JoGo: Joint Open Genome and Omics Platform

Search by Variant

Regionname

e.g. ALDH2_chr12_111761933_111822532, HBB_chr11_5220464_5232071.

Chr

Chromosome name (e.g., chr11).

Snpeff genename

Exact SnpEff gene name.

Sampleids

Target sampleid (e.g. HG02615).

Snpeff haplotype class

Haplotype-annotation class (e.g., ahapid, ahapid+chapid).

Snpeff annotation impact

Exact impact level (e.g., HIGH, MODERATE, LOW).

Snpeff annotation impact detail

Keyword match in SnpEff annotation.

Hapid

One or more haplotype IDs (comma-separated; e.g., a0001, a01, a0001c0001, a01c02, a1c2, a0001c0001t0005, a0001c0001t0005g0018).

Samplehapid

Sample haplotype IDs to include (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

No_hapid

Haplotype IDs to exclude (comma-separated; e.g., a0001, a0002, a0001c0001, a0001c0001t0005, a1, a01).

No_samplehapid

Sample haplotype IDs to exclude (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

Start

Start position (GRCh38).

End

End position (GRCh38).

Minac

Minimum alternate allele count (≥).

Maxac

Maximum alternate allele count (≤).

Minlen

Minimum variant length (≥).

Maxlen

Maximum variant length (≤).

Sort By

Select column to sort.

Order by

Ascending or descending.

Show

Results per page.

regionname	pos	ref	alt	annotation	impact	samples	ahapids	achapids	acthapids	actghapids	ac	an	af	len	hgvs_c	hgvs_p	genename	geneid	featuretype	featureid	transcript_biotype	rank	cdna cdna pos length	cds cds pos length	aa aa pos length	status	chr	external
NPIPB11_chr16_29376310_29411711	29382102	T T	TGGAAGGT others(132): Show TGGAAGGTGTCTTGAGATTATCATCCGCTGAGGGTGGAAGCGGAACCCAC AGACGCTCCCCGCAGACGCTCGGCAGGTGTCTTGATATTATCATCTGCTG AGGGTGGAGCTGAGGGTGGAAGGGGAGTGAGCTGACGCTC	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	HG01934.hp1 NA18961.hp2 HG01934.hp1 NA18961.hp2	a0096 a0097 a0096 a0097	a0096c0075 a0097c0074 a0096c0075 a0097c0074	a0096c0075t0001 a0097c0074t0001 a0096c0075t0001 a0097c0074t0001	a0096c0075t0001g0182 a0097c0074t0001g0161 a0096c0075t0001g0182 a0097c0074t0001g0161	2	428	0.0047	139	c.282 others(148): Show c.2829_2830insGAGCGTCAGCTCACTCCCCTTCCACCCTCAGCTCCA CCCTCAGCAGATGATAATATCAAGACACCTGCCGAGCGTCTGCGGGGAGC GTCTGTGGGTTCCGCTTCCACCCTCAGCGGATGATAATCTCAAGACACCT TCC	p.Lys others(5): Show p.Lys944fs	NPIPB11	ENSG00000254206.6	transcript	ENST00000698511.1	protein_coding	8/8	5576/6369	2829/3486	943/1161		chr16	TogoVar
NPIPB11_chr16_29376310_29411711	29383170	G G	A A	stop_gained stop_gained	HIGH	HG03927.hp1 HG03927.hp1	a0002 a0002	a0002c0080 a0002c0080	a0002c0080t0001 a0002c0080t0001	a0002c0080t0001g0132 a0002c0080t0001g0132	1	428	0.0023	0	c.176 others(4): Show c.1762C>T	p.Gln others(4): Show p.Gln588*	NPIPB11	ENSG00000254206.6	transcript	ENST00000698511.1	protein_coding	8/8	4509/6369	1762/3486	588/1161		chr16	TogoVar
NPIPB13_chr16_30217897_30253479	30224220	C C	CGGCAGGT others(226): Show CGGCAGGTGTCTTGATATTATCATCTGCTGAGGGTGGAGCTGAGGGTGGA AGGGGAGTGAGCTGACGCTCGGAAGGTGTCTTGAGATTATCATCGGCTGA TGGTGGAAGCGGAATCCGCAGACGCTCAGCAGGTATCTTGATATTATCAT CTGCTGAGAGTGGAGCTGAGGGTGGAAGGGGAGTGAGCTGACGCTCGGAA GGTGTCTTGAGATTATCATCCGCTGAGGGTGGAA	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	HG02683.hp2 HG02683.hp2	a0049 a0049	a0049c0021 a0049c0021	a0049c0021t0001 a0049c0021t0001	a0049c0021t0001g0040 a0049c0021t0001g0040	1	145	0.0069	233	c.222 others(242): Show c.2225_2226insTTCCACCCTCAGCGGATGATAATCTCAAGACACCTT CCGAGCGTCAGCTCACTCCCCTTCCACCCTCAGCTCCACTCTCAGCAGAT GATAATATCAAGATACCTGCTGAGCGTCTGCGGATTCCGCTTCCACCATC AGCCGATGATAATCTCAAGACACCTTCCGAGCGTCAGCTCACTCCCCTTC CACCCTCAGCTCCACCCTCAGCAGATGATAATATCAAGACACCTGCC	p.Val others(5): Show p.Val744fs	NPIPB13	ENSG00000198064.15	transcript	ENST00000697092.1	protein_coding	8/8	4968/6292	2225/3417	742/1138		chr16	TogoVar
NPIPB4_chr16_21829582_21862756	21836161	C C	CAGCAGGT others(100): Show CAGCAGGTATCTTGATATTATCATCTGCTGAGGGTGGAGCTGAGGGTGGA AGGGGAGTGAGCTGACGCTCGGAAGGTGTCTTGAGATTATCATCCGCTGA GGGTGGAA	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	HG03927.hp2 HG03927.hp2	a0055 a0055	a0055c0057 a0055c0057	a0055c0057t0001 a0055c0057t0001	a0055c0057t0001g0130 a0055c0057t0001g0130	1	204	0.0049	107	c.222 others(116): Show c.2225_2226insTTCCACCCTCAGCGGATGATAATCTCAAGACACCTT CCGAGCGTCAGCTCACTCCCCTTCCACCCTCAGCTCCACCCTCAGCAGAT GATAATATCAAGATACCTGCT	p.Val others(5): Show p.Val744fs	NPIPB4	ENSG00000185864.19	transcript	ENST00000682606.1	protein_coding	8/8	2440/4020	2225/3669	742/1222		chr16	TogoVar
NPIPB4_chr16_21829582_21862756	21836287	C C	CAGCAGGT others(100): Show CAGCAGGTATCTTGATATTATCATCTGCTGAGGGTGGAGCTGAGGGTGGA AGGGGAGTGAGCTGACGCTCGGAAGGTGTCTTGAGATTATCATCCGCTGA GGGTGGAA	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	HG02015.hp1 HG02015.hp1	a0057 a0057	a0057c0058 a0057c0058	a0057c0058t0001 a0057c0058t0001	a0057c0058t0001g0182 a0057c0058t0001g0182	1	204	0.0049	107	c.209 others(116): Show c.2099_2100insTTCCACCCTCAGCGGATGATAATCTCAAGACACCTT CCGAGCGTCAGCTCACTCCCCTTCCACCCTCAGCTCCACCCTCAGCAGAT GATAATATCAAGATACCTGCT	p.Val others(5): Show p.Val702fs	NPIPB4	ENSG00000185864.19	transcript	ENST00000682606.1	protein_coding	8/8	2314/4020	2099/3669	700/1222		chr16	TogoVar
NPIPB5_chr16_22505891_22541535	22534941	C C	CTTCCACC others(97): Show CTTCCACCCTCAGCGGATGATCTCAAGACACCTTCCGAGCGTCAGCTCAC TCCCCTTCCACCCTCAGCTCCACCCTCAGCAGATGATAATATCAAGATAC CTGCT	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	HG00621.hp1 HG00621.hp1	a0029 a0029	a0029c0003 a0029c0003	a0029c0003t0010 a0029c0003t0010	a0029c0003t0010g0043 a0029c0003t0010g0043	1	47	0.0213	104	c.195 others(113): Show c.1958_1959insTTCCACCCTCAGCGGATGATCTCAAGACACCTTCCG AGCGTCAGCTCACTCCCCTTCCACCCTCAGCTCCACCCTCAGCAGATGAT AATATCAAGATACCTGCT	p.Val others(5): Show p.Val655fs	NPIPB5	ENSG00000243716.12	transcript	ENST00000424340.7	protein_coding	7/7	4870/6463	1959/3402	653/1133		chr16	TogoVar
NPIPB7_chr16_28451329_28477336	28456547	C C	CGATTGTT others(36): Show CGATTGTTCCACCTCATCCACCCTCCGCCTCCTTGGGTTTCGGT	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	HG02109.hp2 HG02109.hp2	a0020 a0020	a0020c0022 a0020c0022	a0020c0022t0005 a0020c0022t0005	a0020c0022t0005g0099 a0020c0022t0005g0099	1	382	0.0026	43	c.112 others(52): Show c.1121_1122insACCGAAACCCAAGGAGGCGGAGGGTGGATGAGGTGG AACAATC	p.Arg others(5): Show p.Arg379fs	NPIPB7	ENSG00000233232.8	transcript	ENST00000452313.6	protein_coding	7/7	3019/3238	1121/1245	374/414		chr16	TogoVar
NPSR1_chr7_34653218_34854978	34848498	G G	A A	stop_gained stop_gained	HIGH	HG02055.hp1 HG02886.hp2 HG02055.hp1 HG02886.hp2	a0012 a0012	a0012c0016 a0012c0016	a0012c0016t0002 a0012c0016t0005 a0012c0016t0002 a0012c0016t0005	a0012c0016t0002g0119 a0012c0016t0005g0118 a0012c0016t0002g0119 a0012c0016t0005g0118	2	260	0.0077	0	c.860 others(3): Show c.860G>A	p.Trp others(4): Show p.Trp287*	NPSR1	ENSG00000187258.14	transcript	ENST00000360581.6	protein_coding	8/9	1055/1634	860/1116	287/371		chr7	TogoVar
NR4A1_chr12_52046442_52064503	52054347	C C	T T	stop_gained stop_gained	HIGH	NA18968.hp2 NA18968.hp2	a0005 a0005	a0005c0017 a0005c0017	a0005c0017t0001 a0005c0017t0001	a0005c0017t0001g0101 a0005c0017t0001g0101	1	422	0.0024	0	c.19C others(2): Show c.19C>T	p.Gln others(2): Show p.Gln7*	NR4A1	ENSG00000123358.20	transcript	ENST00000394825.6	protein_coding	2/7	148/2485	19/1797	7/598		chr12	TogoVar
NR5A1_chr9_124476236_124512399	124503109	T T	A A	stop_gained stop_gained	HIGH	HG03239.hp1 HG03239.hp1	a0003 a0003	a0003c0014 a0003c0014	a0003c0014t0009 a0003c0014t0009	a0003c0014t0009g0046 a0003c0014t0009g0046	1	356	0.0028	0	c.214 others(3): Show c.214A>T	p.Lys others(3): Show p.Lys72*	NR5A1	ENSG00000136931.10	transcript	ENST00000373588.9	protein_coding	3/7	380/3074	214/1386	72/461		chr9	TogoVar
NRBP1_chr2_27423631_27447259	27439857	C C	A A	stop_gained stop_gained	HIGH	HG01517.hp2 HG01517.hp2	a0005 a0005	a0005c0006 a0005c0006	a0005c0006t0001 a0005c0006t0001	a0005c0006t0001g0069 a0005c0006t0001g0069	1	276	0.0036	0	c.995 others(3): Show c.995C>A	p.Ser others(4): Show p.Ser332*	NRBP1	ENSG00000115216.14	transcript	ENST00000379852.8	protein_coding	11/18	1116/2176	995/1608	332/535		chr2	TogoVar
NSUN4_chr1_46335807_46370018	46360791	C C	T T	stop_gained stop_gained	HIGH	HG03942.hp2 HG03942.hp2	a0011 a0011	a0011c0009 a0011c0009	a0011c0009t0014 a0011c0009t0014	a0011c0009t0014g0079 a0011c0009t0014g0079	1	388	0.0026	0	c.841 others(3): Show c.841C>T	p.Arg others(4): Show p.Arg281*	NSUN4	ENSG00000117481.11	transcript	ENST00000474844.6	protein_coding	5/6	861/4347	841/1155	281/384		chr1	TogoVar
NSUN6_chr10_18540561_18656587	18551939	G G	A A	stop_gained stop_gained	HIGH	NA19007.hp2 NA19007.hp2	a0006 a0006	a0006c0007 a0006c0007	a0006c0007t0001 a0006c0007t0001	a0006c0007t0001g0089 a0006c0007t0001g0089	1	346	0.0029	0	c.955 others(3): Show c.955C>T	p.Arg others(4): Show p.Arg319*	NSUN6	ENSG00000241058.4	transcript	ENST00000377304.7	protein_coding	9/11	1339/2166	955/1410	319/469		chr10	TogoVar
NSUN7_chr4_40744955_40816184	40808386	T T	A A	stop_gained stop_gained	HIGH	HG03130.hp1 HG03130.hp1	a0013 a0013	a0013c0012 a0013c0012	a0013c0012t0001 a0013c0012t0001	a0013c0012t0001g0011 a0013c0012t0001g0011	1	392	0.0026	0	c.160 others(4): Show c.1604T>A	p.Leu others(4): Show p.Leu535*	NSUN7	ENSG00000179299.17	transcript	ENST00000381782.7	protein_coding	12/12	2041/4839	1604/2157	535/718		chr4	TogoVar
NSUN7_chr4_40744955_40816184	40808395	C C	A A	stop_gained stop_gained	HIGH	HG03130.hp1 HG03130.hp1	a0013 a0013	a0013c0012 a0013c0012	a0013c0012t0001 a0013c0012t0001	a0013c0012t0001g0011 a0013c0012t0001g0011	1	392	0.0026	0	c.161 others(4): Show c.1613C>A	p.Ser others(4): Show p.Ser538*	NSUN7	ENSG00000179299.17	transcript	ENST00000381782.7	protein_coding	12/12	2050/4839	1613/2157	538/718		chr4	TogoVar
NSUN7_chr4_40744955_40816184	40808398	C C	A A	stop_gained stop_gained	HIGH	HG03130.hp1 HG03130.hp1	a0013 a0013	a0013c0012 a0013c0012	a0013c0012t0001 a0013c0012t0001	a0013c0012t0001g0011 a0013c0012t0001g0011	1	392	0.0026	0	c.161 others(4): Show c.1616C>A	p.Ser others(4): Show p.Ser539*	NSUN7	ENSG00000179299.17	transcript	ENST00000381782.7	protein_coding	12/12	2053/4839	1616/2157	539/718		chr4	TogoVar
NSUN7_chr4_40744955_40816184	40808418	A A	AAATCAGT others(8): Show AAATCAGTGCGAGTAT	stop_gained others(1): Show stop_gained conservative_inframe_insertion	HIGH	HG03130.hp1 HG03130.hp1	a0013 a0013	a0013c0012 a0013c0012	a0013c0012t0001 a0013c0012t0001	a0013c0012t0001g0011 a0013c0012t0001g0011	1	392	0.0026	15	c.163 others(24): Show c.1638_1639insTCAGTGCGAGTATAA	p.Lys others(28): Show p.Lys546_Lys547insSerValArgValTer	NSUN7	ENSG00000179299.17	transcript	ENST00000381782.7	protein_coding	12/12	2076/4839	1639/2157	547/718	INFO_REALIGN_3_PRIME	chr4	TogoVar
NT5C1B_chr2_18557871_18594569	18584890	G G	T T	stop_gained stop_gained	HIGH	HG01106.hp1 HG01192.hp1 HG01255.hp1 others(30): Show HG01106.hp1 HG01192.hp1 HG01255.hp1 HG01256.hp2 HG01433.hp2 HG01515.hp2 HG01517.hp2 HG01975.hp2 HG01978.hp1 HG02004.hp1 HG02132.hp1 HG02135.hp1 HG02148.hp2 HG02273.hp2 NA18943.hp2 NA18963.hp2 NA18964.hp1 NA18965.hp1 NA18968.hp1 NA18975.hp1 NA18984.hp2 NA18988.hp2 NA19009.hp1 NA19011.hp2 NA19056.hp2 NA19058.hp1 NA19062.hp1 NA19064.hp2 NA19065.hp1 NA19065.hp2 NA19082.hp1 NA20300.hp1 homoSapiens_chm13v2.hp1	a0002 a0002	a0002c0003 a0002c0003	a0002c0003t0002 a0002c0003t0002	a0002c0003t0002g0003 a0002c0003t0002g0009 a0002c0003t0002g0020 others(12): Show a0002c0003t0002g0003 a0002c0003t0002g0009 a0002c0003t0002g0020 a0002c0003t0002g0021 a0002c0003t0002g0022 a0002c0003t0002g0221 a0002c0003t0002g0222 a0002c0003t0002g0223 a0002c0003t0002g0224 a0002c0003t0002g0225 a0002c0003t0002g0226 a0002c0003t0002g0227 a0002c0003t0002g0228 a0002c0003t0002g0229 a0002c0003t0002g0230	33	392	0.0842	0	c.347 others(3): Show c.347C>A	p.Ser others(4): Show p.Ser116*	NT5C1B	ENSG00000185013.17	transcript	ENST00000304081.9	protein_coding	4/9	448/2679	347/1653	116/550		chr2	TogoVar
NT5C1B_chr2_18557871_18594569	18586355	G G	A A	stop_gained stop_gained	HIGH	HG02630.hp2 HG02630.hp2	a0004 a0004	a0004c0011 a0004c0011	a0004c0011t0002 a0004c0011t0002	a0004c0011t0002g0246 a0004c0011t0002g0246	1	392	0.0026	0	c.157 others(3): Show c.157C>T	p.Arg others(3): Show p.Arg53*	NT5C1B	ENSG00000185013.17	transcript	ENST00000304081.9	protein_coding	3/9	258/2679	157/1653	53/550		chr2	TogoVar
NT5DC2_chr3_52519387_52538857	52528195	G G	C C	stop_gained stop_gained	HIGH	NA19080.hp1 NA19080.hp1	a0009 a0009	a0009c0016 a0009c0016	a0009c0016t0002 a0009c0016t0002	a0009c0016t0002g0062 a0009c0016t0002g0062	1	386	0.0026	0	c.759 others(3): Show c.759C>G	p.Tyr others(4): Show p.Tyr253*	NT5DC2	ENSG00000168268.11	transcript	ENST00000422318.7	protein_coding	6/14	879/1877	759/1674	253/557		chr3	TogoVar
NT5M_chr17_17298373_17352663	17303758	G G	T T	stop_gained stop_gained	HIGH	HG03239.hp2 HG03239.hp2	a0002 a0002	a0002c0005 a0002c0005	a0002c0005t0001 a0002c0005t0001	a0002c0005t0001g0082 a0002c0005t0001g0082	1	348	0.0029	0	c.208 others(3): Show c.208G>T	p.Glu others(3): Show p.Glu70*	NT5M	ENSG00000205309.14	transcript	ENST00000389022.9	protein_coding	1/5	386/1581	208/687	70/228		chr17	TogoVar
NTN5_chr19_48656407_48678017	48661962	G G	C C	stop_gained stop_gained	HIGH	HG00621.hp1 HG00621.hp1	a0006 a0006	a0006c0016 a0006c0016	a0006c0016t0002 a0006c0016t0002	a0006c0016t0002g0139 a0006c0016t0002g0139	1	412	0.0024	0	c.118 others(4): Show c.1185C>G	p.Tyr others(4): Show p.Tyr395*	NTN5	ENSG00000142233.14	transcript	ENST00000270235.11	protein_coding	7/7	1291/1846	1185/1470	395/489		chr19	TogoVar
NTRK1_chr1_156855865_156886850	156876154	C C	CTTGCTGA others(30): Show CTTGCTGAGTGCCACAACCTCCTGCCTGAGCAGGACAA	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA20905.hp1 NA20905.hp1	a0011 a0011	a0011c0025 a0011c0025	a0011c0025t0001 a0011c0025t0001	a0011c0025t0001g0202 a0011c0025t0001g0202	1	392	0.0026	37	c.157 others(46): Show c.1577_1613dupTTGCTGAGTGCCACAACCTCCTGCCTGAGCAGGACA A	p.Lys others(5): Show p.Lys538fs	NTRK1	ENSG00000198400.14	transcript	ENST00000524377.7	protein_coding	13/17	1684/2669	1614/2391	538/796	INFO_REALIGN_3_PRIME	chr1	TogoVar
NUB1_chr7_151336812_151383449	151360159	G G	T T	stop_gained stop_gained	HIGH	NA19003.hp1 NA19003.hp1	a0011 a0011	a0011c0009 a0011c0009	a0011c0009t0009 a0011c0009t0009	a0011c0009t0009g0070 a0011c0009t0009g0070	1	418	0.0024	0	c.712 others(3): Show c.712G>T	p.Gly others(4): Show p.Gly238*	NUB1	ENSG00000013374.17	transcript	ENST00000568733.6	protein_coding	8/15	749/3109	712/1848	238/615		chr7	TogoVar
NUB1_chr7_151336812_151383449	151360189	A A	T T	stop_gained stop_gained	HIGH	NA19003.hp1 NA19003.hp1	a0011 a0011	a0011c0009 a0011c0009	a0011c0009t0009 a0011c0009t0009	a0011c0009t0009g0070 a0011c0009t0009g0070	1	418	0.0024	0	c.742 others(3): Show c.742A>T	p.Lys others(4): Show p.Lys248*	NUB1	ENSG00000013374.17	transcript	ENST00000568733.6	protein_coding	8/15	779/3109	742/1848	248/615		chr7	TogoVar
NUDT13_chr10_73105455_73136823	73125121	C C	T T	stop_gained stop_gained	HIGH	HG03209.hp2 HG03209.hp2	a0004 a0004	a0004c0010 a0004c0010	a0004c0010t0001 a0004c0010t0001	a0004c0010t0001g0075 a0004c0010t0001g0075	1	324	0.0031	0	c.469 others(3): Show c.469C>T	p.Gln others(4): Show p.Gln157*	NUDT13	ENSG00000166321.14	transcript	ENST00000357321.9	protein_coding	6/9	591/2101	469/1059	157/352		chr10	TogoVar
NUDT13_chr10_73105455_73136823	73125151	C C	T T	stop_gained stop_gained	HIGH	HG03209.hp2 HG03209.hp2	a0004 a0004	a0004c0010 a0004c0010	a0004c0010t0001 a0004c0010t0001	a0004c0010t0001g0075 a0004c0010t0001g0075	1	324	0.0031	0	c.499 others(3): Show c.499C>T	p.Gln others(4): Show p.Gln167*	NUDT13	ENSG00000166321.14	transcript	ENST00000357321.9	protein_coding	6/9	621/2101	499/1059	167/352		chr10	TogoVar
NUDT13_chr10_73105455_73136823	73125163	A A	T T	stop_gained stop_gained	HIGH	HG03209.hp2 HG03209.hp2	a0004 a0004	a0004c0010 a0004c0010	a0004c0010t0001 a0004c0010t0001	a0004c0010t0001g0075 a0004c0010t0001g0075	1	324	0.0031	0	c.511 others(3): Show c.511A>T	p.Arg others(4): Show p.Arg171*	NUDT13	ENSG00000166321.14	transcript	ENST00000357321.9	protein_coding	6/9	633/2101	511/1059	171/352		chr10	TogoVar
NUDT7_chr16_77717514_77747260	77722604	G G	T T	stop_gained stop_gained	HIGH	HG01070.hp1 HG01358.hp2 HG01975.hp2 others(3): Show HG01070.hp1 HG01358.hp2 HG01975.hp2 HG01978.hp2 HG02148.hp1 HG02300.hp2	a0004 a0004	a0004c0004 a0004c0004	a0004c0004t0001 a0004c0004t0001	a0004c0004t0001g0003 a0004c0004t0001g0213 a0004c0004t0001g0003 a0004c0004t0001g0213	6	462	0.0130	0	c.22G others(2): Show c.22G>T	p.Glu others(2): Show p.Glu8*	NUDT7	ENSG00000140876.11	transcript	ENST00000268533.9	protein_coding	1/4	91/1096	22/717	8/238		chr16	TogoVar
NUDT8_chr11_67622938_67634937	67627985	A A	T T	stop_gained stop_gained	HIGH	HG00558.hp1 HG00558.hp2 HG02293.hp2 others(13): Show HG00558.hp1 HG00558.hp2 HG02293.hp2 NA18941.hp1 NA18950.hp1 NA18971.hp1 NA18983.hp2 NA18985.hp1 NA18993.hp2 NA19004.hp1 NA19004.hp2 NA19005.hp1 NA19057.hp1 NA19060.hp1 NA19065.hp2 NA19084.hp1	a0002 a0002	a0002c0004 a0002c0004	a0002c0004t0001 a0002c0004t0001	a0002c0004t0001g0005 a0002c0004t0001g0005	16	376	0.0426	0	c.672 others(3): Show c.672T>A	p.Cys others(4): Show p.Cys224*	NUDT8	ENSG00000167799.10	transcript	ENST00000376693.3	protein_coding	4/4	698/745	672/711	224/236		chr11	TogoVar
NUMA1_chr11_71997864_72085542	72005248	A A	ATAGCAGG others(23): Show ATAGCAGGTCTTCAGATGTGGGGGGCACACT	stop_gained others(1): Show stop_gained disruptive_inframe_insertion	HIGH	NA18992.hp1 NA18992.hp1	a0016 a0016	a0016c0025 a0016c0025	a0016c0025t0001 a0016c0025t0001	a0016c0025t0001g0204 a0016c0025t0001g0204	1	244	0.0041	30	c.578 others(39): Show c.5784_5813dupAGTGTGCCCCCCACATCTGAAGACCTGCTA	p.Cys others(45): Show p.Cys1937_Tyr1938insTerValCysProProHisLeuLysThrCys	NUMA1	ENSG00000137497.19	transcript	ENST00000393695.8	protein_coding	23/27	6000/7198	5813/6348	1938/2115		chr11	TogoVar
NUTM1_chr15_34338315_34362735	34357423	C C	T T	stop_gained stop_gained	HIGH	HG03486.hp2 HG03486.hp2	a0025 a0025	a0025c0019 a0025c0019	a0025c0019t0009 a0025c0019t0009	a0025c0019t0009g0237 a0025c0019t0009g0237	1	454	0.0022	0	c.341 others(4): Show c.3415C>T	p.Gln others(5): Show p.Gln1139*	NUTM1	ENSG00000184507.17	transcript	ENST00000537011.6	protein_coding	8/8	3797/4109	3415/3483	1139/1160		chr15	TogoVar
NUTM2B_chr10_79698227_79717758	79708709	C C	T T	stop_gained stop_gained	HIGH	HG02257.hp1 HG02451.hp1 HG02559.hp1 others(2): Show HG02257.hp1 HG02451.hp1 HG02559.hp1 HG02647.hp1 HG02809.hp1	a0010 a0010	a0010c0012 a0010c0012	a0010c0012t0001 a0010c0012t0001	a0010c0012t0001g0001 a0010c0012t0001g0001	5	305	0.0164	0	c.109 others(4): Show c.1093C>T	p.Arg others(4): Show p.Arg365*	NUTM2B	ENSG00000188199.11	transcript	ENST00000429828.7	protein_coding	3/7	1476/3293	1093/2637	365/878		chr10	TogoVar
NUTM2F_chr9_94313198_94333644	94318641	G G	A A	stop_gained stop_gained	HIGH	HG00639.hp1 HG00639.hp1	a0017 a0017	a0017c0020 a0017c0020	a0017c0020t0001 a0017c0020t0001	a0017c0020t0001g0101 a0017c0020t0001g0101	1	322	0.0031	0	c.209 others(4): Show c.2095C>T	p.Arg others(4): Show p.Arg699*	NUTM2F	ENSG00000130950.15	transcript	ENST00000253262.9	protein_coding	7/7	2116/2559	2095/2271	699/756		chr9	TogoVar
NUTM2F_chr9_94313198_94333644	94319708	G G	A A	stop_gained stop_gained	HIGH	NA19085.hp1 NA19085.hp1	a0018 a0018	a0018c0022 a0018c0022	a0018c0022t0001 a0018c0022t0001	a0018c0022t0001g0055 a0018c0022t0001g0055	1	322	0.0031	0	c.139 others(4): Show c.1390C>T	p.Arg others(4): Show p.Arg464*	NUTM2F	ENSG00000130950.15	transcript	ENST00000253262.9	protein_coding	6/7	1411/2559	1390/2271	464/756		chr9	TogoVar
NWD1_chr19_16714847_16822953	16744622	G G	T T	stop_gained stop_gained	HIGH	HG01891.hp2 HG02257.hp2 HG02280.hp2 others(6): Show HG01891.hp2 HG02257.hp2 HG02280.hp2 HG02572.hp2 HG02896.hp1 HG02965.hp1 HG03209.hp1 HG03540.hp1 NA19030.hp1	a0009 a0014 a0009 a0014	a0009c0028 a0009c0029 a0009c0068 others(3): Show a0009c0028 a0009c0029 a0009c0068 a0009c0069 a0014c0025 a0014c0054	a0009c0028t0002 a0009c0028t0034 a0009c0029t0002 others(4): Show a0009c0028t0002 a0009c0028t0034 a0009c0029t0002 a0009c0068t0040 a0009c0069t0043 a0014c0025t0002 a0014c0054t0025	a0009c0028t0002g0115 a0009c0028t0034g0258 a0009c0029t0002g0297 others(6): Show a0009c0028t0002g0115 a0009c0028t0034g0258 a0009c0029t0002g0297 a0009c0029t0002g0298 a0009c0068t0040g0116 a0009c0069t0043g0299 a0014c0025t0002g0048 a0014c0025t0002g0049 a0014c0054t0025g0118	9	300	0.0300	0	c.400 others(3): Show c.400G>T	p.Glu others(4): Show p.Glu134*	NWD1	ENSG00000188039.17	transcript	ENST00000524140.7	protein_coding	5/19	951/7764	400/4299	134/1432		chr19	TogoVar
NXPE2_chr11_114673527_114712069	114706793	A A	T T	stop_gained stop_gained	HIGH	NA18977.hp2 NA18977.hp2	a0012 a0012	a0012c0017 a0012c0017	a0012c0017t0003 a0012c0017t0003	a0012c0017t0003g0177 a0012c0017t0003g0177	1	428	0.0023	0	c.154 others(4): Show c.1543A>T	p.Arg others(4): Show p.Arg515*	NXPE2	ENSG00000204361.10	transcript	ENST00000389586.6	protein_coding	6/6	1592/1868	1543/1680	515/559		chr11	TogoVar
NYNRIN_chr14_24394003_24424283	24415697	C C	CTCTACGG others(9): Show CTCTACGGGATAGTGGT	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA19081.hp2 NA19081.hp2	a0014 a0014	a0014c0022 a0014c0022	a0014c0022t0003 a0014c0022t0003	a0014c0022t0003g0201 a0014c0022t0003g0201	1	450	0.0022	16	c.394 others(25): Show c.3949_3950insCTACGGGATAGTGGTT	p.Phe others(6): Show p.Phe1317fs	NYNRIN	ENSG00000205978.6	transcript	ENST00000382554.4	protein_coding	9/9	4051/7635	3950/5697	1317/1898	INFO_REALIGN_3_PRIME	chr14	TogoVar
NYNRIN_chr14_24394003_24424283	24415793	C C	A A	stop_gained stop_gained	HIGH	NA19081.hp2 NA19081.hp2	a0014 a0014	a0014c0022 a0014c0022	a0014c0022t0003 a0014c0022t0003	a0014c0022t0003g0201 a0014c0022t0003g0201	1	450	0.0022	0	c.404 others(4): Show c.4044C>A	p.Tyr others(5): Show p.Tyr1348*	NYNRIN	ENSG00000205978.6	transcript	ENST00000382554.4	protein_coding	9/9	4145/7635	4044/5697	1348/1898		chr14	TogoVar
OAS2_chr12_112973519_113016723	113003070	C C	T T	stop_gained stop_gained	HIGH	NA18941.hp1 NA18941.hp1	a0002 a0002	a0002c0012 a0002c0012	a0002c0012t0001 a0002c0012t0001	a0002c0012t0001g0001 a0002c0012t0001g0001	1	380	0.0026	0	c.114 others(4): Show c.1147C>T	p.Arg others(4): Show p.Arg383*	OAS2	ENSG00000111335.14	transcript	ENST00000392583.7	protein_coding	6/10	1237/4622	1147/2064	383/687		chr12	TogoVar
OAS3_chr12_112933474_112978251	112961236	G G	A A	stop_gained stop_gained	HIGH	HG00621.hp2 HG00621.hp2	a0014 a0014	a0014c0022 a0014c0022	a0014c0022t0001 a0014c0022t0001	a0014c0022t0001g0037 a0014c0022t0001g0037	1	370	0.0027	0	c.182 others(4): Show c.1823G>A	p.Trp others(4): Show p.Trp608*	OAS3	ENSG00000111331.14	transcript	ENST00000228928.12	protein_coding	8/16	1880/6599	1823/3264	608/1087		chr12	TogoVar
OAS3_chr12_112933474_112978251	112965870	C C	T T	stop_gained stop_gained	HIGH	HG02735.hp1 HG02735.hp1	a0015 a0015	a0015c0025 a0015c0025	a0015c0025t0026 a0015c0025t0026	a0015c0025t0026g0104 a0015c0025t0026g0104	1	370	0.0027	0	c.253 others(4): Show c.2530C>T	p.Arg others(4): Show p.Arg844*	OAS3	ENSG00000111331.14	transcript	ENST00000228928.12	protein_coding	12/16	2587/6599	2530/3264	844/1087		chr12	TogoVar
OBSCN_chr1_228203044_228383876	228282202	A A	T T	stop_gained stop_gained	HIGH	HG00423.hp2 HG00438.hp2 HG00544.hp1 others(36): Show HG00423.hp2 HG00438.hp2 HG00544.hp1 HG00558.hp2 HG00673.hp2 HG02015.hp2 HG02027.hp2 HG02056.hp2 HG02080.hp2 HG02083.hp2 HG02132.hp1 HG02165.hp1 HG03098.hp1 HG03453.hp1 HG06807.hp2 NA18906.hp2 NA18939.hp1 NA18940.hp1 NA18940.hp2 NA18951.hp2 NA18954.hp1 NA18959.hp1 NA18970.hp1 NA18977.hp1 NA18982.hp1 NA18986.hp2 NA18992.hp1 NA18993.hp2 NA19004.hp1 NA19011.hp2 NA19012.hp1 NA19054.hp1 NA19065.hp2 NA19067.hp2 NA19080.hp2 NA19081.hp1 NA19083.hp1 NA19085.hp1 NA19091.hp1	a0004 a0008 a0027 others(14): Show a0004 a0008 a0027 a0028 a0038 a0040 a0041 a0043 a0122 a0139 a0140 a0141 a0142 a0147 a0163 a0164 a0167	a0004c0006 a0004c0013 a0004c0123 others(22): Show a0004c0006 a0004c0013 a0004c0123 a0004c0150 a0004c0151 a0008c0027 a0008c0035 a0008c0085 a0008c0086 a0027c0016 a0028c0196 a0028c0197 a0038c0033 a0040c0028 a0041c0026 a0043c0023 a0122c0122 a0139c0084 a0140c0081 a0141c0082 a0142c0087 a0147c0143 a0163c0053 a0164c0049 a0167c0048	a0004c0006t0001 a0004c0006t0003 a0004c0013t0001 others(23): Show a0004c0006t0001 a0004c0006t0003 a0004c0013t0001 a0004c0123t0001 a0004c0150t0001 a0004c0151t0001 a0008c0027t0003 a0008c0035t0001 a0008c0085t0003 a0008c0086t0003 a0027c0016t0003 a0028c0196t0002 a0028c0197t0002 a0038c0033t0003 a0040c0028t0003 a0041c0026t0003 a0043c0023t0001 a0122c0122t0001 a0139c0084t0003 a0140c0081t0003 a0141c0082t0003 a0142c0087t0003 a0147c0143t0001 a0163c0053t0001 a0164c0049t0001 a0167c0048t0001	a0004c0006t0001g0137 a0004c0006t0001g0142 a0004c0006t0001g0143 others(36): Show a0004c0006t0001g0137 a0004c0006t0001g0142 a0004c0006t0001g0143 a0004c0006t0003g0005 a0004c0006t0003g0115 a0004c0013t0001g0141 a0004c0013t0001g0145 a0004c0013t0001g0146 a0004c0123t0001g0140 a0004c0150t0001g0010 a0004c0151t0001g0283 a0008c0027t0003g0297 a0008c0027t0003g0300 a0008c0035t0001g0166 a0008c0035t0001g0228 a0008c0085t0003g0306 a0008c0086t0003g0308 a0027c0016t0003g0302 a0027c0016t0003g0312 a0027c0016t0003g0313 a0028c0196t0002g0041 a0028c0197t0002g0036 a0038c0033t0003g0005 a0038c0033t0003g0116 a0040c0028t0003g0294 a0040c0028t0003g0307 a0041c0026t0003g0296 a0041c0026t0003g0310 a0043c0023t0001g0173 a0043c0023t0001g0174 a0122c0122t0001g0138 a0139c0084t0003g0290 a0140c0081t0003g0303 a0141c0082t0003g0298 a0142c0087t0003g0309 a0147c0143t0001g0128 a0163c0053t0001g0122 a0164c0049t0001g0121 a0167c0048t0001g0125	39	320	0.1219	0	c.975 others(4): Show c.9754A>T	p.Arg others(5): Show p.Arg3252*	OBSCN	ENSG00000154358.23	transcript	ENST00000680850.1	protein_coding	36/116	9914/27019	9754/26778	3252/8925		chr1	TogoVar
OBSCN_chr1_228203044_228383876	228309230	C C	T T	stop_gained stop_gained	HIGH	HG01891.hp1 HG01891.hp1	a0108 a0108	a0108c0157 a0108c0157	a0108c0157t0001 a0108c0157t0001	a0108c0157t0001g0183 a0108c0157t0001g0183	1	320	0.0031	0	c.157 others(5): Show c.15742C>T	p.Gln others(5): Show p.Gln5248*	OBSCN	ENSG00000154358.23	transcript	ENST00000680850.1	protein_coding	59/116	15902/27019	15742/26778	5248/8925		chr1	TogoVar
OBSL1_chr2_219545728_219576539	219554618	G G	A A	stop_gained stop_gained	HIGH	HG01099.hp2 HG02818.hp1 HG01099.hp2 HG02818.hp1	a0022 a0022	a0022c0033 a0022c0033	a0022c0033t0001 a0022c0033t0001	a0022c0033t0001g0035 a0022c0033t0001g0035	2	380	0.0053	0	c.473 others(4): Show c.4732C>T	p.Gln others(5): Show p.Gln1578*	OBSL1	ENSG00000124006.15	transcript	ENST00000404537.6	protein_coding	15/21	5039/6105	4732/5691	1578/1896		chr2	TogoVar
ODAD1_chr19_48291462_48326971	48320308	C C	A A	stop_gained stop_gained	HIGH	NA18998.hp1 NA18998.hp1	a0013 a0013	a0013c0033 a0013c0033	a0013c0033t0002 a0013c0033t0002	a0013c0033t0002g0238 a0013c0033t0002g0238	1	398	0.0025	0	c.61G others(2): Show c.61G>T	p.Glu others(3): Show p.Glu21*	ODAD1	ENSG00000105479.16	transcript	ENST00000674294.1	protein_coding	3/16	418/2995	61/2124	21/707		chr19	TogoVar
ODAD2_chr10_27807168_28004079	27983938	G G	A A	stop_gained stop_gained	HIGH	HG03041.hp1 HG03041.hp1	a0012 a0012	a0012c0038 a0012c0038	a0012c0038t0002 a0012c0038t0002	a0012c0038t0002g0170 a0012c0038t0002g0170	1	304	0.0033	0	c.724 others(3): Show c.724C>T	p.Gln others(4): Show p.Gln242*	ODAD2	ENSG00000169126.16	transcript	ENST00000305242.10	protein_coding	6/20	848/3603	724/3135	242/1044		chr10	TogoVar
ODAPH_chr4_75551066_75569817	75564230	C C	T T	stop_gained stop_gained	HIGH	NA19074.hp1 NA19074.hp1	a0005 a0005	a0005c0007 a0005c0007	a0005c0007t0001 a0005c0007t0001	a0005c0007t0001g0004 a0005c0007t0001g0004	1	454	0.0022	0	c.184 others(3): Show c.184C>T	p.Gln others(3): Show p.Gln62*	ODAPH	ENSG00000174792.11	transcript	ENST00000311623.9	protein_coding	2/2	201/788	184/393	62/130		chr4	TogoVar
ODF3L1_chr15_75719041_75732688	75724242	C C	T T	stop_gained stop_gained	HIGH	HG02145.hp2 HG02622.hp1 HG02723.hp1 others(4): Show HG02145.hp2 HG02622.hp1 HG02723.hp1 HG02886.hp1 HG02895.hp1 HG02897.hp1 HG02922.hp1	a0004 a0004	a0004c0004 a0004c0004	a0004c0004t0001 a0004c0004t0001	a0004c0004t0001g0005 a0004c0004t0001g0005	7	386	0.0181	0	c.43C others(2): Show c.43C>T	p.Gln others(3): Show p.Gln15*	ODF3L1	ENSG00000182950.3	transcript	ENST00000332145.3	protein_coding	1/4	202/1132	43/825	15/274		chr15	TogoVar
ODF4_chr17_8334840_8351046	8340338	T T	A A	stop_gained stop_gained	HIGH	NA18952.hp1 NA18952.hp1	a0009 a0009	a0009c0011 a0009c0011	a0009c0011t0001 a0009c0011t0001	a0009c0011t0001g0002 a0009c0011t0001g0002	1	432	0.0023	0	c.287 others(3): Show c.287T>A	p.Leu others(3): Show p.Leu96*	ODF4	ENSG00000184650.11	transcript	ENST00000328248.7	protein_coding	1/3	499/1180	287/774	96/257		chr17	TogoVar

Search by Variant

Search

Search Results (Total: 3004 hits)