Joint Open Genome and Omics Platform (JoGo)

Search by Variant

Regionname

e.g. ALDH2_chr12_111761933_111822532, HBB_chr11_5220464_5232071.

Chr

Chromosome name (e.g., chr11).

Snpeff genename

Exact SnpEff gene name.

Sampleids

Target sampleid (e.g. HG02615).

Snpeff haplotype class

Haplotype-annotation class (e.g., ahapid, ahapid+chapid).

Snpeff annotation impact

Exact impact level (e.g., HIGH, MODERATE, LOW).

Snpeff annotation impact detail

Keyword match in SnpEff annotation.

Hapid

One or more haplotype IDs (comma-separated; e.g., a0001, a01, a0001c0001, a01c02, a1c2, a0001c0001t0005, a0001c0001t0005g0018).

Samplehapid

Sample haplotype IDs to include (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

No_hapid

Haplotype IDs to exclude (comma-separated; e.g., a0001, a0002, a0001c0001, a0001c0001t0005, a1, a01).

No_samplehapid

Sample haplotype IDs to exclude (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

Start

Start position (GRCh38).

End

End position (GRCh38).

Minac

Minimum alternate allele count (≥).

Maxac

Maximum alternate allele count (≤).

Minlen

Minimum variant length (≥).

Maxlen

Maximum variant length (≤).

Sort By

Select column to sort.

Order by

Ascending or descending.

Show

Results per page.

regionname	pos	ref	alt	annotation	impact	samples	ahapids	achapids	acthapids	actghapids	ac	an	af	len	hgvs_c	hgvs_p	genename	geneid	featuretype	featureid	transcript_biotype	rank	cdna cdna pos length	cds cds pos length	aa aa pos length	status	chr	external
ESX1_chrX_104245038_104259933	104254219	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA19072.hp1 NA19072.hp1	a0036 a0036	a0036c0039 a0036c0039	a0036c0039t0003 a0036c0039t0003	a0036c0039t0003g0029 a0036c0039t0003g0029	1	313	0.0032	1	c.440 others(4): Show c.440dupC	p.Gln others(5): Show p.Gln148fs	ESX1	ENSG00000123576.5	transcript	ENST00000372588.4	protein_coding	2/4	524/1495	440/1221	147/406		chrX	TogoVar
ESX1_chrX_104245038_104259933	104254261	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19067.hp1 NA19067.hp1	a0035 a0035	a0035c0038 a0035c0038	a0035c0038t0001 a0035c0038t0001	a0035c0038t0001g0077 a0035c0038t0001g0077	1	313	0.0032	1	c.398 others(4): Show c.398dupC	p.Gln others(5): Show p.Gln134fs	ESX1	ENSG00000123576.5	transcript	ENST00000372588.4	protein_coding	2/4	482/1495	398/1221	133/406		chrX	TogoVar
ESX1_chrX_104245038_104259933	104254299	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19067.hp1 NA19067.hp1	a0035 a0035	a0035c0038 a0035c0038	a0035c0038t0001 a0035c0038t0001	a0035c0038t0001g0077 a0035c0038t0001g0077	1	313	0.0032	-1	c.360 others(4): Show c.360delG	p.Pro others(5): Show p.Pro121fs	ESX1	ENSG00000123576.5	transcript	ENST00000372588.4	protein_coding	2/4	444/1495	360/1221	120/406		chrX	TogoVar
ESX1_chrX_104245038_104259933	104254316	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19072.hp1 NA19072.hp1	a0036 a0036	a0036c0039 a0036c0039	a0036c0039t0003 a0036c0039t0003	a0036c0039t0003g0029 a0036c0039t0003g0029	1	313	0.0032	-1	c.343 others(4): Show c.343delC	p.Gln others(5): Show p.Gln115fs	ESX1	ENSG00000123576.5	transcript	ENST00000372588.4	protein_coding	2/4	427/1495	343/1221	115/406		chrX	TogoVar
ESX1_chrX_104245038_104259933	104254371	G G	GT GT	frameshift_variant frameshift_variant	HIGH	NA19067.hp1 NA19067.hp1	a0035 a0035	a0035c0038 a0035c0038	a0035c0038t0001 a0035c0038t0001	a0035c0038t0001g0077 a0035c0038t0001g0077	1	313	0.0032	1	c.288 others(4): Show c.288dupA	p.Gln others(4): Show p.Gln97fs	ESX1	ENSG00000123576.5	transcript	ENST00000372588.4	protein_coding	2/4	372/1495	288/1221	96/406		chrX	TogoVar
ESX1_chrX_104245038_104259933	104254442	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19067.hp1 NA19067.hp1	a0035 a0035	a0035c0038 a0035c0038	a0035c0038t0001 a0035c0038t0001	a0035c0038t0001g0077 a0035c0038t0001g0077	1	313	0.0032	1	c.217 others(4): Show c.217dupG	p.Asp others(4): Show p.Asp73fs	ESX1	ENSG00000123576.5	transcript	ENST00000372588.4	protein_coding	2/4	301/1495	217/1221	73/406		chrX	TogoVar
ESX1_chrX_104245038_104259933	104254464	AC AC	A A	frameshift_variant frameshift_variant	HIGH	NA19072.hp1 NA19072.hp1	a0036 a0036	a0036c0039 a0036c0039	a0036c0039t0003 a0036c0039t0003	a0036c0039t0003g0029 a0036c0039t0003g0029	1	313	0.0032	-1	c.195 others(4): Show c.195delG	p.Ser others(4): Show p.Ser66fs	ESX1	ENSG00000123576.5	transcript	ENST00000372588.4	protein_coding	2/4	279/1495	195/1221	65/406		chrX	TogoVar
ESX1_chrX_104245038_104259933	104254845	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19072.hp1 NA19072.hp1	a0036 a0036	a0036c0039 a0036c0039	a0036c0039t0003 a0036c0039t0003	a0036c0039t0003g0029 a0036c0039t0003g0029	1	313	0.0032	1	c.4du others(2): Show c.4dupG	p.Glu others(3): Show p.Glu2fs	ESX1	ENSG00000123576.5	transcript	ENST00000372588.4	protein_coding	1/4	88/1495	4/1221	2/406		chrX	TogoVar
ESYT3_chr3_138429616_138484925	138476246	A A	AGGGAAGT others(3): Show AGGGAAGTGGG	frameshift_variant frameshift_variant	HIGH	HG02735.hp2 HG02735.hp2	a0012 a0012	a0012c0020 a0012c0020	a0012c0020t0001 a0012c0020t0001	a0012c0020t0001g0178 a0012c0020t0001g0178	1	338	0.0030	10	c.249 others(19): Show c.2492_2493insGGGAAGTGGG	p.Glu others(5): Show p.Glu832fs	ESYT3	ENSG00000158220.14	transcript	ENST00000389567.9	protein_coding	21/23	2676/5915	2493/2661	831/886		chr3	TogoVar
ESYT3_chr3_138429616_138484925	138476269	GATGTTGC others(34): Show GATGTTGCAGTGAAAAATAGTAGGCCACTTGGCTCACACAGA	G G	frameshift_variant frameshift_variant	HIGH	HG02735.hp2 HG02735.hp2	a0012 a0012	a0012c0020 a0012c0020	a0012c0020t0001 a0012c0020t0001	a0012c0020t0001g0178 a0012c0020t0001g0178	1	338	0.0030	-41	c.251 others(50): Show c.2517_2557delTGTTGCAGTGAAAAATAGTAGGCCACTTGGCTCACA CAGAA	p.Asp others(5): Show p.Asp839fs	ESYT3	ENSG00000158220.14	transcript	ENST00000389567.9	protein_coding	21/23	2700/5915	2517/2661	839/886	INFO_REALIGN_3_PRIME	chr3	TogoVar
ESYT3_chr3_138429616_138484925	138476480	G G	GGGGGGGG others(4): Show GGGGGGGGTATT	frameshift_variant frameshift_variant	HIGH	HG02735.hp2 HG02735.hp2	a0012 a0012	a0012c0020 a0012c0020	a0012c0020t0001 a0012c0020t0001	a0012c0020t0001g0178 a0012c0020t0001g0178	1	338	0.0030	11	c.261 others(20): Show c.2612_2613insGGGGGGGTATT	p.Phe others(5): Show p.Phe872fs	ESYT3	ENSG00000158220.14	transcript	ENST00000389567.9	protein_coding	22/23	2796/5915	2613/2661	871/886		chr3	TogoVar
EVA1C_chr21_32407706_32520387	32514930	C C	CTGGGGAG others(72): Show CTGGGGAGGGAGCAGCAGAGTTCCTGGTGAGCGTCTCAGCCTGTACTTGC CGAGTTCGCTAAGGACTGTGCTCGGTCGAG	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA19090.hp2 NA19090.hp2	a0009 a0009	a0009c0019 a0009c0019	a0009c0019t0001 a0009c0019t0001	a0009c0019t0001g0223 a0009c0019t0001g0223	1	346	0.0029	79	c.108 others(88): Show c.1081_1082insAGAGTTCCTGGTGAGCGTCTCAGCCTGTACTTGCCG AGTTCGCTAAGGACTGTGCTCGGTCGAGTGGGGAGGGAGCAGC	p.Leu others(5): Show p.Leu361fs	EVA1C	ENSG00000166979.13	transcript	ENST00000300255.7	protein_coding	8/8	1230/1671	1082/1326	361/441	INFO_REALIGN_3_PRIME	chr21	TogoVar
EXO5_chr1_40503767_40521038	40515335	CTG CTG	C C	frameshift_variant frameshift_variant	HIGH	HG00558.hp1 HG00597.hp1 HG00609.hp1 others(15): Show HG00558.hp1 HG00597.hp1 HG00609.hp1 HG00609.hp2 HG00673.hp1 HG02040.hp2 HG02071.hp1 HG02132.hp1 NA18612.hp2 NA18939.hp2 NA18955.hp1 NA18964.hp1 NA19056.hp2 NA19068.hp1 NA19076.hp2 NA19078.hp1 NA19086.hp1 NA19090.hp2	a0004 a0004	a0004c0004 a0004c0004	a0004c0004t0002 a0004c0004t0002	a0004c0004t0002g0002 a0004c0004t0002g0048 a0004c0004t0002g0050 a0004c0004t0002g0002 a0004c0004t0002g0048 a0004c0004t0002g0050	18	406	0.0443	-2	c.794 others(9): Show c.794_795delTG	p.Val others(5): Show p.Val265fs	EXO5	ENSG00000164002.12	transcript	ENST00000415550.6	protein_coding	4/4	1199/1899	794/1122	265/373	INFO_REALIGN_3_PRIME	chr1	TogoVar
EXOC3L4_chr14_103089725_103115559	103107409	C C	CCCCTCTG others(15): Show CCCCTCTGTCCCCAGCCGCTCTT	frameshift_variant frameshift_variant	HIGH	NA18984.hp2 NA18984.hp2	a0002 a0002	a0002c0007 a0002c0007	a0002c0007t0003 a0002c0007t0003	a0002c0007t0003g0073 a0002c0007t0003g0073	1	404	0.0025	22	c.158 others(34): Show c.1582-13_1590dupCCTCTGTCCCCAGCCGCTCTTC	p.Arg others(5): Show p.Arg531fs	EXOC3L4	ENSG00000205436.8	transcript	ENST00000688303.1	protein_coding	9/12	1723/2637	1591/2169	531/722	INFO_REALIGN_3_PRIME	chr14	TogoVar
EZHIP_chrX_51401948_51413843	51407227	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19083.hp1 NA19083.hp1	a0008 a0008	a0008c0006 a0008c0006	a0008c0006t0001 a0008c0006t0001	a0008c0006t0001g0000 a0008c0006t0001g0000	1	295	0.0034	1	c.213 others(4): Show c.213dupC	p.Ala others(4): Show p.Ala72fs	EZHIP	ENSG00000187690.4	transcript	ENST00000342995.4	protein_coding	1/1	283/1896	214/1512	72/503	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A1_chrX_154881355_154893061	154886571	CG CG	C C	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0006 a0006	a0006c0003 a0006c0003	a0006c0003t0001 a0006c0003t0001	a0006c0003t0001g0000 a0006c0003t0001g0000	1	325	0.0031	-1	c.199 others(4): Show c.199delG	p.Ala others(4): Show p.Ala67fs	F8A1	ENSG00000288722.1	transcript	ENST00000610495.2	protein_coding	1/1	219/1707	199/1116	67/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382125	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0013 a0013	a0013c0014 a0013c0014	a0013c0014t0009 a0013c0014t0009	a0013c0014t0009g0000 a0013c0014t0009g0000	1	267	0.0038	1	c.13d others(3): Show c.13dupG	p.Ala others(3): Show p.Ala5fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	34/1707	14/1116	5/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382134	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA18975.hp1 NA18975.hp1	a0012 a0012	a0012c0004 a0012c0004	a0012c0004t0001 a0012c0004t0001	a0012c0004t0001g0000 a0012c0004t0001g0000	1	267	0.0038	1	c.22d others(3): Show c.22dupC	p.Leu others(3): Show p.Leu8fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	43/1707	23/1116	8/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382147	CG CG	C C	frameshift_variant frameshift_variant	HIGH	NA19056.hp1 NA19056.hp1	a0003 a0003	a0003c0005 a0003c0005	a0003c0005t0004 a0003c0005t0004	a0003c0005t0004g0000 a0003c0005t0004g0000	1	267	0.0038	-1	c.35d others(3): Show c.35delG	p.Gly others(4): Show p.Gly12fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	55/1707	35/1116	12/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382171	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0013 a0013	a0013c0014 a0013c0014	a0013c0014t0009 a0013c0014t0009	a0013c0014t0009g0000 a0013c0014t0009g0000	1	267	0.0038	1	c.61d others(3): Show c.61dupG	p.Asp others(4): Show p.Asp21fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	82/1707	62/1116	21/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382216	G G	GA GA	frameshift_variant frameshift_variant	HIGH	NA18975.hp1 NA18975.hp1	a0012 a0012	a0012c0004 a0012c0004	a0012c0004t0001 a0012c0004t0001	a0012c0004t0001g0000 a0012c0004t0001g0000	1	267	0.0038	1	c.104 others(4): Show c.104dupA	p.Arg others(4): Show p.Arg36fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	125/1707	105/1116	35/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382242	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19056.hp1 NA19056.hp1	a0003 a0003	a0003c0005 a0003c0005	a0003c0005t0004 a0003c0005t0004	a0003c0005t0004g0000 a0003c0005t0004g0000	1	267	0.0038	-1	c.130 others(4): Show c.130delG	p.Ala others(4): Show p.Ala44fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	150/1707	130/1116	44/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382341	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19056.hp1 NA19056.hp1	a0003 a0003	a0003c0005 a0003c0005	a0003c0005t0004 a0003c0005t0004	a0003c0005t0004g0000 a0003c0005t0004g0000	1	267	0.0038	1	c.229 others(4): Show c.229dupC	p.Gln others(4): Show p.Gln77fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	250/1707	230/1116	77/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382366	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0013 a0013	a0013c0014 a0013c0014	a0013c0014t0009 a0013c0014t0009	a0013c0014t0009g0000 a0013c0014t0009g0000	1	267	0.0038	1	c.256 others(4): Show c.256dupG	p.Glu others(4): Show p.Glu86fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	277/1707	257/1116	86/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382366	CG CG	C C	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0010 a0010	a0010c0006 a0010c0006	a0010c0006t0008 a0010c0006t0008	a0010c0006t0008g0000 a0010c0006t0008g0000	1	267	0.0038	-1	c.256 others(4): Show c.256delG	p.Glu others(4): Show p.Glu86fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	276/1707	256/1116	86/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382379	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19056.hp1 NA19056.hp1	a0003 a0003	a0003c0005 a0003c0005	a0003c0005t0004 a0003c0005t0004	a0003c0005t0004g0000 a0003c0005t0004g0000	1	267	0.0038	1	c.268 others(4): Show c.268dupC	p.Leu others(4): Show p.Leu90fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	289/1707	269/1116	90/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382394	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA18975.hp1 NA18975.hp1	a0012 a0012	a0012c0004 a0012c0004	a0012c0004t0001 a0012c0004t0001	a0012c0004t0001g0000 a0012c0004t0001g0000	1	267	0.0038	1	c.283 others(4): Show c.283dupC	p.Arg others(4): Show p.Arg95fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	304/1707	284/1116	95/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382413	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0013 a0013	a0013c0014 a0013c0014	a0013c0014t0009 a0013c0014t0009	a0013c0014t0009g0000 a0013c0014t0009g0000	1	267	0.0038	1	c.301 others(4): Show c.301dupG	p.Glu others(5): Show p.Glu101fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	322/1707	302/1116	101/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382443	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19056.hp1 NA19056.hp1	a0003 a0003	a0003c0005 a0003c0005	a0003c0005t0004 a0003c0005t0004	a0003c0005t0004g0000 a0003c0005t0004g0000	1	267	0.0038	1	c.333 others(4): Show c.333dupC	p.Ala others(5): Show p.Ala112fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	354/1707	334/1116	112/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382461	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA18975.hp1 NA18975.hp1	a0012 a0012	a0012c0004 a0012c0004	a0012c0004t0001 a0012c0004t0001	a0012c0004t0001g0000 a0012c0004t0001g0000	1	267	0.0038	1	c.348 others(4): Show c.348dupG	p.Pro others(5): Show p.Pro117fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	369/1707	349/1116	117/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382488	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19056.hp1 NA19056.hp1	a0003 a0003	a0003c0005 a0003c0005	a0003c0005t0004 a0003c0005t0004	a0003c0005t0004g0000 a0003c0005t0004g0000	1	267	0.0038	-1	c.377 others(4): Show c.377delG	p.Gly others(5): Show p.Gly126fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	397/1707	377/1116	126/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382532	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA18977.hp1 NA18977.hp1	a0009 a0009	a0009c0007 a0009c0007	a0009c0007t0002 a0009c0007t0002	a0009c0007t0002g0000 a0009c0007t0002g0000	1	267	0.0038	1	c.420 others(4): Show c.420dupC	p.Ala others(5): Show p.Ala141fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	441/1707	421/1116	141/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382534	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA18975.hp1 NA18975.hp1	a0012 a0012	a0012c0004 a0012c0004	a0012c0004t0001 a0012c0004t0001	a0012c0004t0001g0000 a0012c0004t0001g0000	1	267	0.0038	1	c.421 others(4): Show c.421dupG	p.Ala others(5): Show p.Ala141fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	442/1707	422/1116	141/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382535	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19056.hp1 NA19056.hp1	a0003 a0003	a0003c0005 a0003c0005	a0003c0005t0004 a0003c0005t0004	a0003c0005t0004g0000 a0003c0005t0004g0000	1	267	0.0038	1	c.423 others(4): Show c.423dupC	p.Ala others(5): Show p.Ala142fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	444/1707	424/1116	142/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382548	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19056.hp1 NA19056.hp1	a0003 a0003	a0003c0005 a0003c0005	a0003c0005t0004 a0003c0005t0004	a0003c0005t0004g0000 a0003c0005t0004g0000	1	267	0.0038	-1	c.436 others(4): Show c.436delC	p.Leu others(5): Show p.Leu146fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	456/1707	436/1116	146/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382559	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0013 a0013	a0013c0014 a0013c0014	a0013c0014t0009 a0013c0014t0009	a0013c0014t0009g0000 a0013c0014t0009g0000	1	267	0.0038	1	c.447 others(4): Show c.447dupC	p.Ala others(5): Show p.Ala150fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	468/1707	448/1116	150/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382624	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA18965.hp1 NA18965.hp1	a0008 a0008	a0008c0008 a0008c0008	a0008c0008t0007 a0008c0008t0007	a0008c0008t0007g0000 a0008c0008t0007g0000	1	267	0.0038	1	c.511 others(4): Show c.511dupC	p.Leu others(5): Show p.Leu171fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	532/1707	512/1116	171/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382633	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19083.hp1 NA19083.hp1	a0004 a0004	a0004c0012 a0004c0012	a0004c0012t0005 a0004c0012t0005	a0004c0012t0005g0000 a0004c0012t0005g0000	1	267	0.0038	1	c.523 others(4): Show c.523dupC	p.Gln others(5): Show p.Gln175fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	544/1707	524/1116	175/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382633	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0013 a0013	a0013c0014 a0013c0014	a0013c0014t0009 a0013c0014t0009	a0013c0014t0009g0000 a0013c0014t0009g0000	1	267	0.0038	-1	c.523 others(4): Show c.523delC	p.Gln others(5): Show p.Gln175fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	543/1707	523/1116	175/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382659	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA18975.hp1 NA19083.hp1 NA18975.hp1 NA19083.hp1	a0004 a0012 a0004 a0012	a0004c0012 a0012c0004 a0004c0012 a0012c0004	a0004c0012t0005 a0012c0004t0001 a0004c0012t0005 a0012c0004t0001	a0004c0012t0005g0000 a0012c0004t0001g0000 a0004c0012t0005g0000 a0012c0004t0001g0000	2	267	0.0075	1	c.547 others(4): Show c.547dupG	p.Ala others(5): Show p.Ala183fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	568/1707	548/1116	183/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382671	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19083.hp1 NA19083.hp1	a0004 a0004	a0004c0012 a0004c0012	a0004c0012t0005 a0004c0012t0005	a0004c0012t0005g0000 a0004c0012t0005g0000	1	267	0.0038	1	c.559 others(4): Show c.559dupG	p.Ala others(5): Show p.Ala187fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	580/1707	560/1116	187/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382685	C C	CA CA	frameshift_variant frameshift_variant	HIGH	NA18965.hp1 NA18965.hp1	a0008 a0008	a0008c0008 a0008c0008	a0008c0008t0007 a0008c0008t0007	a0008c0008t0007g0000 a0008c0008t0007g0000	1	267	0.0038	1	c.572 others(4): Show c.572dupA	p.Leu others(5): Show p.Leu192fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	593/1707	573/1116	191/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382786	G G	GC GC	frameshift_variant frameshift_variant	HIGH	HG00597.hp2 HG02165.hp2 HG00597.hp2 HG02165.hp2	a0002 a0002	a0002c0003 a0002c0003	a0002c0003t0001 a0002c0003t0001	a0002c0003t0001g0000 a0002c0003t0001g0000	2	267	0.0075	1	c.677 others(4): Show c.677dupC	p.Pro others(5): Show p.Pro227fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	698/1707	678/1116	226/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382789	C C	CCG CCG	frameshift_variant frameshift_variant	HIGH	NA19083.hp1 NA19083.hp1	a0004 a0004	a0004c0012 a0004c0012	a0004c0012t0005 a0004c0012t0005	a0004c0012t0005g0000 a0004c0012t0005g0000	1	267	0.0038	2	c.676 others(9): Show c.676_677insGC	p.Pro others(5): Show p.Pro226fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	697/1707	677/1116	226/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382829	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA18975.hp1 NA18975.hp1	a0012 a0012	a0012c0004 a0012c0004	a0012c0004t0001 a0012c0004t0001	a0012c0004t0001g0000 a0012c0004t0001g0000	1	267	0.0038	1	c.718 others(4): Show c.718dupC	p.Leu others(5): Show p.Leu240fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	739/1707	719/1116	240/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382876	C C	CCT CCT	frameshift_variant frameshift_variant	HIGH	NA19083.hp1 NA19083.hp1	a0004 a0004	a0004c0012 a0004c0012	a0004c0012t0005 a0004c0012t0005	a0004c0012t0005g0000 a0004c0012t0005g0000	1	267	0.0038	2	c.762 others(9): Show c.762_763insCT	p.Ser others(5): Show p.Ser255fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	783/1707	763/1116	255/371		chrX	TogoVar
F8A2_chrX_155377095_155388801	155382879	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA18975.hp1 NA18975.hp1	a0012 a0012	a0012c0004 a0012c0004	a0012c0004t0001 a0012c0004t0001	a0012c0004t0001g0000 a0012c0004t0001g0000	1	267	0.0038	1	c.768 others(4): Show c.768dupC	p.Ala others(5): Show p.Ala257fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	789/1707	769/1116	257/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155382928	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19056.hp1 NA19056.hp1	a0003 a0003	a0003c0005 a0003c0005	a0003c0005t0004 a0003c0005t0004	a0003c0005t0004g0000 a0003c0005t0004g0000	1	267	0.0038	1	c.817 others(4): Show c.817dupC	p.Arg others(5): Show p.Arg273fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	838/1707	818/1116	273/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155383139	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA18975.hp1 NA18975.hp1	a0012 a0012	a0012c0004 a0012c0004	a0012c0004t0001 a0012c0004t0001	a0012c0004t0001g0000 a0012c0004t0001g0000	1	267	0.0038	1	c.102 others(5): Show c.1027dupG	p.Glu others(5): Show p.Glu343fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	1048/1707	1028/1116	343/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8A2_chrX_155377095_155388801	155383139	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA18965.hp1 NA18965.hp1	a0008 a0008	a0008c0008 a0008c0008	a0008c0008t0007 a0008c0008t0007	a0008c0008t0007g0000 a0008c0008t0007g0000	1	267	0.0038	-1	c.102 others(5): Show c.1027delG	p.Glu others(5): Show p.Glu343fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	1047/1707	1027/1116	343/371	INFO_REALIGN_3_PRIME	chrX	TogoVar

Search by Variant

Search

Search Results (Total: 5828 hits)