0004c0021t0002g0054 a0004c0021t0002g0054	1	374	0.0027	0	c.28C others(2): Show c.28C>T	p.Arg others(3): Show p.Arg10*	ALDH3B1	ENSG00000006534.17	transcript	ENST00000342456.11	protein_coding	2/10	95/2811	28/1407	10/468		chr11	TogoVar
ALDH3B2_chr11_67657155_67679623	67665502	G G	T T	stop_gained stop_gained	HIGH	NA20300.hp2 NA20300.hp2	a0012 a0012	a0012c0018 a0012c0018	a0012c0018t0018 a0012c0018t0018	a0012c0018t0018g0171 a0012c0018t0018g0171	1	390	0.0026	0	c.489 others(3): Show c.489C>A	p.Cys others(4): Show p.Cys163*	ALDH3B2	ENSG00000132746.16	transcript	ENST00000673966.2	protein_coding	7/10	921/2650	489/1158	163/385		chr11	TogoVar
ALDOC_chr17_28568120_28581895	28575451	T T	A A	stop_gained stop_gained	HIGH	NA18989.hp2 NA18989.hp2	a0003 a0003	a0003c0004 a0003c0004	a0003c0004t0002 a0003c0004t0002	a0003c0004t0002g0013 a0003c0004t0002g0013	1	352	0.0028	0	c.82A others(2): Show c.82A>T	p.Lys others(3): Show p.Lys28*	ALDOC	ENSG00000109107.14	transcript	ENST00000226253.9	protein_coding	2/9	189/1608	82/1095	28/364		chr17	TogoVar
ALKBH3_chr11_43875831_43925274	43884007	C C	T T	stop_gained stop_gained	HIGH	NA18995.hp2 homoSapiens_chm13v2.hp1 NA18995.hp2 homoSapiens_chm13v2.hp1	a0003 a0003	a0003c0009 a0003c0010 a0003c0009 a0003c0010	a0003c0009t0001 a0003c0010t0002 a0003c0009t0001 a0003c0010t0002	a0003c0009t0001g0093 a0003c0010t0002g0033 a0003c0009t0001g0093 a0003c0010t0002g0033	2	376	0.0053	0	c.208 others(3): Show c.208C>T	p.Arg others(3): Show p.Arg70*	ALKBH3	ENSG00000166199.13	transcript	ENST00000302708.9	protein_coding	4/10	627/1544	208/861	70/286		chr11	TogoVar
ALLC_chr2_3653200_3707671	3681636	A A	T T	stop_gained others(1): Show stop_gained splice_region_variant	HIGH	NA19082.hp2 NA19082.hp2	a0009 a0009	a0009c0016 a0009c0016	a0009c0016t0002 a0009c0016t0002	a0009c0016t0002g0180 a0009c0016t0002g0180	1	274	0.0037	0	c.301 others(3): Show c.301A>T	p.Lys others(4): Show p.Lys101*	ALLC	ENSG00000151360.10	transcript	ENST00000252505.4	protein_coding	6/12	458/1441	301/1176	101/391		chr2	TogoVar
ALOX15_chr17_4625919_4646678	4639517	G G	A A	stop_gained stop_gained	HIGH	NA19066.hp2 NA19066.hp2	a0007 a0007	a0007c0012 a0007c0012	a0007c0012t0001 a0007c0012t0001	a0007c0012t0001g0203 a0007c0012t0001g0203	1	472	0.0021	0	c.250 others(3): Show c.250C>T	p.Gln others(3): Show p.Gln84*	ALOX15	ENSG00000161905.13	transcript	ENST00000293761.8	protein_coding	2/14	277/2697	250/1989	84/662		chr17	TogoVar
ALOX15_chr17_4625919_4646678	4639568	T T	A A	stop_gained stop_gained	HIGH	NA19066.hp2 NA19066.hp2	a0007 a0007	a0007c0012 a0007c0012	a0007c0012t0001 a0007c0012t0001	a0007c0012t0001g0203 a0007c0012t0001g0203	1	472	0.0021	0	c.199 others(3): Show c.199A>T	p.Lys others(3): Show p.Lys67*	ALOX15	ENSG00000161905.13	transcript	ENST00000293761.8	protein_coding	2/14	226/2697	199/1989	67/662		chr17	TogoVar
ALOX5_chr10_45369216_45451117	45440559	C C	T T	stop_gained stop_gained	HIGH	HG02258.hp2 HG02258.hp2	a0006 a0006	a0006c0013 a0006c0013	a0006c0013t0001 a0006c0013t0001	a0006c0013t0001g0253 a0006c0013t0001g0253	1	345	0.0029	0	c.111 others(4): Show c.1111C>T	p.Arg others(4): Show p.Arg371*	ALOX5	ENSG00000012779.12	transcript	ENST00000374391.7	protein_coding	8/14	1175/2519	1111/2025	371/674		chr10	TogoVar
ALPK1_chr4_112292369_112447621	112431332	G G	A A	stop_gained stop_gained	HIGH	HG03516.hp1 HG03516.hp1	a0011 a0011	a0011c0022 a0011c0022	a0011c0022t0001 a0011c0022t0001	a0011c0022t0001g0091 a0011c0022t0001g0091	1	306	0.0033	0	c.178 others(4): Show c.1785G>A	p.Trp others(4): Show p.Trp595*	ALPK1	ENSG00000073331.18	transcript	ENST00000650871.1	protein_coding	11/16	2038/5399	1785/3735	595/1244		chr4	TogoVar
ALPK2_chr18_58476247_58634091	58504039	C C	A A	stop_gained stop_gained	HIGH	NA19076.hp2 NA19076.hp2	a0044 a0044	a0044c0060 a0044c0060	a0044c0060t0003 a0044c0060t0003	a0044c0060t0003g0205 a0044c0060t0003g0205	1	320	0.0031	0	c.613 others(4): Show c.6139G>T	p.Glu others(5): Show p.Glu2047*	ALPK2	ENSG00000198796.7	transcript	ENST00000361673.4	protein_coding	11/13	6487/7437	6139/6513	2047/2170		chr18	TogoVar

Search by Variant

Search

Search Results (Total: 3004 hits)