Joint Open Genome and Omics Platform (JoGo)

Search by Variant

Regionname

e.g. ALDH2_chr12_111761933_111822532, HBB_chr11_5220464_5232071.

Chr

Chromosome name (e.g., chr11).

Snpeff genename

Exact SnpEff gene name.

Sampleids

Target sampleid (e.g. HG02615).

Snpeff haplotype class

Haplotype-annotation class (e.g., ahapid, ahapid+chapid).

Snpeff annotation impact

Exact impact level (e.g., HIGH, MODERATE, LOW).

Snpeff annotation impact detail

Keyword match in SnpEff annotation.

Hapid

One or more haplotype IDs (comma-separated; e.g., a0001, a01, a0001c0001, a01c02, a1c2, a0001c0001t0005, a0001c0001t0005g0018).

Samplehapid

Sample haplotype IDs to include (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

No_hapid

Haplotype IDs to exclude (comma-separated; e.g., a0001, a0002, a0001c0001, a0001c0001t0005, a1, a01).

No_samplehapid

Sample haplotype IDs to exclude (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

Start

Start position (GRCh38).

End

End position (GRCh38).

Minac

Minimum alternate allele count (≥).

Maxac

Maximum alternate allele count (≤).

Minlen

Minimum variant length (≥).

Maxlen

Maximum variant length (≤).

Sort By

Select column to sort.

Order by

Ascending or descending.

Show

Results per page.

regionname	pos	ref	alt	annotation	impact	samples	ahapids	achapids	acthapids	actghapids	ac	an	af	len	hgvs_c	hgvs_p	genename	geneid	featuretype	featureid	transcript_biotype	rank	cdna cdna pos length	cds cds pos length	aa aa pos length	status	chr	external
FRMPD3_chrX_107444652_107610251	107564885	AG AG	A A	frameshift_variant others(1): Show frameshift_variant splice_region_variant	HIGH	NA18974.hp1 NA18974.hp1	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0001 a0001c0001t0001	a0001c0001t0001g0149 a0001c0001t0001g0149	1	183	0.0055	-1	c.111 others(5): Show c.1117delG	p.Asp others(5): Show p.Asp373fs	FRMPD3	ENSG00000147234.11	transcript	ENST00000683843.1	protein_coding	12/15	1478/7573	1117/5334	373/1777	INFO_REALIGN_3_PRIME	chrX	TogoVar
FRMPD3_chrX_107444652_107610251	107576370	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA18985.hp1 NA18985.hp1	a0004 a0004	a0004c0013 a0004c0013	a0004c0013t0024 a0004c0013t0024	a0004c0013t0024g0002 a0004c0013t0024g0002	1	183	0.0055	1	c.135 others(5): Show c.1356dupG	p.Tyr others(5): Show p.Tyr453fs	FRMPD3	ENSG00000147234.11	transcript	ENST00000683843.1	protein_coding	13/15	1718/7573	1357/5334	453/1777	INFO_REALIGN_3_PRIME	chrX	TogoVar
FRMPD3_chrX_107444652_107610251	107601222	C C	CA CA	frameshift_variant frameshift_variant	HIGH	NA18965.hp1 NA18965.hp1	a0008 a0008	a0008c0016 a0008c0016	a0008c0016t0001 a0008c0016t0001	a0008c0016t0001g0107 a0008c0016t0001g0107	1	183	0.0055	1	c.318 others(5): Show c.3187dupA	p.Ser others(6): Show p.Ser1063fs	FRMPD3	ENSG00000147234.11	transcript	ENST00000683843.1	protein_coding	15/15	3549/7573	3188/5334	1063/1777	INFO_REALIGN_3_PRIME	chrX	TogoVar
FRMPD3_chrX_107444652_107610251	107601955	C C	CG CG	frameshift_variant frameshift_variant	HIGH	HG02145.hp1 HG03710.hp1 NA18965.hp1 others(2): Show HG02145.hp1 HG03710.hp1 NA18965.hp1 NA18985.hp1 NA19086.hp1	a0003 a0004 a0008 a0003 a0004 a0008	a0003c0007 a0003c0010 a0004c0013 others(1): Show a0003c0007 a0003c0010 a0004c0013 a0008c0016	a0003c0007t0001 a0003c0007t0015 a0003c0010t0002 others(2): Show a0003c0007t0001 a0003c0007t0015 a0003c0010t0002 a0004c0013t0024 a0008c0016t0001	a0003c0007t0001g0063 a0003c0007t0015g0104 a0003c0010t0002g0030 others(2): Show a0003c0007t0001g0063 a0003c0007t0015g0104 a0003c0010t0002g0030 a0004c0013t0024g0002 a0008c0016t0001g0107	5	183	0.0273	1	c.392 others(5): Show c.3923dupG	p.Arg others(6): Show p.Arg1309fs	FRMPD3	ENSG00000147234.11	transcript	ENST00000683843.1	protein_coding	15/15	4285/7573	3924/5334	1308/1777	INFO_REALIGN_3_PRIME	chrX	TogoVar
FRMPD3_chrX_107444652_107610251	107602783	G G	GC GC	frameshift_variant frameshift_variant	HIGH	HG01261.hp1 HG01261.hp1	a0009 a0009	a0009c0019 a0009c0019	a0009c0019t0001 a0009c0019t0001	a0009c0019t0001g0122 a0009c0019t0001g0122	1	183	0.0055	1	c.474 others(5): Show c.4747dupC	p.His others(6): Show p.His1583fs	FRMPD3	ENSG00000147234.11	transcript	ENST00000683843.1	protein_coding	15/15	5109/7573	4748/5334	1583/1777	INFO_REALIGN_3_PRIME	chrX	TogoVar
FRMPD4_chrX_12133473_12729523	12716298	CG CG	C C	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0007 a0007	a0007c0016 a0007c0016	a0007c0016t0001 a0007c0016t0001	a0007c0016t0001g0121 a0007c0016t0001g0121	1	174	0.0058	-1	c.184 others(5): Show c.1843delG	p.Glu others(5): Show p.Glu615fs	FRMPD4	ENSG00000169933.17	transcript	ENST00000675598.1	protein_coding	15/17	2342/8453	1843/5289	615/1762	INFO_REALIGN_3_PRIME	chrX	TogoVar
FRMPD4_chrX_12133473_12729523	12716670	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0007 a0007	a0007c0016 a0007c0016	a0007c0016t0001 a0007c0016t0001	a0007c0016t0001g0121 a0007c0016t0001g0121	1	174	0.0058	1	c.221 others(5): Show c.2212dupG	p.Asp others(5): Show p.Asp738fs	FRMPD4	ENSG00000169933.17	transcript	ENST00000675598.1	protein_coding	15/17	2712/8453	2213/5289	738/1762	INFO_REALIGN_3_PRIME	chrX	TogoVar
FRMPD4_chrX_12133473_12729523	12716686	GA GA	G G	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0007 a0007	a0007c0016 a0007c0016	a0007c0016t0001 a0007c0016t0001	a0007c0016t0001g0121 a0007c0016t0001g0121	1	174	0.0058	-1	c.223 others(5): Show c.2231delA	p.Asn others(5): Show p.Asn744fs	FRMPD4	ENSG00000169933.17	transcript	ENST00000675598.1	protein_coding	15/17	2730/8453	2231/5289	744/1762	INFO_REALIGN_3_PRIME	chrX	TogoVar
FRMPD4_chrX_12133473_12729523	12716711	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0007 a0007	a0007c0016 a0007c0016	a0007c0016t0001 a0007c0016t0001	a0007c0016t0001g0121 a0007c0016t0001g0121	1	174	0.0058	1	c.225 others(5): Show c.2254dupG	p.Asp others(5): Show p.Asp752fs	FRMPD4	ENSG00000169933.17	transcript	ENST00000675598.1	protein_coding	15/17	2754/8453	2255/5289	752/1762	INFO_REALIGN_3_PRIME	chrX	TogoVar
FRMPD4_chrX_12133473_12729523	12716715	CGA CGA	C C	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0007 a0007	a0007c0016 a0007c0016	a0007c0016t0001 a0007c0016t0001	a0007c0016t0001g0121 a0007c0016t0001g0121	1	174	0.0058	-2	c.225 others(11): Show c.2258_2259delAG	p.Glu others(5): Show p.Glu753fs	FRMPD4	ENSG00000169933.17	transcript	ENST00000675598.1	protein_coding	15/17	2757/8453	2258/5289	753/1762	INFO_REALIGN_3_PRIME	chrX	TogoVar
FRMPD4_chrX_12133473_12729523	12716725	T T	TGA TGA	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA19076.hp1 NA19076.hp1	a0007 a0007	a0007c0016 a0007c0016	a0007c0016t0001 a0007c0016t0001	a0007c0016t0001g0121 a0007c0016t0001g0121	1	174	0.0058	2	c.226 others(11): Show c.2267_2268insAG	p.Cys others(5): Show p.Cys756fs	FRMPD4	ENSG00000169933.17	transcript	ENST00000675598.1	protein_coding	15/17	2767/8453	2268/5289	756/1762	INFO_REALIGN_3_PRIME	chrX	TogoVar
FRMPD4_chrX_12133473_12729523	12717657	A A	AC AC	frameshift_variant frameshift_variant	HIGH	HG02135.hp1 HG02135.hp1	a0005 a0005	a0005c0019 a0005c0019	a0005c0019t0001 a0005c0019t0001	a0005c0019t0001g0130 a0005c0019t0001g0130	1	174	0.0058	1	c.283 others(5): Show c.2836dupC	p.Leu others(5): Show p.Leu946fs	FRMPD4	ENSG00000169933.17	transcript	ENST00000675598.1	protein_coding	16/17	3336/8453	2837/5289	946/1762	INFO_REALIGN_3_PRIME	chrX	TogoVar
FRS2_chr12_69465388_69584793	69571314	TTTAACAT others(21): Show TTTAACATGTTGCAAGAGATTATGCAAAA	T T	frameshift_variant frameshift_variant	HIGH	NA18987.hp1 NA18987.hp1	a0003 a0003	a0003c0003 a0003c0003	a0003c0003t0002 a0003c0003t0002	a0003c0003t0002g0324 a0003c0003t0002g0324	1	342	0.0029	-28	c.294 others(35): Show c.294_321delTAACATGTTGCAAGAGATTATGCAAAAT	p.Phe others(4): Show p.Phe98fs	FRS2	ENSG00000166225.9	transcript	ENST00000549921.6	protein_coding	7/9	697/6768	294/1527	98/508	INFO_REALIGN_3_PRIME	chr12	TogoVar
FSBP_chr8_94422716_94441944	94432600	TCCAACAT others(3): Show TCCAACATTAC	T T	frameshift_variant frameshift_variant	HIGH	NA18956.hp1 NA18956.hp1	a0003 a0003	a0003c0003 a0003c0003	a0003c0003t0001 a0003c0003t0001	a0003c0003t0001g0042 a0003c0003t0001g0042	1	428	0.0023	-10	c.421 others(17): Show c.421_430delGTAATGTTGG	p.Val others(5): Show p.Val141fs	FSBP	ENSG00000265817.4	transcript	ENST00000481490.3	protein_coding	2/2	506/5391	421/900	141/299		chr8	TogoVar
FSCB_chr14_44499149_44512283	44504951	A A	AGGGGCCT others(30): Show AGGGGCCTCCTCAGCTGGTGGAGGCTGAACTTCAGAGG	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA19075.hp2 NA19075.hp2	a0016 a0016	a0016c0023 a0016c0023	a0016c0023t0002 a0016c0023t0002	a0016c0023t0002g0000 a0016c0023t0002g0000	1	446	0.0022	37	c.203 others(46): Show c.2036_2037insCCTCTGAAGTTCAGCCTCCACCAGCTGAGGAGGCCC C	p.Ala others(5): Show p.Ala680fs	FSCB	ENSG00000189139.6	transcript	ENST00000340446.5	protein_coding	1/1	2332/3135	2036/2478	679/825		chr14	TogoVar
FSCB_chr14_44499149_44512283	44504985	G G	GAGGGGGC others(30): Show GAGGGGGCCTCCTCAGCTGGTGGAGGCTGAACTTCAGC	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA19030.hp2 NA19030.hp2	a0018 a0018	a0018c0022 a0018c0022	a0018c0022t0002 a0018c0022t0002	a0018c0022t0002g0000 a0018c0022t0002g0000	1	446	0.0022	37	c.200 others(46): Show c.2002_2003insGCTGAAGTTCAGCCTCCACCAGCTGAGGAGGCCCCC T	p.Ala others(5): Show p.Ala668fs	FSCB	ENSG00000189139.6	transcript	ENST00000340446.5	protein_coding	1/1	2298/3135	2002/2478	668/825		chr14	TogoVar
FSCN2_chr17_81523377_81542130	81528602	TG TG	T T	frameshift_variant frameshift_variant	HIGH	HG02074.hp2 NA18947.hp2 NA18953.hp2 others(2): Show HG02074.hp2 NA18947.hp2 NA18953.hp2 NA18962.hp1 NA19079.hp2	a0002 a0002	a0002c0005 a0002c0005	a0002c0005t0002 a0002c0005t0002	a0002c0005t0002g0008 a0002c0005t0002g0102 a0002c0005t0002g0103 a0002c0005t0002g0008 a0002c0005t0002g0102 a0002c0005t0002g0103	5	432	0.0116	-1	c.72d others(3): Show c.72delG	p.Thr others(4): Show p.Thr25fs	FSCN2	ENSG00000186765.12	transcript	ENST00000417245.7	protein_coding	1/5	227/1684	72/1479	24/492		chr17	TogoVar
FSD2_chr15_82750362_82811069	82782857	A A	AAGTATCT others(13): Show AAGTATCTAGGTTTTCTCCAC	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA19081.hp2 NA19081.hp2	a0010 a0010	a0010c0010 a0010c0010	a0010c0010t0004 a0010c0010t0004	a0010c0010t0004g0358 a0010c0010t0004g0358	1	384	0.0026	20	c.884 others(27): Show c.884_903dupGTGGAGAAAACCTAGATACT	p.Cys others(5): Show p.Cys302fs	FSD2	ENSG00000186628.12	transcript	ENST00000334574.12	protein_coding	4/13	1085/6418	903/2250	301/749		chr15	TogoVar
FTCD_chr21_46131779_46160579	46145471	C C	CGAAGCCT others(40): Show CGAAGCCTCGCGGAAGGGCGGGATCAGGCGCCGCATCGTCGTGTCCAG	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	HG04184.hp2 HG04184.hp2	a0014 a0014	a0014c0027 a0014c0027	a0014c0027t0002 a0014c0027t0002	a0014c0027t0002g0073 a0014c0027t0002g0073	1	230	0.0044	47	c.115 others(56): Show c.1159_1205dupCTGGACACGACGATGCGGCGCCTGATCCCGCCCTTC CGCGAGGCTTC	p.Ala others(5): Show p.Ala403fs	FTCD	ENSG00000160282.15	transcript	ENST00000397746.8	protein_coding	10/14	1261/1890	1205/1626	402/541		chr21	TogoVar
FTHL17_chrX_31066233_31077041	31071454	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19072.hp1 NA19072.hp1	a0000 a0000	a0000c0009 a0000c0009	a0000c0009t0005 a0000c0009t0005	a0000c0009t0005g0000 a0000c0009t0005g0000	1	336	0.0030	-1	c.499 others(4): Show c.499delG	p.Ala others(5): Show p.Ala167fs	FTHL17	ENSG00000132446.7	transcript	ENST00000359202.5	protein_coding	1/1	587/809	499/552	167/183		chrX	TogoVar
FTMT_chr5_121846882_121857833	121852489	GAATTGCA others(42): Show GAATTGCACGCTCTAGCCTCAGATAAAGGTGACCCCCATTTGTGCGATTT	G G	frameshift_variant frameshift_variant	HIGH	HG01255.hp2 HG01255.hp2	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0001 a0005c0005t0001	a0005c0005t0001g0000 a0005c0005t0001g0000	1	412	0.0024	-49	c.527 others(56): Show c.527_575delAATTGCACGCTCTAGCCTCAGATAAAGGTGACCCCCAT TTGTGCGATTT	p.Glu others(5): Show p.Glu176fs	FTMT	ENSG00000181867.3	transcript	ENST00000321339.3	protein_coding	1/1	609/952	527/729	176/242		chr5	TogoVar
FTSJ1_chrX_48471199_48491350	48479070	T T	TA TA	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0007 a0007	a0007c0005 a0007c0005	a0007c0005t0015 a0007c0005t0015	a0007c0005t0015g0071 a0007c0005t0015g0071	1	308	0.0033	1	c.317 others(4): Show c.317dupA	p.Cys others(5): Show p.Cys108fs	FTSJ1	ENSG00000068438.15	transcript	ENST00000348411.3	protein_coding	5/13	603/1899	318/990	106/329	INFO_REALIGN_3_PRIME	chrX	TogoVar
FTSJ1_chrX_48471199_48491350	48481655	T T	TA TA	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA19055.hp1 NA19055.hp1	a0005 a0005	a0005c0008 a0005c0008	a0005c0008t0008 a0005c0008t0008	a0005c0008t0008g0029 a0005c0008t0008g0029	1	308	0.0033	1	c.596 others(4): Show c.596dupA	p.Tyr others(5): Show p.Tyr199fs	FTSJ1	ENSG00000068438.15	transcript	ENST00000348411.3	protein_coding	9/13	882/1899	597/990	199/329	INFO_REALIGN_3_PRIME	chrX	TogoVar
FTSJ1_chrX_48471199_48491350	48481693	AC AC	A A	frameshift_variant frameshift_variant	HIGH	NA19055.hp1 NA19055.hp1	a0005 a0005	a0005c0008 a0005c0008	a0005c0008t0008 a0005c0008t0008	a0005c0008t0008g0029 a0005c0008t0008g0029	1	308	0.0033	-1	c.637 others(4): Show c.637delC	p.Leu others(5): Show p.Leu213fs	FTSJ1	ENSG00000068438.15	transcript	ENST00000348411.3	protein_coding	9/13	922/1899	637/990	213/329	INFO_REALIGN_3_PRIME	chrX	TogoVar
FTSJ1_chrX_48471199_48491350	48482421	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19055.hp1 NA19055.hp1	a0005 a0005	a0005c0008 a0005c0008	a0005c0008t0008 a0005c0008t0008	a0005c0008t0008g0029 a0005c0008t0008g0029	1	308	0.0033	-1	c.676 others(4): Show c.676delG	p.Asp others(5): Show p.Asp226fs	FTSJ1	ENSG00000068438.15	transcript	ENST00000348411.3	protein_coding	10/13	961/1899	676/990	226/329	INFO_REALIGN_3_PRIME	chrX	TogoVar
FTSJ1_chrX_48471199_48491350	48482461	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0007 a0007	a0007c0005 a0007c0005	a0007c0005t0015 a0007c0005t0015	a0007c0005t0015g0071 a0007c0005t0015g0071	1	308	0.0033	1	c.718 others(4): Show c.718dupG	p.Asp others(5): Show p.Asp240fs	FTSJ1	ENSG00000068438.15	transcript	ENST00000348411.3	protein_coding	10/13	1004/1899	719/990	240/329	INFO_REALIGN_3_PRIME	chrX	TogoVar
FTSJ1_chrX_48471199_48491350	48482501	C C	CA CA	frameshift_variant frameshift_variant	HIGH	NA19055.hp1 NA19055.hp1	a0005 a0005	a0005c0008 a0005c0008	a0005c0008t0008 a0005c0008t0008	a0005c0008t0008g0029 a0005c0008t0008g0029	1	308	0.0033	1	c.754 others(8): Show c.754_755insA	p.Leu others(5): Show p.Leu252fs	FTSJ1	ENSG00000068438.15	transcript	ENST00000348411.3	protein_coding	10/13	1040/1899	755/990	252/329		chrX	TogoVar
FTSJ1_chrX_48471199_48491350	48482638	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA18956.hp1 NA19006.hp1 NA19055.hp1 NA18956.hp1 NA19006.hp1 NA19055.hp1	a0003 a0004 a0005 a0003 a0004 a0005	a0003c0006 a0004c0007 a0005c0008 a0003c0006 a0004c0007 a0005c0008	a0003c0006t0013 a0004c0007t0001 a0005c0008t0008 a0003c0006t0013 a0004c0007t0001 a0005c0008t0008	a0003c0006t0013g0025 a0004c0007t0001g0069 a0005c0008t0008g0029 a0003c0006t0013g0025 a0004c0007t0001g0069 a0005c0008t0008g0029	3	308	0.0097	1	c.807 others(4): Show c.807dupC	p.Ile others(5): Show p.Ile270fs	FTSJ1	ENSG00000068438.15	transcript	ENST00000348411.3	protein_coding	11/13	1093/1899	808/990	270/329	INFO_REALIGN_3_PRIME	chrX	TogoVar
FTSJ1_chrX_48471199_48491350	48482664	AG AG	A A	frameshift_variant frameshift_variant	HIGH	NA18956.hp1 NA18956.hp1	a0003 a0003	a0003c0006 a0003c0006	a0003c0006t0013 a0003c0006t0013	a0003c0006t0013g0025 a0003c0006t0013g0025	1	308	0.0033	-1	c.829 others(4): Show c.829delG	p.Ala others(5): Show p.Ala277fs	FTSJ1	ENSG00000068438.15	transcript	ENST00000348411.3	protein_coding	11/13	1114/1899	829/990	277/329	INFO_REALIGN_3_PRIME	chrX	TogoVar
FTSJ1_chrX_48471199_48491350	48482786	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19055.hp1 NA19055.hp1	a0005 a0005	a0005c0008 a0005c0008	a0005c0008t0008 a0005c0008t0008	a0005c0008t0008g0029 a0005c0008t0008g0029	1	308	0.0033	-1	c.953 others(4): Show c.953delC	p.Pro others(5): Show p.Pro318fs	FTSJ1	ENSG00000068438.15	transcript	ENST00000348411.3	protein_coding	11/13	1238/1899	953/990	318/329	INFO_REALIGN_3_PRIME	chrX	TogoVar
FUNDC1_chrX_44518639_44547859	44527271	T T	TTG TTG	frameshift_variant frameshift_variant	HIGH	NA19055.hp1 NA19055.hp1	a0002 a0002	a0002c0004 a0002c0004	a0002c0004t0001 a0002c0004t0001	a0002c0004t0001g0109 a0002c0004t0001g0109	1	313	0.0032	2	c.354 others(9): Show c.354_355dupCA	p.Lys others(5): Show p.Lys119fs	FUNDC1	ENSG00000069509.6	transcript	ENST00000378045.5	protein_coding	4/5	382/1054	355/468	119/155		chrX	TogoVar
FUZ_chr19_49801866_49818292	49807343	C C	CTCATCTT others(3): Show CTCATCTTCTG	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA18978.hp2 NA18978.hp2	a0009 a0009	a0009c0012 a0009c0012	a0009c0012t0001 a0009c0012t0001	a0009c0012t0001g0080 a0009c0012t0001g0080	1	410	0.0024	10	c.105 others(19): Show c.1055_1064dupCAGAAGATGA	p.Glu others(5): Show p.Glu355fs	FUZ	ENSG00000010361.14	transcript	ENST00000313777.9	protein_coding	11/11	1250/1728	1064/1257	355/418		chr19	TogoVar
FUZ_chr19_49801866_49818292	49812306	A A	ACCTCAGA others(40): Show ACCTCAGATGACAGAACAATGAGGGTGATGCTGTGGAATGGAAGTGAG	frameshift_variant frameshift_variant	HIGH	NA18944.hp2 NA18944.hp2	a0008 a0008	a0008c0011 a0008c0011	a0008c0011t0002 a0008c0011t0002	a0008c0011t0002g0061 a0008c0011t0002g0061	1	410	0.0024	47	c.234 others(57): Show c.234-18_262dupCTCACTTCCATTCCACAGCATCACCCTCATTGTTC TGTCATCTGAGG	p.Val others(4): Show p.Val88fs	FUZ	ENSG00000010361.14	transcript	ENST00000313777.9	protein_coding	3/11	448/1728	262/1257	88/418		chr19	TogoVar
FXR2_chr17_7586230_7619897	7614455	G G	GAAAGGAA others(3): Show GAAAGGAAAAA	frameshift_variant frameshift_variant	HIGH	NA18906.hp1 NA18906.hp1	a0002 a0002	a0002c0007 a0002c0007	a0002c0007t0002 a0002c0007t0002	a0002c0007t0002g0058 a0002c0007t0002g0058	1	426	0.0024	10	c.77_ others(15): Show c.77_78insTTTTTCCTTT	p.Lys others(4): Show p.Lys27fs	FXR2	ENSG00000129245.13	transcript	ENST00000250113.12	protein_coding	1/17	442/2987	77/2022	26/673		chr17	TogoVar
FZD8_chr10_35633247_35647296	35639499	GGC GGC	G G	frameshift_variant frameshift_variant	HIGH	HG02132.hp2 NA18954.hp2 NA18979.hp2 others(2): Show HG02132.hp2 NA18954.hp2 NA18979.hp2 NA18987.hp2 NA19089.hp2	a0000 a0000	a0000c0005 a0000c0005	a0000c0005t0001 a0000c0005t0004 a0000c0005t0001 a0000c0005t0004	a0000c0005t0001g0000 a0000c0005t0004g0000 a0000c0005t0001g0000 a0000c0005t0004g0000	5	404	0.0124	-2	c.192 others(11): Show c.1929_1930delGC	p.Pro others(5): Show p.Pro644fs	FZD8	ENSG00000177283.8	transcript	ENST00000374694.3	protein_coding	1/1	2797/4050	1929/2085	643/694		chr10	TogoVar
G6PD_chrX_154526391_154551846	154532709	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0007 a0007	a0007c0010 a0007c0010	a0007c0010t0006 a0007c0010t0006	a0007c0010t0006g0088 a0007c0010t0006g0088	1	285	0.0035	1	c.114 others(5): Show c.1144dupC	p.His others(5): Show p.His382fs	G6PD	ENSG00000160211.20	transcript	ENST00000393562.10	protein_coding	10/13	1210/2223	1144/1548	382/515		chrX	TogoVar
G6PD_chrX_154526391_154551846	154532787	AG AG	A A	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0007 a0007	a0007c0010 a0007c0010	a0007c0010t0006 a0007c0010t0006	a0007c0010t0006g0088 a0007c0010t0006g0088	1	285	0.0035	-1	c.106 others(5): Show c.1066delC	p.Leu others(5): Show p.Leu356fs	G6PD	ENSG00000160211.20	transcript	ENST00000393562.10	protein_coding	10/13	1132/2223	1066/1548	356/515		chrX	TogoVar
G6PD_chrX_154526391_154551846	154533004	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA19083.hp1 NA19083.hp1	a0010 a0010	a0010c0012 a0010c0012	a0010c0012t0001 a0010c0012t0001	a0010c0012t0001g0068 a0010c0012t0001g0068	1	285	0.0035	1	c.988 others(4): Show c.988dupC	p.Arg others(5): Show p.Arg330fs	G6PD	ENSG00000160211.20	transcript	ENST00000393562.10	protein_coding	9/13	1054/2223	988/1548	330/515		chrX	TogoVar
G6PD_chrX_154526391_154551846	154533597	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0007 a0007	a0007c0010 a0007c0010	a0007c0010t0006 a0007c0010t0006	a0007c0010t0006g0088 a0007c0010t0006g0088	1	285	0.0035	1	c.842 others(4): Show c.842dupC	p.Asp others(5): Show p.Asp282fs	G6PD	ENSG00000160211.20	transcript	ENST00000393562.10	protein_coding	8/13	908/2223	842/1548	281/515		chrX	TogoVar
G6PD_chrX_154526391_154551846	154533651	G G	GT GT	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0007 a0007	a0007c0010 a0007c0010	a0007c0010t0006 a0007c0010t0006	a0007c0010t0006g0088 a0007c0010t0006g0088	1	285	0.0035	1	c.788 others(4): Show c.788dupA	p.His others(5): Show p.His263fs	G6PD	ENSG00000160211.20	transcript	ENST00000393562.10	protein_coding	8/13	854/2223	788/1548	263/515		chrX	TogoVar
G6PD_chrX_154526391_154551846	154534091	CT CT	C C	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0007 a0007	a0007c0010 a0007c0010	a0007c0010t0006 a0007c0010t0006	a0007c0010t0006g0088 a0007c0010t0006g0088	1	285	0.0035	-1	c.713 others(4): Show c.713delA	p.Lys others(5): Show p.Lys238fs	G6PD	ENSG00000160211.20	transcript	ENST00000393562.10	protein_coding	7/13	779/2223	713/1548	238/515		chrX	TogoVar
G6PD_chrX_154526391_154551846	154534125	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0007 a0007	a0007c0010 a0007c0010	a0007c0010t0006 a0007c0010t0006	a0007c0010t0006g0088 a0007c0010t0006g0088	1	285	0.0035	1	c.679 others(4): Show c.679dupC	p.Arg others(5): Show p.Arg227fs	G6PD	ENSG00000160211.20	transcript	ENST00000393562.10	protein_coding	7/13	745/2223	679/1548	227/515		chrX	TogoVar
G6PD_chrX_154526391_154551846	154534135	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0007 a0007	a0007c0010 a0007c0010	a0007c0010t0006 a0007c0010t0006	a0007c0010t0006g0088 a0007c0010t0006g0088	1	285	0.0035	1	c.669 others(4): Show c.669dupC	p.Ile others(5): Show p.Ile224fs	G6PD	ENSG00000160211.20	transcript	ENST00000393562.10	protein_coding	7/13	735/2223	669/1548	223/515		chrX	TogoVar
G6PD_chrX_154526391_154551846	154534401	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0007 a0007	a0007c0010 a0007c0010	a0007c0010t0006 a0007c0010t0006	a0007c0010t0006g0088 a0007c0010t0006g0088	1	285	0.0035	1	c.580 others(4): Show c.580dupG	p.Asp others(5): Show p.Asp194fs	G6PD	ENSG00000160211.20	transcript	ENST00000393562.10	protein_coding	6/13	646/2223	580/1548	194/515		chrX	TogoVar
G6PD_chrX_154526391_154551846	154534468	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0007 a0007	a0007c0010 a0007c0010	a0007c0010t0006 a0007c0010t0006	a0007c0010t0006g0088 a0007c0010t0006g0088	1	285	0.0035	1	c.513 others(4): Show c.513dupG	p.Pro others(5): Show p.Pro172fs	G6PD	ENSG00000160211.20	transcript	ENST00000393562.10	protein_coding	6/13	579/2223	513/1548	171/515		chrX	TogoVar
G6PD_chrX_154526391_154551846	154535246	CG CG	C C	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0007 a0007	a0007c0010 a0007c0010	a0007c0010t0006 a0007c0010t0006	a0007c0010t0006g0088 a0007c0010t0006g0088	1	285	0.0035	-1	c.406 others(4): Show c.406delC	p.Arg others(5): Show p.Arg136fs	G6PD	ENSG00000160211.20	transcript	ENST00000393562.10	protein_coding	5/13	472/2223	406/1548	136/515		chrX	TogoVar
G6PD_chrX_154526391_154551846	154535274	C C	CA CA	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0007 a0007	a0007c0010 a0007c0010	a0007c0010t0006 a0007c0010t0006	a0007c0010t0006g0088 a0007c0010t0006g0088	1	285	0.0035	1	c.378 others(4): Show c.378dupT	p.Ala others(5): Show p.Ala127fs	G6PD	ENSG00000160211.20	transcript	ENST00000393562.10	protein_coding	5/13	444/2223	378/1548	126/515		chrX	TogoVar
G6PD_chrX_154526391_154551846	154535337	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0007 a0007	a0007c0010 a0007c0010	a0007c0010t0006 a0007c0010t0006	a0007c0010t0006g0088 a0007c0010t0006g0088	1	285	0.0035	1	c.315 others(4): Show c.315dupC	p.Ser others(5): Show p.Ser106fs	G6PD	ENSG00000160211.20	transcript	ENST00000393562.10	protein_coding	5/13	381/2223	315/1548	105/515		chrX	TogoVar
G6PD_chrX_154526391_154551846	154535983	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA18940.hp1 NA18985.hp2 NA18940.hp1 NA18985.hp2	a0004 a0004	a0004c0007 a0004c0007	a0004c0007t0001 a0004c0007t0001	a0004c0007t0001g0070 a0004c0007t0001g0106 a0004c0007t0001g0070 a0004c0007t0001g0106	2	285	0.0070	1	c.220 others(4): Show c.220dupC	p.Arg others(4): Show p.Arg74fs	G6PD	ENSG00000160211.20	transcript	ENST00000393562.10	protein_coding	4/13	286/2223	220/1548	74/515		chrX	TogoVar
G6PD_chrX_154526391_154551846	154535983	C C	CT CT	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0007 a0007	a0007c0010 a0007c0010	a0007c0010t0006 a0007c0010t0006	a0007c0010t0006g0088 a0007c0010t0006g0088	1	285	0.0035	1	c.220 others(8): Show c.220_221insA	p.Arg others(4): Show p.Arg74fs	G6PD	ENSG00000160211.20	transcript	ENST00000393562.10	protein_coding	4/13	286/2223	220/1548	74/515		chrX	TogoVar

Search by Variant

Search

Search Results (Total: 5828 hits)