Joint Open Genome and Omics Platform (JoGo)

Search by Variant

Regionname

e.g. ALDH2_chr12_111761933_111822532, HBB_chr11_5220464_5232071.

Chr

Chromosome name (e.g., chr11).

Snpeff genename

Exact SnpEff gene name.

Sampleids

Target sampleid (e.g. HG02615).

Snpeff haplotype class

Haplotype-annotation class (e.g., ahapid, ahapid+chapid).

Snpeff annotation impact

Exact impact level (e.g., HIGH, MODERATE, LOW).

Snpeff annotation impact detail

Keyword match in SnpEff annotation.

Hapid

One or more haplotype IDs (comma-separated; e.g., a0001, a01, a0001c0001, a01c02, a1c2, a0001c0001t0005, a0001c0001t0005g0018).

Samplehapid

Sample haplotype IDs to include (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

No_hapid

Haplotype IDs to exclude (comma-separated; e.g., a0001, a0002, a0001c0001, a0001c0001t0005, a1, a01).

No_samplehapid

Sample haplotype IDs to exclude (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

Start

Start position (GRCh38).

End

End position (GRCh38).

Minac

Minimum alternate allele count (≥).

Maxac

Maximum alternate allele count (≤).

Minlen

Minimum variant length (≥).

Maxlen

Maximum variant length (≤).

Sort By

Select column to sort.

Order by

Ascending or descending.

Show

Results per page.

regionname	pos	ref	alt	annotation	impact	samples	ahapids	achapids	acthapids	actghapids	ac	an	af	len	hgvs_c	hgvs_p	genename	geneid	featuretype	featureid	transcript_biotype	rank	cdna cdna pos length	cds cds pos length	aa aa pos length	status	chr	external
F8A2_chrX_155377095_155388801	155383220	AG AG	A A	frameshift_variant frameshift_variant	HIGH	NA18965.hp1 NA18965.hp1	a0008 a0008	a0008c0008 a0008c0008	a0008c0008t0007 a0008c0008t0007	a0008c0008t0007g0000 a0008c0008t0007g0000	1	267	0.0038	-1	c.110 others(5): Show c.1109delG	p.Gly others(5): Show p.Gly370fs	F8A2	ENSG00000288709.1	transcript	ENST00000369505.5	protein_coding	1/1	1129/1707	1109/1116	370/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
F8_chrX_154830792_155027723	154906552	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA18985.hp1 NA18985.hp1	a0009 a0009	a0009c0013 a0009c0013	a0009c0013t0001 a0009c0013t0001	a0009c0013t0001g0033 a0009c0013t0001g0033	1	233	0.0043	1	c.524 others(5): Show c.5240dupC	p.Gln others(6): Show p.Gln1748fs	F8	ENSG00000185010.15	transcript	ENST00000360256.9	protein_coding	15/26	5411/9032	5240/7056	1747/2351		chrX	TogoVar
F8_chrX_154830792_155027723	154929709	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0010 a0010	a0010c0015 a0010c0015	a0010c0015t0001 a0010c0015t0001	a0010c0015t0001g0032 a0010c0015t0001g0032	1	233	0.0043	1	c.408 others(5): Show c.4080dupC	p.Lys others(6): Show p.Lys1361fs	F8	ENSG00000185010.15	transcript	ENST00000360256.9	protein_coding	14/26	4251/9032	4080/7056	1360/2351		chrX	TogoVar
FAAH2_chrX_57281706_57494193	57292505	G G	GT GT	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0007 a0007	a0007c0008 a0007c0008	a0007c0008t0004 a0007c0008t0004	a0007c0008t0004g0117 a0007c0008t0004g0117	1	282	0.0036	1	c.201 others(4): Show c.201dupT	p.Ile others(4): Show p.Ile68fs	FAAH2	ENSG00000165591.7	transcript	ENST00000374900.5	protein_coding	2/11	322/1980	202/1599	68/532	INFO_REALIGN_3_PRIME	chrX	TogoVar
FAAH2_chrX_57281706_57494193	57488772	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0007 a0007	a0007c0008 a0007c0008	a0007c0008t0004 a0007c0008t0004	a0007c0008t0004g0117 a0007c0008t0004g0117	1	282	0.0036	1	c.144 others(5): Show c.1442dupG	p.Leu others(5): Show p.Leu482fs	FAAH2	ENSG00000165591.7	transcript	ENST00000374900.5	protein_coding	11/11	1563/1980	1443/1599	481/532	INFO_REALIGN_3_PRIME	chrX	TogoVar
FAAH2_chrX_57281706_57494193	57488820	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA18955.hp1 NA18974.hp1 NA18955.hp1 NA18974.hp1	a0006 a0007 a0006 a0007	a0006c0009 a0007c0008 a0006c0009 a0007c0008	a0006c0009t0002 a0007c0008t0004 a0006c0009t0002 a0007c0008t0004	a0006c0009t0002g0192 a0007c0008t0004g0117 a0006c0009t0002g0192 a0007c0008t0004g0117	2	282	0.0071	-1	c.149 others(5): Show c.1490delC	p.Pro others(5): Show p.Pro497fs	FAAH2	ENSG00000165591.7	transcript	ENST00000374900.5	protein_coding	11/11	1610/1980	1490/1599	497/532	INFO_REALIGN_3_PRIME	chrX	TogoVar
FAAH2_chrX_57281706_57494193	57488845	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0007 a0007	a0007c0008 a0007c0008	a0007c0008t0004 a0007c0008t0004	a0007c0008t0004g0117 a0007c0008t0004g0117	1	282	0.0036	-1	c.151 others(5): Show c.1514delG	p.Gly others(5): Show p.Gly505fs	FAAH2	ENSG00000165591.7	transcript	ENST00000374900.5	protein_coding	11/11	1634/1980	1514/1599	505/532	INFO_REALIGN_3_PRIME	chrX	TogoVar
FAAH_chr1_46389317_46418845	46408496	A A	ACCCCACC others(7): Show ACCCCACCTCATAGT	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	HG02486.hp1 HG02486.hp1	a0005 a0005	a0005c0008 a0005c0008	a0005c0008t0001 a0005c0008t0001	a0005c0008t0001g0001 a0005c0008t0001g0001	1	370	0.0027	14	c.989 others(21): Show c.989_990insCCCCACCTCATAGT	p.Glu others(5): Show p.Glu331fs	FAAH	ENSG00000117480.16	transcript	ENST00000243167.9	protein_coding	8/15	1022/2042	990/1740	330/579		chr1	TogoVar
FADS6_chr17_74872302_74898633	74893515	A A	AGGTTCCA others(12): Show AGGTTCCATGGGCTCCGTAG	frameshift_variant frameshift_variant	HIGH	NA19076.hp2 NA19076.hp2	a0013 a0013	a0013c0019 a0013c0019	a0013c0019t0001 a0013c0019t0001	a0013c0019t0001g0077 a0013c0019t0001g0077	1	440	0.0023	19	c.62_ others(24): Show c.62_80dupCTACGGAGCCCATGGAACC	p.Thr others(4): Show p.Thr28fs	FADS6	ENSG00000172782.13	transcript	ENST00000612771.5	protein_coding	1/6	118/2174	80/1107	27/368		chr17	TogoVar
FAM110C_chr2_33814_51505	46307	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA18947.hp2 NA18976.hp2 NA18978.hp1 others(4): Show NA18947.hp2 NA18976.hp2 NA18978.hp1 NA19006.hp1 NA19059.hp1 NA19067.hp2 NA19078.hp2	a0003 a0003	a0003c0003 a0003c0003	a0003c0003t0001 a0003c0003t0002 a0003c0003t0003 a0003c0003t0001 a0003c0003t0002 a0003c0003t0003	a0003c0003t0001g0017 a0003c0003t0002g0033 a0003c0003t0003g0018 a0003c0003t0001g0017 a0003c0003t0002g0033 a0003c0003t0003g0018	7	442	0.0158	1	c.78d others(3): Show c.78dupC	p.Asp others(4): Show p.Asp27fs	FAM110C	ENSG00000184731.6	transcript	ENST00000327669.5	protein_coding	1/2	198/3880	78/966	26/321		chr2	TogoVar
FAM111A_chr11_59137856_59160039	59152449	G G	GGCAGATA others(3): Show GGCAGATACTT	frameshift_variant frameshift_variant	HIGH	HG02257.hp1 HG02257.hp1	a0012 a0012	a0012c0009 a0012c0009	a0012c0009t0001 a0012c0009t0001	a0012c0009t0001g0002 a0012c0009t0001g0002	1	442	0.0023	10	c.782 others(17): Show c.782_791dupGCAGATACTT	p.Phe others(5): Show p.Phe264fs	FAM111A	ENSG00000166801.17	transcript	ENST00000675163.1	protein_coding	6/6	1410/3989	792/1836	264/611	INFO_REALIGN_3_PRIME	chr11	TogoVar
FAM120C_chrX_54063324_54188254	54132709	C C	CA CA	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0005 a0005	a0005c0007 a0005c0007	a0005c0007t0034 a0005c0007t0034	a0005c0007t0034g0007 a0005c0007t0034g0007	1	190	0.0053	1	c.204 others(10): Show c.2044_2045insT	p.Arg others(5): Show p.Arg682fs	FAM120C	ENSG00000184083.12	transcript	ENST00000375180.7	protein_coding	9/16	2100/8056	2044/3291	682/1096		chrX	TogoVar
FAM120C_chrX_54063324_54188254	54132790	CG CG	C C	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0005 a0005	a0005c0007 a0005c0007	a0005c0007t0034 a0005c0007t0034	a0005c0007t0034g0007 a0005c0007t0034g0007	1	190	0.0053	-1	c.196 others(5): Show c.1963delC	p.Arg others(5): Show p.Arg655fs	FAM120C	ENSG00000184083.12	transcript	ENST00000375180.7	protein_coding	9/16	2019/8056	1963/3291	655/1096		chrX	TogoVar
FAM120C_chrX_54063324_54188254	54132795	TA TA	T T	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0005 a0005	a0005c0007 a0005c0007	a0005c0007t0034 a0005c0007t0034	a0005c0007t0034g0007 a0005c0007t0034g0007	1	190	0.0053	-1	c.195 others(5): Show c.1958delT	p.Leu others(5): Show p.Leu653fs	FAM120C	ENSG00000184083.12	transcript	ENST00000375180.7	protein_coding	9/16	2014/8056	1958/3291	653/1096		chrX	TogoVar
FAM120C_chrX_54063324_54188254	54132832	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0005 a0005	a0005c0007 a0005c0007	a0005c0007t0034 a0005c0007t0034	a0005c0007t0034g0007 a0005c0007t0034g0007	1	190	0.0053	1	c.192 others(5): Show c.1921dupG	p.Asp others(5): Show p.Asp641fs	FAM120C	ENSG00000184083.12	transcript	ENST00000375180.7	protein_coding	9/16	1977/8056	1921/3291	641/1096		chrX	TogoVar
FAM120C_chrX_54063324_54188254	54133865	AG AG	A A	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0005 a0005	a0005c0007 a0005c0007	a0005c0007t0034 a0005c0007t0034	a0005c0007t0034g0007 a0005c0007t0034g0007	1	190	0.0053	-1	c.179 others(5): Show c.1797delC	p.Leu others(5): Show p.Leu600fs	FAM120C	ENSG00000184083.12	transcript	ENST00000375180.7	protein_coding	8/16	1853/8056	1797/3291	599/1096		chrX	TogoVar
FAM120C_chrX_54063324_54188254	54133938	A A	AC AC	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0005 a0005	a0005c0007 a0005c0007	a0005c0007t0034 a0005c0007t0034	a0005c0007t0034g0007 a0005c0007t0034g0007	1	190	0.0053	1	c.172 others(5): Show c.1724dupG	p.Asp others(5): Show p.Asp576fs	FAM120C	ENSG00000184083.12	transcript	ENST00000375180.7	protein_coding	8/16	1780/8056	1724/3291	575/1096		chrX	TogoVar
FAM120C_chrX_54063324_54188254	54133978	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0005 a0005	a0005c0007 a0005c0007	a0005c0007t0034 a0005c0007t0034	a0005c0007t0034g0007 a0005c0007t0034g0007	1	190	0.0053	-1	c.168 others(5): Show c.1684delG	p.Ala others(5): Show p.Ala562fs	FAM120C	ENSG00000184083.12	transcript	ENST00000375180.7	protein_coding	8/16	1740/8056	1684/3291	562/1096		chrX	TogoVar
FAM120C_chrX_54063324_54188254	54134933	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0005 a0005	a0005c0007 a0005c0007	a0005c0007t0034 a0005c0007t0034	a0005c0007t0034g0007 a0005c0007t0034g0007	1	190	0.0053	-1	c.151 others(5): Show c.1513delC	p.Gln others(5): Show p.Gln505fs	FAM120C	ENSG00000184083.12	transcript	ENST00000375180.7	protein_coding	7/16	1569/8056	1513/3291	505/1096		chrX	TogoVar
FAM120C_chrX_54063324_54188254	54135011	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0005 a0005	a0005c0007 a0005c0007	a0005c0007t0034 a0005c0007t0034	a0005c0007t0034g0007 a0005c0007t0034g0007	1	190	0.0053	-1	c.143 others(5): Show c.1435delC	p.His others(5): Show p.His479fs	FAM120C	ENSG00000184083.12	transcript	ENST00000375180.7	protein_coding	7/16	1491/8056	1435/3291	479/1096		chrX	TogoVar
FAM120C_chrX_54063324_54188254	54135017	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA18950.hp2 NA18950.hp2	a0006 a0006	a0006c0006 a0006c0006	a0006c0006t0001 a0006c0006t0001	a0006c0006t0001g0128 a0006c0006t0001g0128	1	190	0.0053	-1	c.142 others(5): Show c.1429delG	p.Glu others(5): Show p.Glu477fs	FAM120C	ENSG00000184083.12	transcript	ENST00000375180.7	protein_coding	7/16	1485/8056	1429/3291	477/1096		chrX	TogoVar
FAM120C_chrX_54063324_54188254	54182716	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19055.hp1 NA19055.hp1	a0008 a0008	a0008c0010 a0008c0010	a0008c0010t0075 a0008c0010t0075	a0008c0010t0075g0188 a0008c0010t0075g0188	1	190	0.0053	-1	c.482 others(4): Show c.482delG	p.Gly others(5): Show p.Gly161fs	FAM120C	ENSG00000184083.12	transcript	ENST00000375180.7	protein_coding	1/16	538/8056	482/3291	161/1096		chrX	TogoVar
FAM120C_chrX_54063324_54188254	54183088	C C	CTG CTG	frameshift_variant frameshift_variant	HIGH	NA19055.hp1 NA19055.hp1	a0008 a0008	a0008c0010 a0008c0010	a0008c0010t0075 a0008c0010t0075	a0008c0010t0075g0188 a0008c0010t0075g0188	1	190	0.0053	2	c.109 others(9): Show c.109_110dupCA	p.Gln others(4): Show p.Gln37fs	FAM120C	ENSG00000184083.12	transcript	ENST00000375180.7	protein_coding	1/16	166/8056	110/3291	37/1096		chrX	TogoVar
FAM120C_chrX_54063324_54188254	54183149	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19055.hp1 NA19055.hp1	a0008 a0008	a0008c0010 a0008c0010	a0008c0010t0075 a0008c0010t0075	a0008c0010t0075g0188 a0008c0010t0075g0188	1	190	0.0053	1	c.49d others(3): Show c.49dupG	p.Ala others(4): Show p.Ala17fs	FAM120C	ENSG00000184083.12	transcript	ENST00000375180.7	protein_coding	1/16	105/8056	49/3291	17/1096		chrX	TogoVar
FAM133A_chrX_93669206_93717265	93709683	TA TA	T T	frameshift_variant frameshift_variant	HIGH	NA19072.hp1 NA19072.hp1	a0004 a0004	a0004c0005 a0004c0005	a0004c0005t0008 a0004c0005t0008	a0004c0005t0008g0215 a0004c0005t0008g0215	1	298	0.0034	-1	c.271 others(4): Show c.271delA	p.Arg others(4): Show p.Arg91fs	FAM133A	ENSG00000179083.7	transcript	ENST00000683942.1	protein_coding	4/4	604/3179	271/747	91/248	INFO_REALIGN_3_PRIME	chrX	TogoVar
FAM133A_chrX_93669206_93717265	93709789	GA GA	G G	frameshift_variant frameshift_variant	HIGH	NA19072.hp1 NA19072.hp1	a0004 a0004	a0004c0005 a0004c0005	a0004c0005t0008 a0004c0005t0008	a0004c0005t0008g0215 a0004c0005t0008g0215	1	298	0.0034	-1	c.374 others(4): Show c.374delA	p.Lys others(5): Show p.Lys125fs	FAM133A	ENSG00000179083.7	transcript	ENST00000683942.1	protein_coding	4/4	707/3179	374/747	125/248	INFO_REALIGN_3_PRIME	chrX	TogoVar
FAM133A_chrX_93669206_93717265	93709950	CA CA	C C	frameshift_variant frameshift_variant	HIGH	NA19072.hp1 NA19072.hp1	a0004 a0004	a0004c0005 a0004c0005	a0004c0005t0008 a0004c0005t0008	a0004c0005t0008g0215 a0004c0005t0008g0215	1	298	0.0034	-1	c.538 others(4): Show c.538delA	p.Arg others(5): Show p.Arg180fs	FAM133A	ENSG00000179083.7	transcript	ENST00000683942.1	protein_coding	4/4	871/3179	538/747	180/248	INFO_REALIGN_3_PRIME	chrX	TogoVar
FAM151A_chr1_54604181_54628525	54610464	CCACTCCA others(22): Show CCACTCCACATTCAGACCGTCATCCCCAGG	C C	frameshift_variant frameshift_variant	HIGH	HG00099.hp1 HG00735.hp2 HG01074.hp2 others(2): Show HG00099.hp1 HG00735.hp2 HG01074.hp2 HG01081.hp1 HG02738.hp1	a0007 a0007	a0007c0012 a0007c0012	a0007c0012t0001 a0007c0012t0001	a0007c0012t0001g0147 a0007c0012t0001g0181 a0007c0012t0001g0182 others(2): Show a0007c0012t0001g0147 a0007c0012t0001g0181 a0007c0012t0001g0182 a0007c0012t0001g0188 a0007c0012t0001g0281	5	448	0.0112	-29	c.100 others(38): Show c.1003_1031delCCTGGGGATGACGGTCTGAATGTGGAGTG	p.Pro others(5): Show p.Pro335fs	FAM151A	ENSG00000162391.12	transcript	ENST00000302250.7	protein_coding	7/8	1161/1975	1003/1758	335/585		chr1	TogoVar
FAM156A_chrX_52942254_52963518	52947976	G G	GC GC	frameshift_variant frameshift_variant	HIGH	HG01515.hp1 HG01515.hp1	a0006 a0006	a0006c0002 a0006c0002	a0006c0002t0001 a0006c0002t0001	a0006c0002t0001g0083 a0006c0002t0001g0083	1	161	0.0062	1	c.612 others(4): Show c.612dupG	p.Leu others(5): Show p.Leu205fs	FAM156A	ENSG00000268350.8	transcript	ENST00000622447.5	protein_coding	3/3	3068/3791	612/642	204/213		chrX	TogoVar
FAM156A_chrX_52942254_52963518	52948109	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA18977.hp1 NA18977.hp1	a0005 a0005	a0005c0006 a0005c0006	a0005c0006t0014 a0005c0006t0014	a0005c0006t0014g0048 a0005c0006t0014g0048	1	161	0.0062	1	c.479 others(4): Show c.479dupG	p.Leu others(5): Show p.Leu161fs	FAM156A	ENSG00000268350.8	transcript	ENST00000622447.5	protein_coding	3/3	2935/3791	479/642	160/213		chrX	TogoVar
FAM156A_chrX_52942254_52963518	52948296	T T	TG TG	frameshift_variant frameshift_variant	HIGH	HG02647.hp1 HG02647.hp1	a0003 a0003	a0003c0004 a0003c0004	a0003c0004t0018 a0003c0004t0018	a0003c0004t0018g0066 a0003c0004t0018g0066	1	161	0.0062	1	c.292 others(4): Show c.292dupC	p.His others(4): Show p.His98fs	FAM156A	ENSG00000268350.8	transcript	ENST00000622447.5	protein_coding	3/3	2748/3791	292/642	98/213		chrX	TogoVar
FAM156A_chrX_52942254_52963518	52948328	C C	CT CT	frameshift_variant frameshift_variant	HIGH	NA19060.hp1 NA19060.hp1	a0004 a0004	a0004c0005 a0004c0005	a0004c0005t0002 a0004c0005t0002	a0004c0005t0002g0045 a0004c0005t0002g0045	1	161	0.0062	1	c.260 others(4): Show c.260dupA	p.Lys others(4): Show p.Lys88fs	FAM156A	ENSG00000268350.8	transcript	ENST00000622447.5	protein_coding	3/3	2716/3791	260/642	87/213		chrX	TogoVar
FAM156A_chrX_52942254_52963518	52948515	TG TG	T T	frameshift_variant frameshift_variant	HIGH	HG01515.hp1 HG01515.hp1	a0006 a0006	a0006c0002 a0006c0002	a0006c0002t0001 a0006c0002t0001	a0006c0002t0001g0083 a0006c0002t0001g0083	1	161	0.0062	-1	c.73d others(3): Show c.73delC	p.Gln others(4): Show p.Gln25fs	FAM156A	ENSG00000268350.8	transcript	ENST00000622447.5	protein_coding	3/3	2529/3791	73/642	25/213		chrX	TogoVar
FAM156B_chrX_52892330_52913560	52907565	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA18960.hp1 NA18960.hp1	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0011 a0002c0002t0011	a0002c0002t0011g0002 a0002c0002t0011g0002	1	182	0.0055	-1	c.344 others(4): Show c.344delC	p.Pro others(5): Show p.Pro115fs	FAM156B	ENSG00000179304.18	transcript	ENST00000416841.8	protein_coding	3/3	2766/3757	344/642	115/213	INFO_REALIGN_3_PRIME	chrX	TogoVar
FAM166B_chr9_35556831_35568878	35562396	A A	ATAGT ATAGT	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	HG00099.hp1 HG00438.hp1 HG00558.hp2 others(84): Show HG00099.hp1 HG00438.hp1 HG00558.hp2 HG00597.hp2 HG00621.hp1 HG00621.hp2 HG00642.hp1 HG00673.hp2 HG00738.hp2 HG01099.hp1 HG01891.hp2 HG01978.hp2 HG01993.hp1 HG02071.hp2 HG02074.hp2 HG02080.hp1 HG02148.hp1 HG02273.hp1 HG02451.hp1 HG02523.hp1 HG02523.hp2 HG02738.hp2 HG02976.hp2 HG03139.hp1 HG03225.hp2 HG03579.hp2 HG03654.hp2 HG03669.hp2 HG03688.hp2 HG03704.hp1 HG03710.hp2 HG03834.hp2 HG06807.hp1 NA18939.hp1 NA18940.hp1 NA18940.hp2 NA18944.hp2 NA18947.hp1 NA18953.hp2 NA18954.hp2 NA18960.hp2 NA18961.hp1 NA18964.hp1 NA18965.hp1 NA18967.hp1 NA18969.hp2 NA18973.hp2 NA18974.hp1 NA18975.hp1 NA18976.hp1 NA18979.hp1 NA18980.hp2 NA18981.hp1 NA18983.hp1 NA18984.hp2 NA18985.hp2 NA18988.hp2 NA18989.hp1 NA18991.hp2 NA18999.hp1 NA19003.hp2 NA19004.hp2 NA19005.hp2 NA19009.hp2 NA19010.hp1 NA19010.hp2 NA19012.hp1 NA19056.hp1 NA19057.hp1 NA19058.hp2 NA19062.hp1 NA19063.hp1 NA19064.hp2 NA19065.hp2 NA19066.hp2 NA19067.hp2 NA19074.hp2 NA19076.hp1 NA19077.hp2 NA19078.hp2 NA19079.hp1 NA19080.hp1 NA19081.hp1 NA19087.hp2 NA19089.hp1 NA19090.hp1 NA19090.hp2	a0002 a0003 a0002 a0003	a0002c0003 a0003c0004 a0003c0005 a0002c0003 a0003c0004 a0003c0005	a0002c0003t0001 a0002c0003t0002 a0003c0004t0001 others(1): Show a0002c0003t0001 a0002c0003t0002 a0003c0004t0001 a0003c0005t0001	a0002c0003t0001g0003 a0002c0003t0001g0015 a0002c0003t0001g0017 others(4): Show a0002c0003t0001g0003 a0002c0003t0001g0015 a0002c0003t0001g0017 a0002c0003t0001g0018 a0002c0003t0002g0019 a0003c0004t0001g0006 a0003c0005t0001g0009	87	436	0.1995	4	c.719 others(11): Show c.719_722dupACTA	p.Tyr others(5): Show p.Tyr241fs	FAM166B	ENSG00000215187.13	transcript	ENST00000399742.7	protein_coding	5/6	772/1054	722/828	241/275		chr9	TogoVar
FAM186B_chr12_49582505_49610639	49600279	T T	TGGAGTCC others(12): Show TGGAGTCCTCCCTTCTGGAA	frameshift_variant frameshift_variant	HIGH	HG01168.hp2 HG01168.hp2	a0010 a0010	a0010c0019 a0010c0019	a0010c0019t0001 a0010c0019t0001	a0010c0019t0001g0090 a0010c0019t0001g0090	1	266	0.0038	19	c.134 others(28): Show c.1342_1360dupTTCCAGAAGGGAGGACTCC	p.Gln others(5): Show p.Gln454fs	FAM186B	ENSG00000135436.8	transcript	ENST00000257894.2	protein_coding	4/7	1522/2944	1360/2682	454/893		chr12	TogoVar
FAM193A_chr4_2531647_2737573	2536987	C C	CG CG	frameshift_variant frameshift_variant	HIGH	HG00544.hp2 HG00741.hp2 HG01099.hp1 others(9): Show HG00544.hp2 HG00741.hp2 HG01099.hp1 HG01192.hp2 HG01517.hp2 HG02055.hp1 HG02615.hp2 HG03017.hp1 HG03927.hp2 NA18981.hp1 NA18981.hp2 NA19062.hp2	a0002 a0002	a0002c0006 a0002c0011 a0002c0012 others(2): Show a0002c0006 a0002c0011 a0002c0012 a0002c0013 a0002c0014	a0002c0006t0001 a0002c0006t0002 a0002c0006t0017 others(4): Show a0002c0006t0001 a0002c0006t0002 a0002c0006t0017 a0002c0011t0003 a0002c0012t0004 a0002c0013t0002 a0002c0014t0001	a0002c0006t0001g0242 a0002c0006t0001g0268 a0002c0006t0001g0287 others(9): Show a0002c0006t0001g0242 a0002c0006t0001g0268 a0002c0006t0001g0287 a0002c0006t0002g0046 a0002c0006t0002g0060 a0002c0006t0002g0102 a0002c0006t0002g0105 a0002c0006t0017g0096 a0002c0011t0003g0114 a0002c0012t0004g0328 a0002c0013t0002g0018 a0002c0014t0001g0270	12	330	0.0364	1	c.77d others(3): Show c.77dupG	p.Asn others(4): Show p.Asn27fs	FAM193A	ENSG00000125386.16	transcript	ENST00000637812.2	protein_coding	1/21	347/5522	78/4548	26/1515	INFO_REALIGN_3_PRIME	chr4	TogoVar
FAM210A_chr18_13658347_13731558	13666662	C C	CCCACCCC others(10): Show CCCACCCCCCTCTCCCAG	frameshift_variant frameshift_variant	HIGH	NA18968.hp1 NA18968.hp1	a0003 a0003	a0003c0005 a0003c0005	a0003c0005t0001 a0003c0005t0001	a0003c0005t0001g0189 a0003c0005t0001g0189	1	326	0.0031	17	c.636 others(24): Show c.636_637insCTGGGAGAGGGGGGTGG	p.Val others(5): Show p.Val213fs	FAM210A	ENSG00000177150.13	transcript	ENST00000651643.1	protein_coding	4/4	894/4210	636/819	212/272		chr18	TogoVar
FAM220A_chr7_6324411_6353967	6331130	CGAGGGGC others(39): Show CGAGGGGCCCTCTTCTGTCCCTCATGCTTCGTGTTCTTGGATGCGGT	C C	frameshift_variant others(1): Show frameshift_variant start_lost	HIGH	NA18974.hp1 NA18974.hp1	a0006 a0006	a0006c0014 a0006c0014	a0006c0014t0018 a0006c0014t0018	a0006c0014t0018g0324 a0006c0014t0018g0324	1	420	0.0024	-46	c.-22 others(52): Show c.-22_24delACCGCATCCAAGAACACGAAGCATGAGGGACAGAAGAGG GCCCCTC	p.Met others(3): Show p.Met1fs	FAM220A	ENSG00000178397.13	transcript	ENST00000313324.9	protein_coding	2/2	500/2220	1/780	1/259		chr7	TogoVar
FAM228B_chr2_24118469_24174638	24164308	GC GC	G G	frameshift_variant frameshift_variant	HIGH	HG00140.hp1 HG00323.hp2 HG00642.hp1 others(17): Show HG00140.hp1 HG00323.hp2 HG00642.hp1 HG01069.hp1 HG01081.hp2 HG02015.hp1 HG02071.hp2 HG02080.hp1 HG02630.hp2 HG03239.hp1 NA18943.hp2 NA18956.hp1 NA18972.hp2 NA18993.hp2 NA19001.hp2 NA19011.hp2 NA19043.hp1 NA19057.hp2 NA19079.hp2 NA20752.hp2	a0003 a0003	a0003c0004 a0003c0013 a0003c0004 a0003c0013	a0003c0004t0001 a0003c0013t0002 a0003c0004t0001 a0003c0013t0002	a0003c0004t0001g0093 a0003c0004t0001g0095 a0003c0004t0001g0096 others(17): Show a0003c0004t0001g0093 a0003c0004t0001g0095 a0003c0004t0001g0096 a0003c0004t0001g0097 a0003c0004t0001g0098 a0003c0004t0001g0099 a0003c0004t0001g0103 a0003c0004t0001g0104 a0003c0004t0001g0105 a0003c0004t0001g0106 a0003c0004t0001g0107 a0003c0004t0001g0108 a0003c0004t0001g0109 a0003c0004t0001g0111 a0003c0004t0001g0112 a0003c0004t0001g0114 a0003c0004t0001g0115 a0003c0004t0001g0116 a0003c0004t0001g0124 a0003c0013t0002g0063	20	290	0.0690	-1	c.907 others(4): Show c.907delC	p.Gln others(5): Show p.Gln303fs	FAM228B	ENSG00000219626.9	transcript	ENST00000615575.5	protein_coding	9/11	1004/1369	907/975	303/324	INFO_REALIGN_3_PRIME	chr2	TogoVar
FAM236B_chrX_72776865_72787660	72782010	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19005.hp1 NA19005.hp1	a0004 a0004	a0004c0003 a0004c0003	a0004c0003t0001 a0004c0003t0001	a0004c0003t0001g0007 a0004c0003t0001g0007	1	110	0.0091	1	c.219 others(8): Show c.219_220insC	p.Tyr others(4): Show p.Tyr74fs	FAM236B	ENSG00000268994.3	transcript	ENST00000596535.3	protein_coding	3/3	319/465	219/240	73/79		chrX	TogoVar
FAM236B_chrX_72776865_72787660	72782540	AAGGAAGG others(28): Show AAGGAAGGGAGTGAAGATCATGCTTCCAGGAGTGTG	A A	frameshift_variant others(1): Show frameshift_variant start_lost	HIGH	HG02886.hp1 HG02886.hp1	a0003 a0003	a0003c0004 a0003c0004	a0003c0004t0003 a0003c0004t0003	a0003c0004t0003g0010 a0003c0004t0003g0010	1	110	0.0091	-35	c.-15 others(41): Show c.-15_20delCACACTCCTGGAAGCATGATCTTCACTCCCTTCCT	p.Met others(3): Show p.Met1fs	FAM236B	ENSG00000268994.3	transcript	ENST00000596535.3	protein_coding	1/3	120/465	1/240	1/79		chrX	TogoVar
FAM236B_chrX_72776865_72787660	72782541	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19005.hp1 NA19005.hp1	a0004 a0004	a0004c0003 a0004c0003	a0004c0003t0001 a0004c0003t0001	a0004c0003t0001g0007 a0004c0003t0001g0007	1	110	0.0091	1	c.19d others(3): Show c.19dupC	p.Leu others(3): Show p.Leu7fs	FAM236B	ENSG00000268994.3	transcript	ENST00000596535.3	protein_coding	1/3	119/465	19/240	7/79		chrX	TogoVar
FAM236C_chrX_72907615_72918401	72912733	C C	CT CT	frameshift_variant frameshift_variant	HIGH	HG03239.hp2 HG03239.hp2	a0004 a0004	a0004c0005 a0004c0005	a0004c0005t0002 a0004c0005t0002	a0004c0005t0002g0005 a0004c0005t0002g0005	1	199	0.0050	1	c.21d others(3): Show c.21dupT	p.Pro others(3): Show p.Pro8fs	FAM236C	ENSG00000283594.1	transcript	ENST00000636267.1	protein_coding	1/3	122/463	22/240	8/79	INFO_REALIGN_3_PRIME	chrX	TogoVar
FAM236C_chrX_72907615_72918401	72912947	CA CA	C C	frameshift_variant frameshift_variant	HIGH	HG01496.hp2 HG01496.hp2	a0000 a0000	a0000c0004 a0000c0004	a0000c0004t0004 a0000c0004t0004	a0000c0004t0004g0006 a0000c0004t0004g0006	1	199	0.0050	-1	c.69d others(3): Show c.69delA	p.Asp others(4): Show p.Asp24fs	FAM236C	ENSG00000283594.1	transcript	ENST00000636267.1	protein_coding	2/3	169/463	69/240	23/79	INFO_REALIGN_3_PRIME	chrX	TogoVar
FAM246A_chr22_21355601_21366299	21360823	G G	GCAGGCGG others(4): Show GCAGGCGGGGAC	frameshift_variant frameshift_variant	HIGH	HG00673.hp2 NA18986.hp1 HG00673.hp2 NA18986.hp1	a0009 a0009	a0009c0011 a0009c0011	a0009c0011t0000 a0009c0011t0000	a0009c0011t0000g0000 a0009c0011t0000g0000	2	416	0.0048	11	c.476 others(18): Show c.476_477insGTCCCCGCCTG	p.Pro others(5): Show p.Pro160fs	FAM246A	ENSG00000286102.1	transcript	ENST00000652479.1	protein_coding	1/1	476/699	476/699	159/232		chr22	TogoVar
FAM47A_chrX_34124752_34137314	34130379	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19067.hp1 NA19067.hp1	a0017 a0017	a0017c0020 a0017c0020	a0017c0020t0001 a0017c0020t0001	a0017c0020t0001g0000 a0017c0020t0001g0000	1	324	0.0031	-1	c.189 others(5): Show c.1899delC	p.Lys others(5): Show p.Lys634fs	FAM47A	ENSG00000185448.12	transcript	ENST00000346193.5	protein_coding	1/1	1935/2563	1899/2376	633/791		chrX	TogoVar
FAM47A_chrX_34124752_34137314	34130502	CT CT	C C	frameshift_variant frameshift_variant	HIGH	NA19077.hp2 NA19077.hp2	a0010 a0010	a0010c0015 a0010c0015	a0010c0015t0001 a0010c0015t0001	a0010c0015t0001g0000 a0010c0015t0001g0000	1	324	0.0031	-1	c.177 others(5): Show c.1776delA	p.Glu others(5): Show p.Glu593fs	FAM47A	ENSG00000185448.12	transcript	ENST00000346193.5	protein_coding	1/1	1812/2563	1776/2376	592/791		chrX	TogoVar
FAM47A_chrX_34124752_34137314	34130962	CT CT	C C	frameshift_variant frameshift_variant	HIGH	NA19067.hp1 NA19067.hp1	a0017 a0017	a0017c0020 a0017c0020	a0017c0020t0001 a0017c0020t0001	a0017c0020t0001g0000 a0017c0020t0001g0000	1	324	0.0031	-1	c.131 others(5): Show c.1316delA	p.Lys others(5): Show p.Lys439fs	FAM47A	ENSG00000185448.12	transcript	ENST00000346193.5	protein_coding	1/1	1352/2563	1316/2376	439/791		chrX	TogoVar
FAM47A_chrX_34124752_34137314	34131056	A A	AC AC	frameshift_variant frameshift_variant	HIGH	NA19067.hp1 NA19067.hp1	a0017 a0017	a0017c0020 a0017c0020	a0017c0020t0001 a0017c0020t0001	a0017c0020t0001g0000 a0017c0020t0001g0000	1	324	0.0031	1	c.122 others(5): Show c.1222dupG	p.Val others(5): Show p.Val408fs	FAM47A	ENSG00000185448.12	transcript	ENST00000346193.5	protein_coding	1/1	1258/2563	1222/2376	408/791		chrX	TogoVar

Search by Variant

Search

Search Results (Total: 5828 hits)