Joint Open Genome and Omics Platform (JoGo)

Search by Variant

Regionname

e.g. ALDH2_chr12_111761933_111822532, HBB_chr11_5220464_5232071.

Chr

Chromosome name (e.g., chr11).

Snpeff genename

Exact SnpEff gene name.

Sampleids

Target sampleid (e.g. HG02615).

Snpeff haplotype class

Haplotype-annotation class (e.g., ahapid, ahapid+chapid).

Snpeff annotation impact

Exact impact level (e.g., HIGH, MODERATE, LOW).

Snpeff annotation impact detail

Keyword match in SnpEff annotation.

Hapid

One or more haplotype IDs (comma-separated; e.g., a0001, a01, a0001c0001, a01c02, a1c2, a0001c0001t0005, a0001c0001t0005g0018).

Samplehapid

Sample haplotype IDs to include (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

No_hapid

Haplotype IDs to exclude (comma-separated; e.g., a0001, a0002, a0001c0001, a0001c0001t0005, a1, a01).

No_samplehapid

Sample haplotype IDs to exclude (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

Start

Start position (GRCh38).

End

End position (GRCh38).

Minac

Minimum alternate allele count (≥).

Maxac

Maximum alternate allele count (≤).

Minlen

Minimum variant length (≥).

Maxlen

Maximum variant length (≤).

Sort By

Select column to sort.

Order by

Ascending or descending.

Show

Results per page.

regionname	pos	ref	alt	annotation	impact	samples	ahapids	achapids	acthapids	actghapids	ac	an	af	len	hgvs_c	hgvs_p	genename	geneid	featuretype	featureid	transcript_biotype	rank	cdna cdna pos length	cds cds pos length	aa aa pos length	status	chr	external
AGTR2_chrX_116165744_116179974	116172674	AT AT	A A	frameshift_variant frameshift_variant	HIGH	NA18978.hp1 NA18978.hp1	a0003 a0003	a0003c0003 a0003c0003	a0003c0003t0001 a0003c0003t0001	a0003c0003t0001g0012 a0003c0003t0001g0012	1	332	0.0030	-1	c.402 others(4): Show c.402delT	p.Phe others(5): Show p.Phe134fs	AGTR2	ENSG00000180772.8	transcript	ENST00000371906.5	protein_coding	3/3	570/2862	402/1092	134/363	INFO_REALIGN_3_PRIME	chrX	TogoVar
AGTR2_chrX_116165744_116179974	116172723	AC AC	A A	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0005 a0005	a0005c0006 a0005c0006	a0005c0006t0013 a0005c0006t0013	a0005c0006t0013g0010 a0005c0006t0013g0010	1	332	0.0030	-1	c.447 others(4): Show c.447delC	p.Leu others(5): Show p.Leu151fs	AGTR2	ENSG00000180772.8	transcript	ENST00000371906.5	protein_coding	3/3	615/2862	447/1092	149/363	INFO_REALIGN_3_PRIME	chrX	TogoVar
AGTR2_chrX_116165744_116179974	116172737	CA CA	C C	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0005 a0005	a0005c0006 a0005c0006	a0005c0006t0013 a0005c0006t0013	a0005c0006t0013g0010 a0005c0006t0013g0010	1	332	0.0030	-1	c.460 others(4): Show c.460delA	p.Arg others(5): Show p.Arg154fs	AGTR2	ENSG00000180772.8	transcript	ENST00000371906.5	protein_coding	3/3	628/2862	460/1092	154/363	INFO_REALIGN_3_PRIME	chrX	TogoVar
AGTR2_chrX_116165744_116179974	116172819	AT AT	A A	frameshift_variant frameshift_variant	HIGH	NA18978.hp1 NA18978.hp1	a0003 a0003	a0003c0003 a0003c0003	a0003c0003t0001 a0003c0003t0001	a0003c0003t0001g0012 a0003c0003t0001g0012	1	332	0.0030	-1	c.543 others(4): Show c.543delT	p.Arg others(5): Show p.Arg182fs	AGTR2	ENSG00000180772.8	transcript	ENST00000371906.5	protein_coding	3/3	711/2862	543/1092	181/363	INFO_REALIGN_3_PRIME	chrX	TogoVar
AGTR2_chrX_116165744_116179974	116172945	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0005 a0005	a0005c0006 a0005c0006	a0005c0006t0013 a0005c0006t0013	a0005c0006t0013g0010 a0005c0006t0013g0010	1	332	0.0030	-1	c.668 others(4): Show c.668delC	p.Pro others(5): Show p.Pro223fs	AGTR2	ENSG00000180772.8	transcript	ENST00000371906.5	protein_coding	3/3	836/2862	668/1092	223/363	INFO_REALIGN_3_PRIME	chrX	TogoVar
AGTR2_chrX_116165744_116179974	116173245	G G	GA GA	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0005 a0005	a0005c0006 a0005c0006	a0005c0006t0013 a0005c0006t0013	a0005c0006t0013g0010 a0005c0006t0013g0010	1	332	0.0030	1	c.968 others(4): Show c.968dupA	p.Asn others(5): Show p.Asn323fs	AGTR2	ENSG00000180772.8	transcript	ENST00000371906.5	protein_coding	3/3	1137/2862	969/1092	323/363	INFO_REALIGN_3_PRIME	chrX	TogoVar
AGTR2_chrX_116165744_116179974	116173303	AG AG	A A	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0005 a0005	a0005c0006 a0005c0006	a0005c0006t0013 a0005c0006t0013	a0005c0006t0013g0010 a0005c0006t0013g0010	1	332	0.0030	-1	c.102 others(5): Show c.1026delG	p.Arg others(5): Show p.Arg344fs	AGTR2	ENSG00000180772.8	transcript	ENST00000371906.5	protein_coding	3/3	1194/2862	1026/1092	342/363	INFO_REALIGN_3_PRIME	chrX	TogoVar
AGTR2_chrX_116165744_116179974	116173328	CG CG	C C	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0005 a0005	a0005c0006 a0005c0006	a0005c0006t0013 a0005c0006t0013	a0005c0006t0013g0010 a0005c0006t0013g0010	1	332	0.0030	-1	c.105 others(5): Show c.1050delG	p.Ser others(5): Show p.Ser352fs	AGTR2	ENSG00000180772.8	transcript	ENST00000371906.5	protein_coding	3/3	1218/2862	1050/1092	350/363	INFO_REALIGN_3_PRIME	chrX	TogoVar
AHNAK2_chr14_104932253_104983374	104948543	T T	TCCCCCTC others(489): Show TCCCCCTCCAGCCGCGCACCATCCAGCTTGGCTCCTGGGGCCTTGACGTC CACCTCCACGCTGGGCAGAGACACCTCCACATCAGGGGCTGTCACTTCCA CCTTGGGGTCTTTTAGGTCCAGCTTGGGGCCCTTGATGTCTATTTCGGGG CCCTTGAGGTCCACTTTGGGCACCTTGAAACTGGGCATCTGCAGCTTGGG CAGGTGCCCTTTGAGGCCGACTTCCTCGGGCACAGGGCCCTCCAGGAGTT TCACGTCCACCTGGCCAGCCTGGACCTTCACGTCGGCGGAAAGGGGCTGA ATGCTGAGGTCAGTGGTCTTGAGGTCCCCCTGCATGGAGGGGAGGCTCAC GTCGGCCTCCACCTTCAACGCAGACACATCCGCTGAGGCCTCGATGGACT TGCCAAGGGCAGACACCCCAAACGACAGCATCTTGAACTTGGGCATTTTG AACTTGCTGTCTTTGGCAGTCACGTCCTTGTCGGCCAGGGACATGTC	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	HG02615.hp2 HG02615.hp2	a0210 a0210	a0210c0055 a0210c0055	a0210c0055t0003 a0210c0055t0003	a0210c0055t0003g0114 a0210c0055t0003g0114	1	356	0.0028	496	c.690 others(505): Show c.6907_6908insGACATGTCCCTGGCCGACAAGGACGTGACTGCCAAA GACAGCAAGTTCAAAATGCCCAAGTTCAAGATGCTGTCGTTTGGGGTGTC TGCCCTTGGCAAGTCCATCGAGGCCTCAGCGGATGTGTCTGCGTTGAAGG TGGAGGCCGACGTGAGCCTCCCCTCCATGCAGGGGGACCTCAAGACCACT GACCTCAGCATTCAGCCCCTTTCCGCCGACGTGAAGGTCCAGGCTGGCCA GGTGGACGTGAAACTCCTGGAGGGCCCTGTGCCCGAGGAAGTCGGCCTCA AAGGGCACCTGCCCAAGCTGCAGATGCCCAGTTTCAAGGTGCCCAAAGTG GACCTCAAGGGCCCCGAAATAGACATCAAGGGCCCCAAGCTGGACCTAAA AGACCCCAAGGTGGAAGTGACAGCCCCTGATGTGGAGGTGTCTCTGCCCA GCGTGGAGGTGGACGTCAAGGCCCCAGGAGCCAAGCTGGATGGTGCGCGG CTGGAGGGGG	p.Asp others(6): Show p.Asp2303fs	AHNAK2	ENSG00000185567.7	transcript	ENST00000333244.6	protein_coding	7/7	7044/18335	6907/17388	2303/5795		chr14	TogoVar
AICDA_chr12_8597170_8617859	8605412	C C	CG CG	frameshift_variant frameshift_variant	HIGH	HG01261.hp1 HG01361.hp2 HG01934.hp2 others(24): Show HG01261.hp1 HG01361.hp2 HG01934.hp2 HG01993.hp2 HG02071.hp1 HG02080.hp2 HG02132.hp1 HG02135.hp2 HG02615.hp2 HG02630.hp1 HG02717.hp1 HG03098.hp2 HG03225.hp2 HG03490.hp1 NA18941.hp1 NA18946.hp1 NA18954.hp1 NA18965.hp2 NA18973.hp2 NA18985.hp1 NA19005.hp2 NA19056.hp2 NA19072.hp1 NA19083.hp1 NA19091.hp1 NA20129.hp2 NA21309.hp2	a0002 a0007 a0002 a0007	a0002c0003 a0002c0004 a0007c0010 a0002c0003 a0002c0004 a0007c0010	a0002c0003t0001 a0002c0003t0002 a0002c0003t0003 others(5): Show a0002c0003t0001 a0002c0003t0002 a0002c0003t0003 a0002c0003t0010 a0002c0003t0023 a0002c0004t0001 a0002c0004t0008 a0007c0010t0003	a0002c0003t0001g0036 a0002c0003t0001g0045 a0002c0003t0001g0085 others(21): Show a0002c0003t0001g0036 a0002c0003t0001g0045 a0002c0003t0001g0085 a0002c0003t0001g0089 a0002c0003t0001g0157 a0002c0003t0001g0158 a0002c0003t0001g0177 a0002c0003t0001g0238 a0002c0003t0001g0256 a0002c0003t0002g0183 a0002c0003t0002g0202 a0002c0003t0003g0035 a0002c0003t0010g0088 a0002c0003t0023g0288 a0002c0004t0001g0094 a0002c0004t0001g0102 a0002c0004t0001g0131 a0002c0004t0001g0159 a0002c0004t0001g0198 a0002c0004t0001g0203 a0002c0004t0001g0206 a0002c0004t0008g0127 a0002c0004t0008g0145 a0007c0010t0003g0144	27	458	0.0590	1	c.229 others(4): Show c.229dupC	p.Arg others(4): Show p.Arg77fs	AICDA	ENSG00000111732.12	transcript	ENST00000229335.11	protein_coding	3/5	321/2803	229/597	77/198		chr12	TogoVar
AIFM1_chrX_130124362_130170841	130138664	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA19083.hp1 NA19083.hp1	a0004 a0004	a0004c0010 a0004c0010	a0004c0010t0001 a0004c0010t0001	a0004c0010t0001g0053 a0004c0010t0001g0053	1	262	0.0038	-1	c.895 others(4): Show c.895delG	p.Glu others(5): Show p.Glu299fs	AIFM1	ENSG00000156709.15	transcript	ENST00000287295.8	protein_coding	9/16	1080/2222	895/1842	299/613		chrX	TogoVar
AIFM1_chrX_130124362_130170841	130156498	AG AG	A A	frameshift_variant frameshift_variant	HIGH	HG03041.hp2 HG03041.hp2	a0006 a0006	a0006c0007 a0006c0007	a0006c0007t0001 a0006c0007t0001	a0006c0007t0001g0036 a0006c0007t0001g0036	1	262	0.0038	-1	c.211 others(4): Show c.211delC	p.Ile others(4): Show p.Ile72fs	AIFM1	ENSG00000156709.15	transcript	ENST00000287295.8	protein_coding	2/16	396/2222	211/1842	71/613		chrX	TogoVar
AIFM1_chrX_130124362_130170841	130156503	T T	TA TA	frameshift_variant frameshift_variant	HIGH	HG03041.hp2 HG03041.hp2	a0006 a0006	a0006c0007 a0006c0007	a0006c0007t0001 a0006c0007t0001	a0006c0007t0001g0036 a0006c0007t0001g0036	1	262	0.0038	1	c.206 others(4): Show c.206dupT	p.Leu others(4): Show p.Leu69fs	AIFM1	ENSG00000156709.15	transcript	ENST00000287295.8	protein_coding	2/16	391/2222	206/1842	69/613		chrX	TogoVar
AIFM1_chrX_130124362_130170841	130156575	A A	AG AG	frameshift_variant frameshift_variant	HIGH	HG03041.hp2 HG03041.hp2	a0006 a0006	a0006c0007 a0006c0007	a0006c0007t0001 a0006c0007t0001	a0006c0007t0001g0036 a0006c0007t0001g0036	1	262	0.0038	1	c.134 others(4): Show c.134dupC	p.Leu others(4): Show p.Leu46fs	AIFM1	ENSG00000156709.15	transcript	ENST00000287295.8	protein_coding	2/16	319/2222	134/1842	45/613		chrX	TogoVar
AIFM1_chrX_130124362_130170841	130156591	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA18997.hp1 NA18997.hp1	a0007 a0007	a0007c0006 a0007c0006	a0007c0006t0001 a0007c0006t0001	a0007c0006t0001g0119 a0007c0006t0001g0119	1	262	0.0038	-1	c.118 others(4): Show c.118delC	p.Gln others(4): Show p.Gln40fs	AIFM1	ENSG00000156709.15	transcript	ENST00000287295.8	protein_coding	2/16	303/2222	118/1842	40/613		chrX	TogoVar
AIM2_chr1_159057484_159081766	159068603	GCTTTGCG others(30): Show GCTTTGCGACATCATTTCTGATGGCTGCAGATGCAGCA	G G	frameshift_variant frameshift_variant	HIGH	HG02129.hp2 HG02129.hp2	a0006 a0006	a0006c0007 a0006c0007	a0006c0007t0002 a0006c0007t0002	a0006c0007t0002g0155 a0006c0007t0002g0155	1	394	0.0025	-37	c.324 others(44): Show c.324_360delTGCTGCATCTGCAGCCATCAGAAATGATGTCGCAAAG	p.Ala others(5): Show p.Ala109fs	AIM2	ENSG00000163568.16	transcript	ENST00000368130.9	protein_coding	3/6	514/1394	324/1032	108/343		chr1	TogoVar
AIMP2_chr7_6004272_6028834	6023464	G G	GAGGGAAG others(12): Show GAGGGAAGCAGTAAAGAAAA	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	HG01517.hp2 HG01517.hp2	a0007 a0007	a0007c0007 a0007c0007	a0007c0007t0001 a0007c0007t0001	a0007c0007t0001g0020 a0007c0007t0001g0020	1	442	0.0023	19	c.739 others(26): Show c.739_757dupGGAAGCAGTAAAGAAAAAG	p.Ala others(5): Show p.Ala253fs	AIMP2	ENSG00000106305.10	transcript	ENST00000223029.8	protein_coding	4/4	850/1198	758/963	253/320	INFO_REALIGN_3_PRIME	chr7	TogoVar
AIRE_chr21_44280876_44303648	44287530	GGCCAAGC others(7): Show GGCCAAGCCCCCCAA	G G	frameshift_variant frameshift_variant	HIGH	NA18991.hp2 NA18991.hp2	a0010 a0010	a0010c0035 a0010c0035	a0010c0035t0001 a0010c0035t0001	a0010c0035t0001g0197 a0010c0035t0001g0197	1	426	0.0024	-14	c.479 others(21): Show c.479_492delCCAAGCCCCCCAAG	p.Ala others(5): Show p.Ala160fs	AIRE	ENSG00000160224.17	transcript	ENST00000291582.6	protein_coding	4/14	610/2690	479/1638	160/545	INFO_REALIGN_3_PRIME	chr21	TogoVar
AIRE_chr21_44280876_44303648	44293804	GCGCGTTG others(40): Show GCGCGTTGCGGGGTGTGCGGAGATGGTACGGACGTGCTGCGGTGTACT	G G	frameshift_variant frameshift_variant	HIGH	HG01256.hp1 HG01256.hp1	a0008 a0008	a0008c0040 a0008c0040	a0008c0040t0001 a0008c0040t0001	a0008c0040t0001g0160 a0008c0040t0001g0160	1	426	0.0024	-47	c.129 others(56): Show c.1296_1342delGCGTTGCGGGGTGTGCGGAGATGGTACGGACGTGCT GCGGTGTACTC	p.Arg others(5): Show p.Arg433fs	AIRE	ENSG00000160224.17	transcript	ENST00000291582.6	protein_coding	11/14	1427/2690	1296/1638	432/545	INFO_REALIGN_3_PRIME	chr21	TogoVar
AKAP14_chrX_119890893_119925716	119914705	G G	GT GT	frameshift_variant frameshift_variant	HIGH	NA18991.hp1 NA18991.hp1	a0002 a0002	a0002c0005 a0002c0005	a0002c0005t0003 a0002c0005t0003	a0002c0005t0003g0095 a0002c0005t0003g0095	1	304	0.0033	1	c.271 others(4): Show c.271dupT	p.Ser others(4): Show p.Ser91fs	AKAP14	ENSG00000186471.13	transcript	ENST00000371431.8	protein_coding	5/7	490/921	272/594	91/197	INFO_REALIGN_3_PRIME	chrX	TogoVar
AKAP14_chrX_119890893_119925716	119914710	TA TA	T T	frameshift_variant frameshift_variant	HIGH	HG01517.hp2 HG01517.hp2	a0004 a0004	a0004c0004 a0004c0004	a0004c0004t0001 a0004c0004t0001	a0004c0004t0001g0104 a0004c0004t0001g0104	1	304	0.0033	-1	c.279 others(4): Show c.279delA	p.Lys others(4): Show p.Lys93fs	AKAP14	ENSG00000186471.13	transcript	ENST00000371431.8	protein_coding	5/7	497/921	279/594	93/197	INFO_REALIGN_3_PRIME	chrX	TogoVar
AKAP17A_chrX_1586604_1607520	1593484	C C	CA CA	frameshift_variant frameshift_variant	HIGH	NA18948.hp1 NA18948.hp1	a0018 a0018	a0018c0011 a0018c0011	a0018c0011t0001 a0018c0011t0001	a0018c0011t0001g0013 a0018c0011t0001g0013	1	151	0.0066	1	c.23d others(3): Show c.23dupA	p.His others(3): Show p.His8fs	AKAP17A	ENSG00000197976.12	transcript	ENST00000313871.9	protein_coding	2/5	209/3199	24/2088	8/695	INFO_REALIGN_3_PRIME	chrX	TogoVar
AKAP17A_chrX_1586604_1607520	1593587	CG CG	C C	frameshift_variant frameshift_variant	HIGH	HG01515.hp1 HG01515.hp1	a0017 a0017	a0017c0008 a0017c0008	a0017c0008t0001 a0017c0008t0001	a0017c0008t0001g0050 a0017c0008t0001g0050	1	151	0.0066	-1	c.129 others(4): Show c.129delG	p.Lys others(4): Show p.Lys44fs	AKAP17A	ENSG00000197976.12	transcript	ENST00000313871.9	protein_coding	2/5	314/3199	129/2088	43/695	INFO_REALIGN_3_PRIME	chrX	TogoVar
AKAP17A_chrX_1586604_1607520	1593629	AG AG	A A	frameshift_variant frameshift_variant	HIGH	HG02976.hp1 HG02976.hp1	a0005 a0005	a0005c0014 a0005c0014	a0005c0014t0011 a0005c0014t0011	a0005c0014t0011g0052 a0005c0014t0011g0052	1	151	0.0066	-1	c.170 others(4): Show c.170delG	p.Gly others(4): Show p.Gly57fs	AKAP17A	ENSG00000197976.12	transcript	ENST00000313871.9	protein_coding	2/5	355/3199	170/2088	57/695	INFO_REALIGN_3_PRIME	chrX	TogoVar
AKAP17A_chrX_1586604_1607520	1593824	T T	TC TC	frameshift_variant frameshift_variant	HIGH	HG02486.hp1 HG02486.hp1	a0006 a0006	a0006c0027 a0006c0027	a0006c0027t0005 a0006c0027t0005	a0006c0027t0005g0066 a0006c0027t0005g0066	1	151	0.0066	1	c.366 others(4): Show c.366dupC	p.Thr others(5): Show p.Thr123fs	AKAP17A	ENSG00000197976.12	transcript	ENST00000313871.9	protein_coding	2/5	552/3199	367/2088	123/695	INFO_REALIGN_3_PRIME	chrX	TogoVar
AKAP17A_chrX_1586604_1607520	1593852	CT CT	C C	frameshift_variant frameshift_variant	HIGH	NA18948.hp1 NA18948.hp1	a0018 a0018	a0018c0011 a0018c0011	a0018c0011t0001 a0018c0011t0001	a0018c0011t0001g0013 a0018c0011t0001g0013	1	151	0.0066	-1	c.392 others(4): Show c.392delT	p.Phe others(5): Show p.Phe131fs	AKAP17A	ENSG00000197976.12	transcript	ENST00000313871.9	protein_coding	2/5	577/3199	392/2088	131/695	INFO_REALIGN_3_PRIME	chrX	TogoVar
AKAP17A_chrX_1586604_1607520	1593887	C C	CG CG	frameshift_variant frameshift_variant	HIGH	HG02293.hp1 HG02293.hp1	a0016 a0016	a0016c0026 a0016c0026	a0016c0026t0020 a0016c0026t0020	a0016c0026t0020g0114 a0016c0026t0020g0114	1	151	0.0066	1	c.430 others(4): Show c.430dupG	p.Glu others(5): Show p.Glu144fs	AKAP17A	ENSG00000197976.12	transcript	ENST00000313871.9	protein_coding	2/5	616/3199	431/2088	144/695	INFO_REALIGN_3_PRIME	chrX	TogoVar
AKAP17A_chrX_1586604_1607520	1593887	CG CG	C C	frameshift_variant frameshift_variant	HIGH	HG02976.hp1 HG02976.hp1	a0005 a0005	a0005c0014 a0005c0014	a0005c0014t0011 a0005c0014t0011	a0005c0014t0011g0052 a0005c0014t0011g0052	1	151	0.0066	-1	c.430 others(4): Show c.430delG	p.Glu others(5): Show p.Glu144fs	AKAP17A	ENSG00000197976.12	transcript	ENST00000313871.9	protein_coding	2/5	615/3199	430/2088	144/695	INFO_REALIGN_3_PRIME	chrX	TogoVar
AKAP17A_chrX_1586604_1607520	1593924	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA18948.hp1 NA18948.hp1	a0018 a0018	a0018c0011 a0018c0011	a0018c0011t0001 a0018c0011t0001	a0018c0011t0001g0013 a0018c0011t0001g0013	1	151	0.0066	1	c.465 others(4): Show c.465dupC	p.Cys others(5): Show p.Cys156fs	AKAP17A	ENSG00000197976.12	transcript	ENST00000313871.9	protein_coding	2/5	651/3199	466/2088	156/695	INFO_REALIGN_3_PRIME	chrX	TogoVar
AKAP17A_chrX_1586604_1607520	1593940	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA18948.hp1 NA18948.hp1	a0018 a0018	a0018c0011 a0018c0011	a0018c0011t0001 a0018c0011t0001	a0018c0011t0001g0013 a0018c0011t0001g0013	1	151	0.0066	1	c.481 others(4): Show c.481dupC	p.Leu others(5): Show p.Leu161fs	AKAP17A	ENSG00000197976.12	transcript	ENST00000313871.9	protein_coding	2/5	667/3199	482/2088	161/695	INFO_REALIGN_3_PRIME	chrX	TogoVar
AKAP17A_chrX_1586604_1607520	1593953	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA18948.hp1 NA18948.hp1	a0018 a0018	a0018c0011 a0018c0011	a0018c0011t0001 a0018c0011t0001	a0018c0011t0001g0013 a0018c0011t0001g0013	1	151	0.0066	1	c.494 others(4): Show c.494dupG	p.Ser others(5): Show p.Ser166fs	AKAP17A	ENSG00000197976.12	transcript	ENST00000313871.9	protein_coding	2/5	680/3199	495/2088	165/695	INFO_REALIGN_3_PRIME	chrX	TogoVar
AKAP17A_chrX_1586604_1607520	1594005	CG CG	C C	frameshift_variant frameshift_variant	HIGH	NA18948.hp1 NA18948.hp1	a0018 a0018	a0018c0011 a0018c0011	a0018c0011t0001 a0018c0011t0001	a0018c0011t0001g0013 a0018c0011t0001g0013	1	151	0.0066	-1	c.547 others(4): Show c.547delG	p.Glu others(5): Show p.Glu183fs	AKAP17A	ENSG00000197976.12	transcript	ENST00000313871.9	protein_coding	2/5	732/3199	547/2088	183/695	INFO_REALIGN_3_PRIME	chrX	TogoVar
AKAP17A_chrX_1586604_1607520	1595471	C C	CA CA	frameshift_variant frameshift_variant	HIGH	HG02293.hp1 HG02293.hp1	a0016 a0016	a0016c0026 a0016c0026	a0016c0026t0020 a0016c0026t0020	a0016c0026t0020g0114 a0016c0026t0020g0114	1	151	0.0066	1	c.853 others(4): Show c.853dupA	p.Arg others(5): Show p.Arg285fs	AKAP17A	ENSG00000197976.12	transcript	ENST00000313871.9	protein_coding	3/5	1039/3199	854/2088	285/695	INFO_REALIGN_3_PRIME	chrX	TogoVar
AKAP17A_chrX_1586604_1607520	1595513	A A	AG AG	frameshift_variant frameshift_variant	HIGH	HG02293.hp1 HG02293.hp1	a0016 a0016	a0016c0026 a0016c0026	a0016c0026t0020 a0016c0026t0020	a0016c0026t0020g0114 a0016c0026t0020g0114	1	151	0.0066	1	c.894 others(4): Show c.894dupG	p.Gln others(5): Show p.Gln299fs	AKAP17A	ENSG00000197976.12	transcript	ENST00000313871.9	protein_coding	3/5	1080/3199	895/2088	299/695	INFO_REALIGN_3_PRIME	chrX	TogoVar
AKAP17A_chrX_1586604_1607520	1600738	AG AG	A A	frameshift_variant frameshift_variant	HIGH	NA19062.hp1 NA19062.hp1	a0015 a0015	a0015c0016 a0015c0016	a0015c0016t0019 a0015c0016t0019	a0015c0016t0019g0014 a0015c0016t0019g0014	1	151	0.0066	-1	c.123 others(5): Show c.1234delG	p.Ala others(5): Show p.Ala412fs	AKAP17A	ENSG00000197976.12	transcript	ENST00000313871.9	protein_coding	5/5	1419/3199	1234/2088	412/695	INFO_REALIGN_3_PRIME	chrX	TogoVar
AKAP17A_chrX_1586604_1607520	1600950	A A	AC AC	frameshift_variant frameshift_variant	HIGH	HG01261.hp1 HG01261.hp1	a0007 a0007	a0007c0024 a0007c0024	a0007c0024t0001 a0007c0024t0001	a0007c0024t0001g0116 a0007c0024t0001g0116	1	151	0.0066	1	c.144 others(5): Show c.1446dupC	p.Thr others(5): Show p.Thr483fs	AKAP17A	ENSG00000197976.12	transcript	ENST00000313871.9	protein_coding	5/5	1632/3199	1447/2088	483/695	INFO_REALIGN_3_PRIME	chrX	TogoVar
AKAP17A_chrX_1586604_1607520	1600960	A A	AC AC	frameshift_variant frameshift_variant	HIGH	HG01346.hp2 HG01346.hp2	a0014 a0014	a0014c0021 a0014c0021	a0014c0021t0001 a0014c0021t0001	a0014c0021t0001g0003 a0014c0021t0001g0003	1	151	0.0066	1	c.145 others(5): Show c.1459dupC	p.Leu others(5): Show p.Leu487fs	AKAP17A	ENSG00000197976.12	transcript	ENST00000313871.9	protein_coding	5/5	1645/3199	1460/2088	487/695	INFO_REALIGN_3_PRIME	chrX	TogoVar
AKAP17A_chrX_1586604_1607520	1601221	C C	CA CA	frameshift_variant frameshift_variant	HIGH	NA18951.hp1 NA18951.hp1	a0012 a0012	a0012c0017 a0012c0017	a0012c0017t0002 a0012c0017t0002	a0012c0017t0002g0031 a0012c0017t0002g0031	1	151	0.0066	1	c.171 others(10): Show c.1715_1716insA	p.Arg others(5): Show p.Arg573fs	AKAP17A	ENSG00000197976.12	transcript	ENST00000313871.9	protein_coding	5/5	1901/3199	1716/2088	572/695		chrX	TogoVar
AKAP17A_chrX_1586604_1607520	1601527	A A	AC AC	frameshift_variant frameshift_variant	HIGH	HG00738.hp1 HG00738.hp1	a0000 a0000	a0000c0018 a0000c0018	a0000c0018t0002 a0000c0018t0002	a0000c0018t0002g0044 a0000c0018t0002g0044	1	151	0.0066	1	c.202 others(5): Show c.2023dupC	p.Arg others(5): Show p.Arg675fs	AKAP17A	ENSG00000197976.12	transcript	ENST00000313871.9	protein_coding	5/5	2209/3199	2024/2088	675/695	INFO_REALIGN_3_PRIME	chrX	TogoVar
AKAP17A_chrX_1586604_1607520	1601553	T T	TC TC	frameshift_variant frameshift_variant	HIGH	HG02486.hp1 HG02486.hp1	a0006 a0006	a0006c0027 a0006c0027	a0006c0027t0005 a0006c0027t0005	a0006c0027t0005g0066 a0006c0027t0005g0066	1	151	0.0066	1	c.205 others(5): Show c.2050dupC	p.Arg others(5): Show p.Arg684fs	AKAP17A	ENSG00000197976.12	transcript	ENST00000313871.9	protein_coding	5/5	2236/3199	2051/2088	684/695	INFO_REALIGN_3_PRIME	chrX	TogoVar
AKR1B10_chr7_134522567_134546412	134537643	C C	CA CA	frameshift_variant frameshift_variant	HIGH	HG01261.hp2 HG01978.hp1 HG02055.hp2 others(14): Show HG01261.hp2 HG01978.hp1 HG02055.hp2 HG03491.hp2 HG03516.hp1 HG03831.hp1 HG04115.hp2 NA18953.hp2 NA18960.hp2 NA18963.hp1 NA18972.hp1 NA18977.hp2 NA18985.hp2 NA18994.hp2 NA19010.hp1 NA19067.hp2 NA19089.hp1	a0004 a0006 a0004 a0006	a0004c0005 a0004c0006 a0004c0015 others(1): Show a0004c0005 a0004c0006 a0004c0015 a0006c0009	a0004c0005t0001 a0004c0006t0001 a0004c0006t0002 others(4): Show a0004c0005t0001 a0004c0006t0001 a0004c0006t0002 a0004c0006t0003 a0004c0006t0009 a0004c0015t0001 a0006c0009t0001	a0004c0005t0001g0004 a0004c0005t0001g0020 a0004c0005t0001g0047 others(12): Show a0004c0005t0001g0004 a0004c0005t0001g0020 a0004c0005t0001g0047 a0004c0005t0001g0054 a0004c0005t0001g0098 a0004c0005t0001g0117 a0004c0006t0001g0017 a0004c0006t0002g0002 a0004c0006t0002g0150 a0004c0006t0003g0056 a0004c0006t0009g0162 a0004c0015t0001g0009 a0006c0009t0001g0006 a0006c0009t0001g0011 a0006c0009t0001g0086	17	448	0.0380	1	c.730 others(4): Show c.730dupA	p.Thr others(5): Show p.Thr244fs	AKR1B10	ENSG00000198074.10	transcript	ENST00000359579.5	protein_coding	7/10	1076/1619	731/951	244/316	INFO_REALIGN_3_PRIME	chr7	TogoVar
AKR1C8_chr10_5148920_5190150	5159943	GTGATTGA others(229): Show GTGATTGAAATTGGACACCCCAATGGACCTGGTTAAACCTGCTTCTTTGC ACTTCTCCAGGGCCTGGGGAGGAAGGATATGGGTGATAGACCTTTAGTGT AAATTTTTCTTTTCAATTGGCGTTTGACTTTGTAAATGCTGGAAATCTGT TTTAACATATATAAATATTAGACTGAATTAAACAGTTTTATCACTTGAAT ATACAATTTCCTAATGCATTACCTTGCTATGCATATA	G G	frameshift_variant others(3): Show frameshift_variant splice_acceptor_variant splice_region_variant intron_variant	HIGH	HG01069.hp1 HG01071.hp1 HG01106.hp1 others(40): Show HG01069.hp1 HG01071.hp1 HG01106.hp1 HG01123.hp1 HG01257.hp2 HG01361.hp2 HG01433.hp2 HG01496.hp2 HG01516.hp2 HG01952.hp2 HG01978.hp2 HG01993.hp1 HG02004.hp2 HG02056.hp1 HG02071.hp2 HG02083.hp2 HG02129.hp2 HG02132.hp1 HG02523.hp2 HG02602.hp2 HG03239.hp2 HG03927.hp1 HG03942.hp2 HG04184.hp2 NA18941.hp2 NA18953.hp1 NA18974.hp1 NA18979.hp2 NA18980.hp2 NA18988.hp2 NA18990.hp2 NA19000.hp1 NA19002.hp1 NA19011.hp2 NA19012.hp2 NA19054.hp2 NA19056.hp1 NA19058.hp2 NA19063.hp1 NA19064.hp1 NA19079.hp1 NA19088.hp2 NA20752.hp1	a0003 a0003	a0003c0004 a0003c0006 a0003c0004 a0003c0006	a0003c0004t0002 a0003c0006t0002 a0003c0004t0002 a0003c0006t0002	a0003c0004t0002g0005 a0003c0004t0002g0008 a0003c0004t0002g0009 others(27): Show a0003c0004t0002g0005 a0003c0004t0002g0008 a0003c0004t0002g0009 a0003c0004t0002g0029 a0003c0004t0002g0030 a0003c0004t0002g0069 a0003c0004t0002g0073 a0003c0004t0002g0074 a0003c0004t0002g0075 a0003c0004t0002g0076 a0003c0004t0002g0077 a0003c0004t0002g0078 a0003c0004t0002g0079 a0003c0004t0002g0080 a0003c0004t0002g0081 a0003c0004t0002g0082 a0003c0004t0002g0083 a0003c0004t0002g0084 a0003c0004t0002g0085 a0003c0004t0002g0086 a0003c0004t0002g0087 a0003c0004t0002g0088 a0003c0004t0002g0089 a0003c0004t0002g0165 a0003c0006t0002g0028 a0003c0006t0002g0062 a0003c0006t0002g0063 a0003c0006t0002g0064 a0003c0006t0002g0065 a0003c0006t0002g0066	43	408	0.1054	-236	c.457 others(11): Show c.457-174_518del	p.Ala others(5): Show p.Ala153fs	AKR1C8	ENSG00000264006.9	transcript	ENST00000648824.2	protein_coding	5/9	564/1247	457/981	153/326		chr10	TogoVar
AKR7A2_chr1_19298965_19317144	19312096	G G	GAGACTAC others(12): Show GAGACTACGCGAGACGCGGC	frameshift_variant frameshift_variant	HIGH	HG01106.hp2 HG02615.hp2 HG01106.hp2 HG02615.hp2	a0008 a0008	a0008c0011 a0008c0011	a0008c0011t0001 a0008c0011t0001	a0008c0011t0001g0063 a0008c0011t0001g0063	2	460	0.0044	19	c.10_ others(24): Show c.10_28dupGCCGCGTCTCGCGTAGTCT	p.Ser others(4): Show p.Ser10fs	AKR7A2	ENSG00000053371.13	transcript	ENST00000235835.8	protein_coding	1/7	48/1360	28/1080	10/359		chr1	TogoVar
ALG13_chrX_111676170_111765649	111682131	GA GA	G G	frameshift_variant frameshift_variant	HIGH	NA19058.hp1 NA19058.hp1	a0011 a0011	a0011c0020 a0011c0020	a0011c0020t0001 a0011c0020t0001	a0011c0020t0001g0006 a0011c0020t0001g0006	1	191	0.0052	-1	c.85d others(3): Show c.85delA	p.Ile others(4): Show p.Ile29fs	ALG13	ENSG00000101901.13	transcript	ENST00000394780.8	protein_coding	2/27	134/4113	85/3414	29/1137	INFO_REALIGN_3_PRIME	chrX	TogoVar
ALG13_chrX_111676170_111765649	111744768	A A	AC AC	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0007 a0007	a0007c0011 a0007c0011	a0007c0011t0001 a0007c0011t0001	a0007c0011t0001g0155 a0007c0011t0001g0155	1	191	0.0052	1	c.279 others(5): Show c.2798dupC	p.Pro others(5): Show p.Pro934fs	ALG13	ENSG00000101901.13	transcript	ENST00000394780.8	protein_coding	24/27	2848/4113	2799/3414	933/1137	INFO_REALIGN_3_PRIME	chrX	TogoVar
ALG1L2_chr3_130076831_130103390	130096091	GC GC	G G	frameshift_variant frameshift_variant	HIGH	HG00280.hp1 HG00280.hp2 HG00323.hp1 others(48): Show HG00280.hp1 HG00280.hp2 HG00323.hp1 HG00741.hp1 HG00741.hp2 HG01069.hp2 HG01106.hp2 HG01175.hp2 HG01255.hp1 HG01261.hp1 HG01261.hp2 HG01358.hp1 HG01433.hp1 HG01943.hp2 HG01978.hp1 HG02055.hp2 HG02258.hp1 HG02559.hp2 HG02602.hp2 HG02615.hp1 HG02735.hp2 HG02886.hp1 HG02886.hp2 HG02895.hp2 HG02896.hp1 HG02922.hp1 HG02922.hp2 HG02976.hp1 HG03017.hp1 HG03041.hp2 HG03139.hp1 HG03195.hp1 HG03209.hp2 HG03225.hp1 HG03225.hp2 HG03239.hp1 HG03239.hp2 HG03453.hp1 HG03471.hp2 HG03704.hp2 HG06807.hp1 NA18522.hp2 NA18954.hp2 NA19030.hp2 NA19043.hp1 NA19043.hp2 NA19240.hp2 NA20752.hp2 NA20805.hp1 NA20805.hp2 NA21309.hp2	a0002 a0003 a0005 a0002 a0003 a0005	a0002c0002 a0002c0004 a0002c0007 others(6): Show a0002c0002 a0002c0004 a0002c0007 a0002c0012 a0002c0015 a0002c0017 a0003c0005 a0003c0011 a0005c0009	a0002c0002t0001 a0002c0004t0001 a0002c0004t0002 others(8): Show a0002c0002t0001 a0002c0004t0001 a0002c0004t0002 a0002c0007t0001 a0002c0012t0001 a0002c0015t0001 a0002c0017t0001 a0003c0005t0001 a0003c0011t0001 a0005c0009t0001 a0005c0009t0005	a0002c0002t0001g0005 a0002c0002t0001g0008 a0002c0002t0001g0019 others(33): Show a0002c0002t0001g0005 a0002c0002t0001g0008 a0002c0002t0001g0019 a0002c0002t0001g0020 a0002c0002t0001g0065 a0002c0002t0001g0066 a0002c0002t0001g0067 a0002c0002t0001g0068 a0002c0002t0001g0069 a0002c0002t0001g0070 a0002c0002t0001g0071 a0002c0002t0001g0073 a0002c0002t0001g0077 a0002c0002t0001g0079 a0002c0002t0001g0080 a0002c0002t0001g0083 a0002c0002t0001g0084 a0002c0002t0001g0085 a0002c0004t0001g0011 a0002c0004t0001g0059 a0002c0004t0001g0127 a0002c0004t0002g0034 a0002c0007t0001g0081 a0002c0007t0001g0082 a0002c0012t0001g0072 a0002c0015t0001g0098 a0002c0017t0001g0101 a0003c0005t0001g0039 a0003c0005t0001g0040 a0003c0005t0001g0041 a0003c0005t0001g0042 a0003c0005t0001g0043 a0003c0011t0001g0036 a0003c0011t0001g0038 a0005c0009t0001g0150 a0005c0009t0005g0046	51	261	0.1954	-1	c.469 others(4): Show c.469delC	p.Leu others(5): Show p.Leu157fs	ALG1L2	ENSG00000251287.9	transcript	ENST00000425059.1	protein_coding	6/8	655/969	469/648	157/215	INFO_REALIGN_3_PRIME	chr3	TogoVar
ALG1_chr16_5066843_5092379	5078734	AGGCTTTT others(28): Show AGGCTTTTTTTCTGCTCCTTCAGCTCAGAACCTGAG	A A	frameshift_variant others(3): Show frameshift_variant splice_acceptor_variant splice_region_variant intron_variant	HIGH	NA19063.hp1 NA19063.hp1	a0009 a0009	a0009c0016 a0009c0016	a0009c0016t0003 a0009c0016t0003	a0009c0016t0003g0096 a0009c0016t0003g0096	1	444	0.0023	-35	c.741 others(45): Show c.741-21_754delGCTTTTTTTCTGCTCCTTCAGCTCAGAACCTGAGG	p.Ser others(5): Show p.Ser248fs	ALG1	ENSG00000033011.14	transcript	ENST00000262374.10	protein_coding	7/13		741/1395	247/464	INFO_REALIGN_3_PRIME	chr16	TogoVar
ALOX15B_chr17_8034059_8054134	8047773	T T	TGCCACCC others(31): Show TGCCACCCAGCATGCAGCTGCCACCACCCACCTCCAAAG	frameshift_variant frameshift_variant	HIGH	NA18947.hp1 NA18947.hp1	a0021 a0021	a0021c0040 a0021c0040	a0021c0040t0009 a0021c0040t0009	a0021c0040t0009g0127 a0021c0040t0009g0127	1	470	0.0021	38	c.171 others(47): Show c.1713_1750dupACCCAGCATGCAGCTGCCACCACCCACCTCCAAAGG CC	p.Leu others(5): Show p.Leu584fs	ALOX15B	ENSG00000179593.16	transcript	ENST00000380183.9	protein_coding	13/14	1848/2697	1751/2031	584/676	INFO_REALIGN_3_PRIME	chr17	TogoVar
ALOX15_chr17_4625919_4646678	4639538	ACCAGGCG others(4): Show ACCAGGCGTCGT	A A	frameshift_variant frameshift_variant	HIGH	NA19066.hp2 NA19066.hp2	a0007 a0007	a0007c0012 a0007c0012	a0007c0012t0001 a0007c0012t0001	a0007c0012t0001g0203 a0007c0012t0001g0203	1	472	0.0021	-11	c.218 others(18): Show c.218_228delACGACGCCTGG	p.Asp others(4): Show p.Asp73fs	ALOX15	ENSG00000161905.13	transcript	ENST00000293761.8	protein_coding	2/14	255/2697	218/1989	73/662		chr17	TogoVar
ALOX5_chr10_45369216_45451117	45443652	ATCCGGGC others(79): Show ATCCGGGCACGGGGTGGGCGCCGGGCCCTGGGGTCCTCAGGGACTGGGCC TCAGCCCGCCGGTGGTTCCACCCTAGGCTTCCCCAAG	A A	frameshift_variant others(3): Show frameshift_variant splice_acceptor_variant splice_region_variant intron_variant	HIGH	NA18960.hp1 NA18960.hp1	a0007 a0007	a0007c0017 a0007c0017	a0007c0017t0001 a0007c0017t0001	a0007c0017t0001g0226 a0007c0017t0001g0226	1	345	0.0029	-86	c.157 others(98): Show c.1574-73_1586delCGGGCACGGGGTGGGCGCCGGGCCCTGGGGTCC TCAGGGACTGGGCCTCAGCCCGCCGGTGGTTCCACCCTAGGCTTCCCCAA GTC	p.Phe others(5): Show p.Phe526fs	ALOX5	ENSG00000012779.12	transcript	ENST00000374391.7	protein_coding	12/14		1574/2025	525/674	INFO_REALIGN_3_PRIME	chr10	TogoVar

Search by Variant

Search

Search Results (Total: 5828 hits)