Joint Open Genome and Omics Platform (JoGo)

Search by Variant

Regionname

e.g. ALDH2_chr12_111761933_111822532, HBB_chr11_5220464_5232071.

Chr

Chromosome name (e.g., chr11).

Snpeff genename

Exact SnpEff gene name.

Sampleids

Target sampleid (e.g. HG02615).

Snpeff haplotype class

Haplotype-annotation class (e.g., ahapid, ahapid+chapid).

Snpeff annotation impact

Exact impact level (e.g., HIGH, MODERATE, LOW).

Snpeff annotation impact detail

Keyword match in SnpEff annotation.

Hapid

One or more haplotype IDs (comma-separated; e.g., a0001, a01, a0001c0001, a01c02, a1c2, a0001c0001t0005, a0001c0001t0005g0018).

Samplehapid

Sample haplotype IDs to include (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

No_hapid

Haplotype IDs to exclude (comma-separated; e.g., a0001, a0002, a0001c0001, a0001c0001t0005, a1, a01).

No_samplehapid

Sample haplotype IDs to exclude (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

Start

Start position (GRCh38).

End

End position (GRCh38).

Minac

Minimum alternate allele count (≥).

Maxac

Maximum alternate allele count (≤).

Minlen

Minimum variant length (≥).

Maxlen

Maximum variant length (≤).

Sort By

Select column to sort.

Order by

Ascending or descending.

Show

Results per page.

regionname	pos	ref	alt	annotation	impact	samples	ahapids	achapids	acthapids	actghapids	ac	an	af	len	hgvs_c	hgvs_p	genename	geneid	featuretype	featureid	transcript_biotype	rank	cdna cdna pos length	cds cds pos length	aa aa pos length	status	chr	external
CXorf49_chrX_71709371_71723285	71717024	G G	GC GC	frameshift_variant frameshift_variant	HIGH	HG00558.hp1 HG00558.hp1	a0007 a0007	a0007c0014 a0007c0014	a0007c0014t0001 a0007c0014t0001	a0007c0014t0001g0021 a0007c0014t0001g0021	1	73	0.0137	1	c.112 others(5): Show c.1127dupG	p.Ser others(5): Show p.Ser376fs	CXorf49	ENSG00000215115.7	transcript	ENST00000535490.3	protein_coding	1/6	1261/1854	1127/1545	376/514		chrX	TogoVar
CXorf49_chrX_71709371_71723285	71717059	TC TC	T T	frameshift_variant frameshift_variant	HIGH	HG00558.hp2 HG00558.hp2	a0006 a0006	a0006c0006 a0006c0006	a0006c0006t0001 a0006c0006t0001	a0006c0006t0001g0009 a0006c0006t0001g0009	1	73	0.0137	-1	c.109 others(5): Show c.1092delG	p.Met others(5): Show p.Met365fs	CXorf49	ENSG00000215115.7	transcript	ENST00000535490.3	protein_coding	1/6	1226/1854	1092/1545	364/514		chrX	TogoVar
CXorf49_chrX_71709371_71723285	71717087	C C	CG CG	frameshift_variant frameshift_variant	HIGH	HG00558.hp1 HG00558.hp1	a0007 a0007	a0007c0014 a0007c0014	a0007c0014t0001 a0007c0014t0001	a0007c0014t0001g0021 a0007c0014t0001g0021	1	73	0.0137	1	c.106 others(5): Show c.1064dupC	p.Pro others(5): Show p.Pro356fs	CXorf49	ENSG00000215115.7	transcript	ENST00000535490.3	protein_coding	1/6	1198/1854	1064/1545	355/514		chrX	TogoVar
CXorf49_chrX_71709371_71723285	71717163	T T	TGA TGA	frameshift_variant frameshift_variant	HIGH	HG00558.hp1 HG00558.hp1	a0007 a0007	a0007c0014 a0007c0014	a0007c0014t0001 a0007c0014t0001	a0007c0014t0001g0021 a0007c0014t0001g0021	1	73	0.0137	2	c.987 others(9): Show c.987_988dupTC	p.Gln others(5): Show p.Gln330fs	CXorf49	ENSG00000215115.7	transcript	ENST00000535490.3	protein_coding	1/6	1122/1854	988/1545	330/514		chrX	TogoVar
CXorf49_chrX_71709371_71723285	71717178	A A	AG AG	frameshift_variant frameshift_variant	HIGH	HG04184.hp1 HG04184.hp1	a0010 a0010	a0010c0009 a0010c0009	a0010c0009t0001 a0010c0009t0001	a0010c0009t0001g0012 a0010c0009t0001g0012	1	73	0.0137	1	c.973 others(4): Show c.973dupC	p.Leu others(5): Show p.Leu325fs	CXorf49	ENSG00000215115.7	transcript	ENST00000535490.3	protein_coding	1/6	1107/1854	973/1545	325/514		chrX	TogoVar
CXorf49_chrX_71709371_71723285	71717229	G G	GC GC	frameshift_variant frameshift_variant	HIGH	HG00558.hp1 HG00558.hp1	a0007 a0007	a0007c0014 a0007c0014	a0007c0014t0001 a0007c0014t0001	a0007c0014t0001g0021 a0007c0014t0001g0021	1	73	0.0137	1	c.922 others(4): Show c.922dupG	p.Ala others(5): Show p.Ala308fs	CXorf49	ENSG00000215115.7	transcript	ENST00000535490.3	protein_coding	1/6	1056/1854	922/1545	308/514		chrX	TogoVar
CXorf49_chrX_71709371_71723285	71717273	CT CT	C C	frameshift_variant frameshift_variant	HIGH	HG00558.hp1 HG00558.hp1	a0007 a0007	a0007c0014 a0007c0014	a0007c0014t0001 a0007c0014t0001	a0007c0014t0001g0021 a0007c0014t0001g0021	1	73	0.0137	-1	c.878 others(4): Show c.878delA	p.Lys others(5): Show p.Lys293fs	CXorf49	ENSG00000215115.7	transcript	ENST00000535490.3	protein_coding	1/6	1012/1854	878/1545	293/514		chrX	TogoVar
CXorf49_chrX_71709371_71723285	71717447	CT CT	C C	frameshift_variant frameshift_variant	HIGH	HG00558.hp2 HG00558.hp2	a0006 a0006	a0006c0006 a0006c0006	a0006c0006t0001 a0006c0006t0001	a0006c0006t0001g0009 a0006c0006t0001g0009	1	73	0.0137	-1	c.704 others(4): Show c.704delA	p.Lys others(5): Show p.Lys235fs	CXorf49	ENSG00000215115.7	transcript	ENST00000535490.3	protein_coding	1/6	838/1854	704/1545	235/514		chrX	TogoVar
CXorf49_chrX_71709371_71723285	71717545	C C	CGTGGGTA others(9): Show CGTGGGTAGGCAGCCTG	frameshift_variant frameshift_variant	HIGH	HG00621.hp1 HG00621.hp1	a0011 a0011	a0011c0008 a0011c0008	a0011c0008t0001 a0011c0008t0001	a0011c0008t0001g0011 a0011c0008t0001g0011	1	73	0.0137	16	c.591 others(23): Show c.591_606dupCAGGCTGCCTACCCAC	p.Asp others(5): Show p.Asp203fs	CXorf49	ENSG00000215115.7	transcript	ENST00000535490.3	protein_coding	1/6	740/1854	606/1545	202/514		chrX	TogoVar
CXorf49_chrX_71709371_71723285	71717657	A A	AG AG	frameshift_variant frameshift_variant	HIGH	HG00558.hp1 HG00558.hp1	a0007 a0007	a0007c0014 a0007c0014	a0007c0014t0001 a0007c0014t0001	a0007c0014t0001g0021 a0007c0014t0001g0021	1	73	0.0137	1	c.494 others(4): Show c.494dupC	p.Gly others(5): Show p.Gly166fs	CXorf49	ENSG00000215115.7	transcript	ENST00000535490.3	protein_coding	1/6	628/1854	494/1545	165/514		chrX	TogoVar
CXorf49_chrX_71709371_71723285	71717705	AG AG	A A	frameshift_variant frameshift_variant	HIGH	HG02683.hp1 HG02683.hp1	a0012 a0012	a0012c0005 a0012c0005	a0012c0005t0006 a0012c0005t0006	a0012c0005t0006g0026 a0012c0005t0006g0026	1	73	0.0137	-1	c.446 others(4): Show c.446delC	p.Pro others(5): Show p.Pro149fs	CXorf49	ENSG00000215115.7	transcript	ENST00000535490.3	protein_coding	1/6	580/1854	446/1545	149/514		chrX	TogoVar
CXorf49_chrX_71709371_71723285	71717913	CG CG	C C	frameshift_variant frameshift_variant	HIGH	HG00558.hp1 HG00558.hp1	a0007 a0007	a0007c0014 a0007c0014	a0007c0014t0001 a0007c0014t0001	a0007c0014t0001g0021 a0007c0014t0001g0021	1	73	0.0137	-1	c.238 others(4): Show c.238delC	p.Arg others(4): Show p.Arg80fs	CXorf49	ENSG00000215115.7	transcript	ENST00000535490.3	protein_coding	1/6	372/1854	238/1545	80/514		chrX	TogoVar
CXorf49_chrX_71709371_71723285	71717925	A A	AC AC	frameshift_variant frameshift_variant	HIGH	HG00558.hp1 HG00558.hp1	a0007 a0007	a0007c0014 a0007c0014	a0007c0014t0001 a0007c0014t0001	a0007c0014t0001g0021 a0007c0014t0001g0021	1	73	0.0137	1	c.226 others(4): Show c.226dupG	p.Val others(4): Show p.Val76fs	CXorf49	ENSG00000215115.7	transcript	ENST00000535490.3	protein_coding	1/6	360/1854	226/1545	76/514		chrX	TogoVar
CXorf49_chrX_71709371_71723285	71717947	AT AT	A A	frameshift_variant frameshift_variant	HIGH	HG00558.hp1 HG00558.hp1	a0007 a0007	a0007c0014 a0007c0014	a0007c0014t0001 a0007c0014t0001	a0007c0014t0001g0021 a0007c0014t0001g0021	1	73	0.0137	-1	c.204 others(4): Show c.204delA	p.Glu others(4): Show p.Glu68fs	CXorf49	ENSG00000215115.7	transcript	ENST00000535490.3	protein_coding	1/6	338/1854	204/1545	68/514		chrX	TogoVar
CXorf49_chrX_71709371_71723285	71717972	GC GC	G G	frameshift_variant frameshift_variant	HIGH	HG02683.hp1 HG02683.hp1	a0012 a0012	a0012c0005 a0012c0005	a0012c0005t0006 a0012c0005t0006	a0012c0005t0006g0026 a0012c0005t0006g0026	1	73	0.0137	-1	c.179 others(4): Show c.179delG	p.Gly others(4): Show p.Gly60fs	CXorf49	ENSG00000215115.7	transcript	ENST00000535490.3	protein_coding	1/6	313/1854	179/1545	60/514		chrX	TogoVar
CXorf49_chrX_71709371_71723285	71717989	A A	AC AC	frameshift_variant frameshift_variant	HIGH	HG00735.hp1 HG00735.hp1	a0013 a0013	a0013c0015 a0013c0015	a0013c0015t0001 a0013c0015t0001	a0013c0015t0001g0022 a0013c0015t0001g0022	1	73	0.0137	1	c.162 others(4): Show c.162dupG	p.Phe others(4): Show p.Phe55fs	CXorf49	ENSG00000215115.7	transcript	ENST00000535490.3	protein_coding	1/6	296/1854	162/1545	54/514		chrX	TogoVar
CXorf49_chrX_71709371_71723285	71718024	A A	AC AC	frameshift_variant frameshift_variant	HIGH	HG00558.hp2 HG00735.hp1 HG00558.hp2 HG00735.hp1	a0006 a0013 a0006 a0013	a0006c0006 a0013c0015 a0006c0006 a0013c0015	a0006c0006t0001 a0013c0015t0001 a0006c0006t0001 a0013c0015t0001	a0006c0006t0001g0009 a0013c0015t0001g0022 a0006c0006t0001g0009 a0013c0015t0001g0022	2	73	0.0274	1	c.127 others(4): Show c.127dupG	p.Val others(4): Show p.Val43fs	CXorf49	ENSG00000215115.7	transcript	ENST00000535490.3	protein_coding	1/6	261/1854	127/1545	43/514		chrX	TogoVar
CXorf49_chrX_71709371_71723285	71718024	AC AC	A A	frameshift_variant frameshift_variant	HIGH	HG02683.hp1 HG02683.hp1	a0012 a0012	a0012c0005 a0012c0005	a0012c0005t0006 a0012c0005t0006	a0012c0005t0006g0026 a0012c0005t0006g0026	1	73	0.0137	-1	c.127 others(4): Show c.127delG	p.Val others(4): Show p.Val43fs	CXorf49	ENSG00000215115.7	transcript	ENST00000535490.3	protein_coding	1/6	261/1854	127/1545	43/514		chrX	TogoVar
CXorf49_chrX_71709371_71723285	71718051	GC GC	G G	frameshift_variant frameshift_variant	HIGH	HG02683.hp1 HG02683.hp1	a0012 a0012	a0012c0005 a0012c0005	a0012c0005t0006 a0012c0005t0006	a0012c0005t0006g0026 a0012c0005t0006g0026	1	73	0.0137	-1	c.100 others(4): Show c.100delG	p.Ala others(4): Show p.Ala34fs	CXorf49	ENSG00000215115.7	transcript	ENST00000535490.3	protein_coding	1/6	234/1854	100/1545	34/514		chrX	TogoVar
CXorf49_chrX_71709371_71723285	71718123	C C	CA CA	frameshift_variant frameshift_variant	HIGH	HG00735.hp1 HG00735.hp1	a0013 a0013	a0013c0015 a0013c0015	a0013c0015t0001 a0013c0015t0001	a0013c0015t0001g0022 a0013c0015t0001g0022	1	73	0.0137	1	c.28d others(3): Show c.28dupT	p.Cys others(4): Show p.Cys10fs	CXorf49	ENSG00000215115.7	transcript	ENST00000535490.3	protein_coding	1/6	162/1854	28/1545	10/514		chrX	TogoVar
CXorf51A_chrX_146809106_146819744	146814334	G G	GT GT	frameshift_variant frameshift_variant	HIGH	HG01256.hp1 HG01256.hp1	a0006 a0006	a0006c0006 a0006c0006	a0006c0006t0001 a0006c0006t0001	a0006c0006t0001g0009 a0006c0006t0001g0009	1	264	0.0038	1	c.199 others(4): Show c.199dupA	p.Thr others(4): Show p.Thr67fs	CXorf51A	ENSG00000224440.2	transcript	ENST00000458472.2	protein_coding	2/2	220/449	199/327	67/108		chrX	TogoVar
CXorf51B_chrX_146804771_146815411	146809874	G G	GA GA	frameshift_variant frameshift_variant	HIGH	HG01975.hp2 HG01975.hp2	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0003 a0005c0005t0003	a0005c0005t0003g0008 a0005c0005t0003g0008	1	272	0.0037	1	c.83_ others(6): Show c.83_84insA	p.Lys others(4): Show p.Lys29fs	CXorf51B	ENSG00000235699.3	transcript	ENST00000438525.3	protein_coding	1/2	105/451	84/327	28/108		chrX	TogoVar
CXorf51B_chrX_146804771_146815411	146809890	AC AC	A A	frameshift_variant frameshift_variant	HIGH	NA18967.hp1 NA18967.hp1	a0006 a0006	a0006c0007 a0006c0007	a0006c0007t0001 a0006c0007t0001	a0006c0007t0001g0001 a0006c0007t0001g0001	1	272	0.0037	-1	c.103 others(4): Show c.103delC	p.Arg others(4): Show p.Arg35fs	CXorf51B	ENSG00000235699.3	transcript	ENST00000438525.3	protein_coding	1/2	124/451	103/327	35/108	INFO_REALIGN_3_PRIME	chrX	TogoVar
CXorf51B_chrX_146804771_146815411	146810252	GA GA	G G	frameshift_variant frameshift_variant	HIGH	NA18967.hp1 NA18967.hp1	a0006 a0006	a0006c0007 a0006c0007	a0006c0007t0001 a0006c0007t0001	a0006c0007t0001g0001 a0006c0007t0001g0001	1	272	0.0037	-1	c.277 others(4): Show c.277delA	p.Met others(4): Show p.Met93fs	CXorf51B	ENSG00000235699.3	transcript	ENST00000438525.3	protein_coding	2/2	298/451	277/327	93/108	INFO_REALIGN_3_PRIME	chrX	TogoVar
CXorf51B_chrX_146804771_146815411	146810278	CA CA	C C	frameshift_variant frameshift_variant	HIGH	HG01975.hp2 HG01975.hp2	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0003 a0005c0005t0003	a0005c0005t0003g0008 a0005c0005t0003g0008	1	272	0.0037	-1	c.300 others(4): Show c.300delA	p.Glu others(5): Show p.Glu101fs	CXorf51B	ENSG00000235699.3	transcript	ENST00000438525.3	protein_coding	2/2	321/451	300/327	100/108	INFO_REALIGN_3_PRIME	chrX	TogoVar
CXorf65_chrX_71098889_71111740	71104076	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19059.hp2 NA19059.hp2	a0006 a0006	a0006c0005 a0006c0005	a0006c0005t0001 a0006c0005t0001	a0006c0005t0001g0028 a0006c0005t0001g0028	1	287	0.0035	-1	c.462 others(4): Show c.462delC	p.Thr others(5): Show p.Thr155fs	CXorf65	ENSG00000204165.6	transcript	ENST00000374251.6	protein_coding	6/6	646/834	462/552	154/183		chrX	TogoVar
CXorf65_chrX_71098889_71111740	71104083	CT CT	C C	frameshift_variant frameshift_variant	HIGH	NA19059.hp2 NA19059.hp2	a0006 a0006	a0006c0005 a0006c0005	a0006c0005t0001 a0006c0005t0001	a0006c0005t0001g0028 a0006c0005t0001g0028	1	287	0.0035	-1	c.455 others(4): Show c.455delA	p.Lys others(5): Show p.Lys152fs	CXorf65	ENSG00000204165.6	transcript	ENST00000374251.6	protein_coding	6/6	639/834	455/552	152/183		chrX	TogoVar
CXorf65_chrX_71098889_71111740	71104377	AG AG	A A	frameshift_variant frameshift_variant	HIGH	NA19059.hp2 NA19059.hp2	a0006 a0006	a0006c0005 a0006c0005	a0006c0005t0001 a0006c0005t0001	a0006c0005t0001g0028 a0006c0005t0001g0028	1	287	0.0035	-1	c.346 others(4): Show c.346delC	p.Leu others(5): Show p.Leu116fs	CXorf65	ENSG00000204165.6	transcript	ENST00000374251.6	protein_coding	5/6	530/834	346/552	116/183		chrX	TogoVar
CXorf65_chrX_71098889_71111740	71104805	CA CA	C C	frameshift_variant frameshift_variant	HIGH	NA19059.hp2 NA19059.hp2	a0006 a0006	a0006c0005 a0006c0005	a0006c0005t0001 a0006c0005t0001	a0006c0005t0001g0028 a0006c0005t0001g0028	1	287	0.0035	-1	c.282 others(4): Show c.282delT	p.Phe others(4): Show p.Phe94fs	CXorf65	ENSG00000204165.6	transcript	ENST00000374251.6	protein_coding	4/6	466/834	282/552	94/183		chrX	TogoVar
CXorf65_chrX_71098889_71111740	71106377	C C	CA CA	frameshift_variant frameshift_variant	HIGH	NA18999.hp2 NA18999.hp2	a0003 a0003	a0003c0008 a0003c0008	a0003c0008t0002 a0003c0008t0002	a0003c0008t0002g0034 a0003c0008t0002g0034	1	287	0.0035	1	c.74d others(3): Show c.74dupT	p.Tyr others(4): Show p.Tyr26fs	CXorf65	ENSG00000204165.6	transcript	ENST00000374251.6	protein_coding	2/6	258/834	74/552	25/183		chrX	TogoVar
CYLC1_chrX_83856146_83891698	83873280	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19058.hp1 NA19058.hp1	a0007 a0007	a0007c0008 a0007c0008	a0007c0008t0001 a0007c0008t0001	a0007c0008t0001g0174 a0007c0008t0001g0174	1	208	0.0048	1	c.573 others(4): Show c.573dupC	p.Ser others(5): Show p.Ser192fs	CYLC1	ENSG00000183035.13	transcript	ENST00000329312.5	protein_coding	4/5	611/2107	574/1956	192/651	INFO_REALIGN_3_PRIME	chrX	TogoVar
CYLC1_chrX_83856146_83891698	83873316	CA CA	C C	frameshift_variant frameshift_variant	HIGH	NA19030.hp1 NA19030.hp1	a0012 a0012	a0012c0014 a0012c0014	a0012c0014t0001 a0012c0014t0001	a0012c0014t0001g0142 a0012c0014t0001g0142	1	208	0.0048	-1	c.611 others(4): Show c.611delA	p.Lys others(5): Show p.Lys204fs	CYLC1	ENSG00000183035.13	transcript	ENST00000329312.5	protein_coding	4/5	648/2107	611/1956	204/651	INFO_REALIGN_3_PRIME	chrX	TogoVar
CYLC1_chrX_83856146_83891698	83873404	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA19030.hp1 NA19030.hp1	a0012 a0012	a0012c0014 a0012c0014	a0012c0014t0001 a0012c0014t0001	a0012c0014t0001g0142 a0012c0014t0001g0142	1	208	0.0048	-1	c.699 others(4): Show c.699delC	p.Ile others(5): Show p.Ile234fs	CYLC1	ENSG00000183035.13	transcript	ENST00000329312.5	protein_coding	4/5	736/2107	699/1956	233/651	INFO_REALIGN_3_PRIME	chrX	TogoVar
CYLC1_chrX_83856146_83891698	83873460	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19030.hp1 NA19030.hp1	a0012 a0012	a0012c0014 a0012c0014	a0012c0014t0001 a0012c0014t0001	a0012c0014t0001g0142 a0012c0014t0001g0142	1	208	0.0048	1	c.755 others(4): Show c.755dupG	p.Gln others(5): Show p.Gln253fs	CYLC1	ENSG00000183035.13	transcript	ENST00000329312.5	protein_coding	4/5	793/2107	756/1956	252/651	INFO_REALIGN_3_PRIME	chrX	TogoVar
CYLC1_chrX_83856146_83891698	83873761	G G	GA GA	frameshift_variant frameshift_variant	HIGH	NA19030.hp1 NA19030.hp1	a0012 a0012	a0012c0014 a0012c0014	a0012c0014t0001 a0012c0014t0001	a0012c0014t0001g0142 a0012c0014t0001g0142	1	208	0.0048	1	c.105 others(5): Show c.1059dupA	p.Leu others(5): Show p.Leu354fs	CYLC1	ENSG00000183035.13	transcript	ENST00000329312.5	protein_coding	4/5	1097/2107	1060/1956	354/651	INFO_REALIGN_3_PRIME	chrX	TogoVar
CYLC1_chrX_83856146_83891698	83873761	GA GA	G G	frameshift_variant frameshift_variant	HIGH	NA19081.hp1 NA19081.hp1	a0010 a0010	a0010c0011 a0010c0011	a0010c0011t0001 a0010c0011t0001	a0010c0011t0001g0025 a0010c0011t0001g0025	1	208	0.0048	-1	c.105 others(5): Show c.1059delA	p.Lys others(5): Show p.Lys353fs	CYLC1	ENSG00000183035.13	transcript	ENST00000329312.5	protein_coding	4/5	1096/2107	1059/1956	353/651	INFO_REALIGN_3_PRIME	chrX	TogoVar
CYLC1_chrX_83856146_83891698	83873773	GA GA	G G	frameshift_variant frameshift_variant	HIGH	NA19030.hp1 NA19030.hp1	a0012 a0012	a0012c0014 a0012c0014	a0012c0014t0001 a0012c0014t0001	a0012c0014t0001g0142 a0012c0014t0001g0142	1	208	0.0048	-1	c.106 others(5): Show c.1068delA	p.Asp others(5): Show p.Asp357fs	CYLC1	ENSG00000183035.13	transcript	ENST00000329312.5	protein_coding	4/5	1105/2107	1068/1956	356/651	INFO_REALIGN_3_PRIME	chrX	TogoVar
CYLC1_chrX_83856146_83891698	83873810	G G	GA GA	frameshift_variant frameshift_variant	HIGH	NA19082.hp1 NA19082.hp1	a0008 a0008	a0008c0012 a0008c0012	a0008c0012t0001 a0008c0012t0001	a0008c0012t0001g0063 a0008c0012t0001g0063	1	208	0.0048	1	c.110 others(5): Show c.1103dupA	p.Ser others(5): Show p.Ser369fs	CYLC1	ENSG00000183035.13	transcript	ENST00000329312.5	protein_coding	4/5	1141/2107	1104/1956	368/651	INFO_REALIGN_3_PRIME	chrX	TogoVar
CYLC1_chrX_83856146_83891698	83873911	GA GA	G G	frameshift_variant frameshift_variant	HIGH	NA19082.hp1 NA19082.hp1	a0008 a0008	a0008c0012 a0008c0012	a0008c0012t0001 a0008c0012t0001	a0008c0012t0001g0063 a0008c0012t0001g0063	1	208	0.0048	-1	c.120 others(5): Show c.1207delA	p.Ile others(5): Show p.Ile403fs	CYLC1	ENSG00000183035.13	transcript	ENST00000329312.5	protein_coding	4/5	1244/2107	1207/1956	403/651	INFO_REALIGN_3_PRIME	chrX	TogoVar
CYLC1_chrX_83856146_83891698	83873972	G G	GA GA	frameshift_variant frameshift_variant	HIGH	NA19082.hp1 NA19082.hp1	a0008 a0008	a0008c0012 a0008c0012	a0008c0012t0001 a0008c0012t0001	a0008c0012t0001g0063 a0008c0012t0001g0063	1	208	0.0048	1	c.127 others(5): Show c.1271dupA	p.Asp others(5): Show p.Asp425fs	CYLC1	ENSG00000183035.13	transcript	ENST00000329312.5	protein_coding	4/5	1309/2107	1272/1956	424/651	INFO_REALIGN_3_PRIME	chrX	TogoVar
CYLC1_chrX_83856146_83891698	83874094	G G	GAAGA GAAGA	frameshift_variant frameshift_variant	HIGH	NA19030.hp1 NA19030.hp1	a0012 a0012	a0012c0014 a0012c0014	a0012c0014t0001 a0012c0014t0001	a0012c0014t0001g0142 a0012c0014t0001g0142	1	208	0.0048	4	c.138 others(13): Show c.1389_1390insAAAG	p.Gly others(5): Show p.Gly464fs	CYLC1	ENSG00000183035.13	transcript	ENST00000329312.5	protein_coding	4/5	1427/2107	1390/1956	464/651	INFO_REALIGN_3_PRIME	chrX	TogoVar
CYLC1_chrX_83856146_83891698	83874204	CA CA	C C	frameshift_variant frameshift_variant	HIGH	NA19030.hp1 NA19030.hp1	a0012 a0012	a0012c0014 a0012c0014	a0012c0014t0001 a0012c0014t0001	a0012c0014t0001g0142 a0012c0014t0001g0142	1	208	0.0048	-1	c.149 others(5): Show c.1499delA	p.Lys others(5): Show p.Lys500fs	CYLC1	ENSG00000183035.13	transcript	ENST00000329312.5	protein_coding	4/5	1536/2107	1499/1956	500/651	INFO_REALIGN_3_PRIME	chrX	TogoVar
CYLC1_chrX_83856146_83891698	83874358	T T	TA TA	frameshift_variant frameshift_variant	HIGH	NA19058.hp1 NA19058.hp1	a0007 a0007	a0007c0008 a0007c0008	a0007c0008t0001 a0007c0008t0001	a0007c0008t0001g0174 a0007c0008t0001g0174	1	208	0.0048	1	c.165 others(5): Show c.1653dupA	p.Pro others(5): Show p.Pro552fs	CYLC1	ENSG00000183035.13	transcript	ENST00000329312.5	protein_coding	4/5	1691/2107	1654/1956	552/651	INFO_REALIGN_3_PRIME	chrX	TogoVar
CYLC1_chrX_83856146_83891698	83874364	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19030.hp1 NA19030.hp1	a0012 a0012	a0012c0014 a0012c0014	a0012c0014t0001 a0012c0014t0001	a0012c0014t0001g0142 a0012c0014t0001g0142	1	208	0.0048	1	c.166 others(5): Show c.1660dupG	p.Ala others(5): Show p.Ala554fs	CYLC1	ENSG00000183035.13	transcript	ENST00000329312.5	protein_coding	4/5	1698/2107	1661/1956	554/651	INFO_REALIGN_3_PRIME	chrX	TogoVar
CYLC1_chrX_83856146_83891698	83874556	AC AC	A A	frameshift_variant frameshift_variant	HIGH	NA19058.hp1 NA19058.hp1	a0007 a0007	a0007c0008 a0007c0008	a0007c0008t0001 a0007c0008t0001	a0007c0008t0001g0174 a0007c0008t0001g0174	1	208	0.0048	-1	c.185 others(5): Show c.1850delC	p.Pro others(5): Show p.Pro617fs	CYLC1	ENSG00000183035.13	transcript	ENST00000329312.5	protein_coding	4/5	1887/2107	1850/1956	617/651	INFO_REALIGN_3_PRIME	chrX	TogoVar
CYP21A2_chr6_32033415_32046644	32039385	GGCCATTG others(4): Show GGCCATTGAGGA	G G	frameshift_variant frameshift_variant	HIGH	NA19058.hp2 NA19058.hp2	a0030 a0030	a0030c0035 a0030c0035	a0030c0035t0001 a0030c0035t0001	a0030c0035t0001g0001 a0030c0035t0001g0001	1	459	0.0022	-11	c.479 others(18): Show c.479_489delCCATTGAGGAG	p.Ala others(5): Show p.Ala160fs	CYP21A2	ENSG00000231852.9	transcript	ENST00000644719.2	protein_coding	4/10	487/2006	479/1488	160/495	INFO_REALIGN_3_PRIME	chr6	TogoVar
CYP21A2_chr6_32033415_32046644	32040182	G G	GT GT	frameshift_variant frameshift_variant	HIGH	HG00544.hp1 HG00738.hp1 HG03688.hp1 others(6): Show HG00544.hp1 HG00738.hp1 HG03688.hp1 NA18978.hp1 NA18981.hp1 NA18987.hp2 NA19058.hp2 NA19062.hp1 NA19067.hp1	a0011 a0017 a0027 others(2): Show a0011 a0017 a0027 a0028 a0030	a0011c0023 a0011c0024 a0017c0052 others(4): Show a0011c0023 a0011c0024 a0017c0052 a0017c0053 a0027c0056 a0028c0042 a0030c0035	a0011c0023t0001 a0011c0024t0001 a0017c0052t0002 others(4): Show a0011c0023t0001 a0011c0024t0001 a0017c0052t0002 a0017c0053t0001 a0027c0056t0001 a0028c0042t0001 a0030c0035t0001	a0011c0023t0001g0011 a0011c0023t0001g0016 a0011c0024t0001g0001 others(5): Show a0011c0023t0001g0011 a0011c0023t0001g0016 a0011c0024t0001g0001 a0017c0052t0002g0023 a0017c0053t0001g0022 a0027c0056t0001g0017 a0028c0042t0001g0056 a0030c0035t0001g0001	9	459	0.0196	1	c.923 others(4): Show c.923dupT	p.Leu others(5): Show p.Leu308fs	CYP21A2	ENSG00000231852.9	transcript	ENST00000644719.2	protein_coding	7/10	932/2006	924/1488	308/495	INFO_REALIGN_3_PRIME	chr6	TogoVar
CYP2F1_chr19_41109432_41133381	41116202	G G	GC GC	frameshift_variant frameshift_variant	HIGH	HG00099.hp1 HG00099.hp2 HG00280.hp1 others(111): Show HG00099.hp1 HG00099.hp2 HG00280.hp1 HG00438.hp2 HG00544.hp2 HG00558.hp1 HG00558.hp2 HG00621.hp2 HG00642.hp2 HG00733.hp1 HG00738.hp1 HG00738.hp2 HG01081.hp1 HG01081.hp2 HG01099.hp1 HG01099.hp2 HG01123.hp2 HG01175.hp2 HG01884.hp1 HG01891.hp2 HG01928.hp1 HG01943.hp2 HG01952.hp1 HG02027.hp1 HG02109.hp1 HG02109.hp2 HG02135.hp2 HG02145.hp1 HG02145.hp2 HG02155.hp2 HG02257.hp1 HG02258.hp1 HG02258.hp2 HG02451.hp2 HG02559.hp2 HG02615.hp1 HG02622.hp1 HG02622.hp2 HG02630.hp2 HG02647.hp1 HG02683.hp2 HG02738.hp1 HG02818.hp2 HG02886.hp2 HG02895.hp2 HG02896.hp2 HG02897.hp1 HG02922.hp1 HG02965.hp1 HG02970.hp1 HG02976.hp2 HG03017.hp2 HG03098.hp1 HG03130.hp1 HG03195.hp1 HG03195.hp2 HG03209.hp2 HG03225.hp1 HG03453.hp1 HG03453.hp2 HG03486.hp2 HG03491.hp1 HG03492.hp1 HG03516.hp2 HG03540.hp2 HG03669.hp2 HG03688.hp2 HG03704.hp2 HG03710.hp2 HG03834.hp1 HG03942.hp1 HG04184.hp1 HG04199.hp2 HG04204.hp1 HG04228.hp1 HG04228.hp2 NA18522.hp1 NA18612.hp2 NA18747.hp1 NA18747.hp2 NA18906.hp1 NA18942.hp1 NA18944.hp1 NA18945.hp1 NA18948.hp2 NA18952.hp2 NA18961.hp1 NA18962.hp2 NA18967.hp1 NA18969.hp1 NA18970.hp1 NA18977.hp1 NA18981.hp1 NA18981.hp2 NA18982.hp2 NA18985.hp2 NA18986.hp2 NA18995.hp1 NA19005.hp2 NA19043.hp1 NA19043.hp2 NA19060.hp2 NA19065.hp1 NA19070.hp2 NA19074.hp1 NA19080.hp1 NA19083.hp1 NA19083.hp2 NA19240.hp2 NA20129.hp2 NA20300.hp1 NA20805.hp2 NA21309.hp1 NA21309.hp2	a0002 a0013 a0002 a0013	a0002c0002 a0002c0003 a0002c0005 others(11): Show a0002c0002 a0002c0003 a0002c0005 a0002c0010 a0002c0017 a0002c0018 a0002c0019 a0002c0028 a0002c0029 a0002c0030 a0002c0031 a0002c0032 a0002c0033 a0013c0034	a0002c0002t0001 a0002c0002t0002 a0002c0002t0011 others(17): Show a0002c0002t0001 a0002c0002t0002 a0002c0002t0011 a0002c0002t0017 a0002c0003t0003 a0002c0005t0002 a0002c0005t0006 a0002c0005t0010 a0002c0005t0014 a0002c0010t0003 a0002c0017t0002 a0002c0018t0003 a0002c0019t0002 a0002c0028t0003 a0002c0029t0003 a0002c0030t0002 a0002c0031t0002 a0002c0032t0002 a0002c0033t0002 a0013c0034t0002	a0002c0002t0001g0063 a0002c0002t0002g0002 a0002c0002t0002g0003 others(101): Show a0002c0002t0001g0063 a0002c0002t0002g0002 a0002c0002t0002g0003 a0002c0002t0002g0008 a0002c0002t0002g0009 a0002c0002t0002g0010 a0002c0002t0002g0052 a0002c0002t0002g0055 a0002c0002t0002g0056 a0002c0002t0002g0057 a0002c0002t0002g0058 a0002c0002t0002g0059 a0002c0002t0002g0060 a0002c0002t0002g0061 a0002c0002t0002g0062 a0002c0002t0002g0064 a0002c0002t0002g0065 a0002c0002t0002g0066 a0002c0002t0002g0067 a0002c0002t0002g0069 a0002c0002t0002g0071 a0002c0002t0002g0072 a0002c0002t0002g0073 a0002c0002t0002g0074 a0002c0002t0002g0075 a0002c0002t0002g0076 a0002c0002t0002g0078 a0002c0002t0002g0079 a0002c0002t0002g0080 a0002c0002t0002g0081 a0002c0002t0002g0082 a0002c0002t0002g0083 a0002c0002t0002g0084 a0002c0002t0002g0085 a0002c0002t0002g0086 a0002c0002t0002g0087 a0002c0002t0002g0088 a0002c0002t0002g0089 a0002c0002t0002g0090 a0002c0002t0002g0092 a0002c0002t0002g0127 a0002c0002t0011g0009 a0002c0002t0017g0123 a0002c0003t0003g0013 a0002c0003t0003g0014 a0002c0003t0003g0093 a0002c0003t0003g0094 a0002c0003t0003g0095 a0002c0003t0003g0096 a0002c0003t0003g0097 a0002c0003t0003g0116 a0002c0003t0003g0117 a0002c0003t0003g0118 a0002c0003t0003g0125 a0002c0003t0003g0128 a0002c0003t0003g0130 a0002c0003t0003g0131 a0002c0003t0003g0132 a0002c0003t0003g0133 a0002c0003t0003g0134 a0002c0003t0003g0135 a0002c0003t0003g0136 a0002c0003t0003g0138 a0002c0003t0003g0140 a0002c0003t0003g0141 a0002c0003t0003g0151 a0002c0003t0003g0152 a0002c0005t0002g0006 a0002c0005t0002g0007 a0002c0005t0002g0025 a0002c0005t0002g0026 a0002c0005t0002g0031 a0002c0005t0002g0032 a0002c0005t0002g0033 a0002c0005t0006g0110 a0002c0005t0006g0111 a0002c0005t0006g0112 a0002c0005t0006g0113 a0002c0005t0006g0119 a0002c0005t0006g0120 a0002c0005t0006g0148 a0002c0005t0006g0149 a0002c0005t0010g0007 a0002c0005t0010g0037 a0002c0005t0010g0039 a0002c0005t0014g0035 a0002c0010t0003g0129 a0002c0010t0003g0137 a0002c0010t0003g0139 a0002c0010t0003g0142 a0002c0010t0003g0156 a0002c0017t0002g0053 a0002c0017t0002g0068 a0002c0018t0003g0109 a0002c0018t0003g0122 a0002c0019t0002g0036 a0002c0019t0002g0038 a0002c0028t0003g0115 a0002c0029t0003g0114 a0002c0030t0002g0077 a0002c0031t0002g0034 a0002c0032t0002g0070 a0002c0033t0002g0054 a0013c0034t0002g0091	114	374	0.3048	1	c.15d others(3): Show c.15dupC	p.Thr others(3): Show p.Thr6fs	CYP2F1	ENSG00000197446.9	transcript	ENST00000331105.7	protein_coding	2/10	88/1847	16/1476	6/491	INFO_REALIGN_3_PRIME	chr19	TogoVar
CYP2S1_chr19_41188219_41212539	41193242	GGAGAAGG others(12): Show GGAGAAGGAGCCGACCTGCC	G G	frameshift_variant others(1): Show frameshift_variant start_lost	HIGH	HG02132.hp2 HG02132.hp2	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0019 a0001c0001t0019	a0001c0001t0019g0004 a0001c0001t0019g0004	1	422	0.0024	-19	c.-18 others(24): Show c.-18_1delAGGAGCCGACCTGCCGAGA	p.Met others(3): Show p.Met1fs	CYP2S1	ENSG00000167600.14	transcript	ENST00000310054.9	protein_coding	1/9	29/2612	1/1515	1/504	INFO_REALIGN_3_PRIME	chr19	TogoVar
CYP3A43_chr7_99823013_99871093	99836454	TA TA	T T	frameshift_variant others(1): Show frameshift_variant splice_region_variant	HIGH	HG01109.hp2 HG01516.hp1 HG01517.hp1 others(34): Show HG01109.hp2 HG01516.hp1 HG01517.hp1 HG02055.hp1 HG02055.hp2 HG02258.hp2 HG02559.hp1 HG02559.hp2 HG02615.hp1 HG02615.hp2 HG02647.hp1 HG02886.hp1 HG02895.hp2 HG02896.hp1 HG02897.hp1 HG02897.hp2 HG02922.hp1 HG02970.hp2 HG03041.hp1 HG03041.hp2 HG03130.hp1 HG03130.hp2 HG03195.hp1 HG03209.hp1 HG03471.hp2 HG03516.hp1 HG03516.hp2 HG03654.hp1 HG03669.hp2 HG03831.hp2 HG04199.hp1 HG06807.hp1 NA19030.hp1 NA19043.hp1 NA19043.hp2 NA19240.hp1 NA21309.hp1	a0002 a0002	a0002c0002 a0002c0010 a0002c0011 others(3): Show a0002c0002 a0002c0010 a0002c0011 a0002c0014 a0002c0015 a0002c0019	a0002c0002t0001 a0002c0010t0001 a0002c0011t0001 others(3): Show a0002c0002t0001 a0002c0010t0001 a0002c0011t0001 a0002c0014t0001 a0002c0015t0001 a0002c0019t0001	a0002c0002t0001g0037 a0002c0002t0001g0039 a0002c0002t0001g0040 others(28): Show a0002c0002t0001g0037 a0002c0002t0001g0039 a0002c0002t0001g0040 a0002c0002t0001g0187 a0002c0002t0001g0188 a0002c0002t0001g0189 a0002c0002t0001g0190 a0002c0002t0001g0191 a0002c0002t0001g0193 a0002c0002t0001g0194 a0002c0002t0001g0195 a0002c0002t0001g0196 a0002c0002t0001g0197 a0002c0002t0001g0198 a0002c0002t0001g0199 a0002c0002t0001g0201 a0002c0002t0001g0202 a0002c0002t0001g0203 a0002c0002t0001g0204 a0002c0002t0001g0205 a0002c0002t0001g0206 a0002c0002t0001g0211 a0002c0002t0001g0212 a0002c0010t0001g0035 a0002c0010t0001g0180 a0002c0011t0001g0036 a0002c0011t0001g0181 a0002c0014t0001g0182 a0002c0014t0001g0192 a0002c0015t0001g0038 a0002c0019t0001g0200	37	326	0.1135	-1	c.74d others(3): Show c.74delA	p.Tyr others(4): Show p.Tyr25fs	CYP3A43	ENSG00000021461.18	transcript	ENST00000354829.7	protein_coding	2/13	177/1707	74/1512	25/503		chr7	TogoVar

Search by Variant

Search

Search Results (Total: 5828 hits)