Joint Open Genome and Omics Platform (JoGo)

Search by Variant

Regionname

e.g. ALDH2_chr12_111761933_111822532, HBB_chr11_5220464_5232071.

Chr

Chromosome name (e.g., chr11).

Snpeff genename

Exact SnpEff gene name.

Sampleids

Target sampleid (e.g. HG02615).

Snpeff haplotype class

Haplotype-annotation class (e.g., ahapid, ahapid+chapid).

Snpeff annotation impact

Exact impact level (e.g., HIGH, MODERATE, LOW).

Snpeff annotation impact detail

Keyword match in SnpEff annotation.

Hapid

One or more haplotype IDs (comma-separated; e.g., a0001, a01, a0001c0001, a01c02, a1c2, a0001c0001t0005, a0001c0001t0005g0018).

Samplehapid

Sample haplotype IDs to include (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

No_hapid

Haplotype IDs to exclude (comma-separated; e.g., a0001, a0002, a0001c0001, a0001c0001t0005, a1, a01).

No_samplehapid

Sample haplotype IDs to exclude (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

Start

Start position (GRCh38).

End

End position (GRCh38).

Minac

Minimum alternate allele count (≥).

Maxac

Maximum alternate allele count (≤).

Minlen

Minimum variant length (≥).

Maxlen

Maximum variant length (≤).

Sort By

Select column to sort.

Order by

Ascending or descending.

Show

Results per page.

regionname	pos	ref	alt	annotation	impact	samples	ahapids	achapids	acthapids	actghapids	ac	an	af	len	hgvs_c	hgvs_p	genename	geneid	featuretype	featureid	transcript_biotype	rank	cdna cdna pos length	cds cds pos length	aa aa pos length	status	chr	external
G6PD_chrX_154526391_154551846	154536043	C C	CCA CCA	frameshift_variant others(1): Show frameshift_variant splice_region_variant	HIGH	NA19076.hp1 NA19076.hp1	a0007 a0007	a0007c0010 a0007c0010	a0007c0010t0006 a0007c0010t0006	a0007c0010t0006g0088 a0007c0010t0006g0088	1	285	0.0035	2	c.160 others(9): Show c.160_161insTG	p.Trp others(4): Show p.Trp54fs	G6PD	ENSG00000160211.20	transcript	ENST00000393562.10	protein_coding	4/13	226/2223	160/1548	54/515		chrX	TogoVar
G6PD_chrX_154526391_154551846	154546087	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19086.hp1 NA19086.hp1	a0012 a0012	a0012c0015 a0012c0015	a0012c0015t0001 a0012c0015t0001	a0012c0015t0001g0115 a0012c0015t0001g0115	1	285	0.0035	1	c.68d others(3): Show c.68dupG	p.Asp others(4): Show p.Asp24fs	G6PD	ENSG00000160211.20	transcript	ENST00000393562.10	protein_coding	2/13	134/2223	68/1548	23/515		chrX	TogoVar
G6PD_chrX_154526391_154551846	154546128	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA18968.hp2 NA18968.hp2	a0006 a0006	a0006c0016 a0006c0016	a0006c0016t0002 a0006c0016t0002	a0006c0016t0002g0116 a0006c0016t0002g0116	1	285	0.0035	1	c.27d others(3): Show c.27dupG	p.Thr others(4): Show p.Thr10fs	G6PD	ENSG00000160211.20	transcript	ENST00000393562.10	protein_coding	2/13	93/2223	27/1548	9/515		chrX	TogoVar
GAB3_chrX_154670249_154756077	154712359	A A	AG AG	frameshift_variant frameshift_variant	HIGH	HG02738.hp1 HG02738.hp1	a0005 a0005	a0005c0006 a0005c0006	a0005c0006t0002 a0005c0006t0002	a0005c0006t0002g0100 a0005c0006t0002g0100	1	257	0.0039	1	c.938 others(4): Show c.938dupC	p.Lys others(5): Show p.Lys314fs	GAB3	ENSG00000160219.12	transcript	ENST00000424127.3	protein_coding	4/10	990/4745	938/1764	313/587		chrX	TogoVar
GAB3_chrX_154670249_154756077	154716265	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19083.hp1 NA19083.hp1	a0008 a0008	a0008c0010 a0008c0010	a0008c0010t0003 a0008c0010t0003	a0008c0010t0003g0190 a0008c0010t0003g0190	1	257	0.0039	1	c.136 others(4): Show c.136dupG	p.Glu others(4): Show p.Glu46fs	GAB3	ENSG00000160219.12	transcript	ENST00000424127.3	protein_coding	2/10	188/4745	136/1764	46/587		chrX	TogoVar
GABRE_chrX_151948124_151979676	151954755	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0012 a0012	a0012c0012 a0012c0012	a0012c0012t0001 a0012c0012t0001	a0012c0012t0001g0264 a0012c0012t0001g0264	1	326	0.0031	1	c.146 others(5): Show c.1466dupC	p.Val others(5): Show p.Val490fs	GABRE	ENSG00000102287.19	transcript	ENST00000370328.4	protein_coding	9/9	1517/3149	1466/1521	489/506		chrX	TogoVar
GABRE_chrX_151948124_151979676	151954909	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA18977.hp1 NA18977.hp1	a0017 a0017	a0017c0021 a0017c0021	a0017c0021t0013 a0017c0021t0013	a0017c0021t0013g0219 a0017c0021t0013g0219	1	326	0.0031	1	c.131 others(5): Show c.1312dupC	p.Arg others(5): Show p.Arg438fs	GABRE	ENSG00000102287.19	transcript	ENST00000370328.4	protein_coding	9/9	1363/3149	1312/1521	438/506		chrX	TogoVar
GABRE_chrX_151948124_151979676	151955394	C C	CT CT	frameshift_variant frameshift_variant	HIGH	NA18977.hp1 NA18977.hp1	a0017 a0017	a0017c0021 a0017c0021	a0017c0021t0013 a0017c0021t0013	a0017c0021t0013g0219 a0017c0021t0013g0219	1	326	0.0031	1	c.111 others(5): Show c.1110dupA	p.Ala others(5): Show p.Ala371fs	GABRE	ENSG00000102287.19	transcript	ENST00000370328.4	protein_coding	8/9	1161/3149	1110/1521	370/506		chrX	TogoVar
GABRE_chrX_151948124_151979676	151955525	GA GA	G G	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0015 a0015	a0015c0020 a0015c0020	a0015c0020t0001 a0015c0020t0001	a0015c0020t0001g0257 a0015c0020t0001g0257	1	326	0.0031	-1	c.979 others(4): Show c.979delT	p.Ser others(5): Show p.Ser327fs	GABRE	ENSG00000102287.19	transcript	ENST00000370328.4	protein_coding	8/9	1030/3149	979/1521	327/506		chrX	TogoVar
GABRP_chr5_170778725_170819047	170797505	A A	ATACCCCA others(27): Show ATACCCCATGGACACACAGACATGCAAGTTGCAGC	frameshift_variant frameshift_variant	HIGH	NA18954.hp2 NA18954.hp2	a0010 a0010	a0010c0011 a0010c0011	a0010c0011t0002 a0010c0011t0002	a0010c0011t0002g0111 a0010c0011t0002g0111	1	362	0.0028	34	c.500 others(41): Show c.500_533dupACCCCATGGACACACAGACATGCAAGTTGCAGCT	p.Glu others(5): Show p.Glu179fs	GABRP	ENSG00000094755.17	transcript	ENST00000265294.9	protein_coding	6/10	726/3304	534/1323	178/440	INFO_REALIGN_3_PRIME	chr5	TogoVar
GABRQ_chrX_152632895_152662542	152640458	AT AT	A A	frameshift_variant frameshift_variant	HIGH	NA19059.hp2 NA19059.hp2	a0006 a0006	a0006c0004 a0006c0004	a0006c0004t0002 a0006c0004t0002	a0006c0004t0002g0110 a0006c0004t0002g0110	1	298	0.0034	-1	c.234 others(4): Show c.234delT	p.Phe others(4): Show p.Phe78fs	GABRQ	ENSG00000268089.3	transcript	ENST00000598523.3	protein_coding	2/9	542/6468	234/1899	78/632	INFO_REALIGN_3_PRIME	chrX	TogoVar
GABRQ_chrX_152632895_152662542	152652706	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19001.hp1 NA19001.hp1	a0005 a0005	a0005c0006 a0005c0006	a0005c0006t0012 a0005c0006t0012	a0005c0006t0012g0003 a0005c0006t0012g0003	1	298	0.0034	1	c.133 others(5): Show c.1330dupC	p.Leu others(5): Show p.Leu444fs	GABRQ	ENSG00000268089.3	transcript	ENST00000598523.3	protein_coding	9/9	1639/6468	1331/1899	444/632	INFO_REALIGN_3_PRIME	chrX	TogoVar
GAGE12D_chrX_49536733_49554094	49542944	GC GC	G G	frameshift_variant frameshift_variant	HIGH	HG03704.hp2 HG03704.hp2	a0009 a0009	a0009c0012 a0009c0012	a0009c0012t0001 a0009c0012t0001	a0009c0012t0001g0056 a0009c0012t0001g0056	1	72	0.0139	-1	c.59d others(3): Show c.59delC	p.Pro others(4): Show p.Pro20fs	GAGE12D	ENSG00000227488.3	transcript	ENST00000405679.4	protein_coding	2/5	175/561	59/354	20/117	INFO_REALIGN_3_PRIME	chrX	TogoVar
GAGE12D_chrX_49536733_49554094	49546426	T T	TG TG	frameshift_variant frameshift_variant	HIGH	HG03831.hp1 HG03831.hp1	a0011 a0011	a0011c0009 a0011c0009	a0011c0009t0002 a0011c0009t0002	a0011c0009t0002g0055 a0011c0009t0002g0055	1	72	0.0139	1	c.255 others(4): Show c.255dupG	p.Cys others(4): Show p.Cys86fs	GAGE12D	ENSG00000227488.3	transcript	ENST00000405679.4	protein_coding	4/5	372/561	256/354	86/117	INFO_REALIGN_3_PRIME	chrX	TogoVar
GAGE12F_chrX_49555842_49573205	49565545	T T	TA TA	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA18978.hp2 NA18978.hp2	a0013 a0013	a0013c0012 a0013c0012	a0013c0012t0001 a0013c0012t0001	a0013c0012t0001g0088 a0013c0012t0001g0088	1	99	0.0101	1	c.256 others(8): Show c.256_257insA	p.Cys others(4): Show p.Cys86fs	GAGE12F	ENSG00000236362.9	transcript	ENST00000440137.2	protein_coding	4/5	373/561	257/354	86/117		chrX	TogoVar
GAGE12F_chrX_49555842_49573205	49565581	G G	GGA GGA	frameshift_variant frameshift_variant	HIGH	HG02970.hp1 HG02970.hp1	a0011 a0011	a0011c0011 a0011c0011	a0011c0011t0007 a0011c0011t0007	a0011c0011t0007g0030 a0011c0011t0007g0030	1	99	0.0101	2	c.292 others(9): Show c.292_293insGA	p.Asp others(4): Show p.Asp98fs	GAGE12F	ENSG00000236362.9	transcript	ENST00000440137.2	protein_coding	4/5	409/561	293/354	98/117		chrX	TogoVar
GAGE12G_chrX_49565400_49582754	49571595	CA CA	C C	frameshift_variant frameshift_variant	HIGH	NA18981.hp2 NA18981.hp2	a0009 a0009	a0009c0012 a0009c0012	a0009c0012t0011 a0009c0012t0011	a0009c0012t0011g0078 a0009c0012t0011g0078	1	95	0.0105	-1	c.43d others(3): Show c.43delA	p.Arg others(4): Show p.Arg15fs	GAGE12G	ENSG00000215269.6	transcript	ENST00000445148.2	protein_coding	2/5	159/561	43/354	15/117	INFO_REALIGN_3_PRIME	chrX	TogoVar
GAGE12G_chrX_49565400_49582754	49572176	C C	CT CT	frameshift_variant frameshift_variant	HIGH	NA19082.hp1 NA19082.hp1	a0008 a0008	a0008c0008 a0008c0008	a0008c0008t0012 a0008c0008t0012	a0008c0008t0012g0076 a0008c0008t0012g0076	1	95	0.0105	1	c.157 others(8): Show c.157_158insT	p.Pro others(4): Show p.Pro53fs	GAGE12G	ENSG00000215269.6	transcript	ENST00000445148.2	protein_coding	3/5	274/561	158/354	53/117		chrX	TogoVar
GAGE12G_chrX_49565400_49582754	49572204	A A	AC AC	frameshift_variant frameshift_variant	HIGH	NA18981.hp2 NA18981.hp2	a0009 a0009	a0009c0012 a0009c0012	a0009c0012t0011 a0009c0012t0011	a0009c0012t0011g0078 a0009c0012t0011g0078	1	95	0.0105	1	c.185 others(8): Show c.185_186insC	p.Glu others(4): Show p.Glu62fs	GAGE12G	ENSG00000215269.6	transcript	ENST00000445148.2	protein_coding	3/5	302/561	186/354	62/117		chrX	TogoVar
GAGE12G_chrX_49565400_49582754	49572204	AG AG	A A	frameshift_variant frameshift_variant	HIGH	NA19082.hp1 NA19082.hp1	a0008 a0008	a0008c0008 a0008c0008	a0008c0008t0012 a0008c0008t0012	a0008c0008t0012g0076 a0008c0008t0012g0076	1	95	0.0105	-1	c.188 others(4): Show c.188delG	p.Gly others(4): Show p.Gly63fs	GAGE12G	ENSG00000215269.6	transcript	ENST00000445148.2	protein_coding	3/5	304/561	188/354	63/117	INFO_REALIGN_3_PRIME	chrX	TogoVar
GAGE12G_chrX_49565400_49582754	49575051	C C	CA CA	frameshift_variant frameshift_variant	HIGH	NA18956.hp2 NA18956.hp2	a0010 a0010	a0010c0010 a0010c0010	a0010c0010t0005 a0010c0010t0005	a0010c0010t0005g0039 a0010c0010t0005g0039	1	95	0.0105	1	c.209 others(8): Show c.209_210insA	p.Lys others(4): Show p.Lys71fs	GAGE12G	ENSG00000215269.6	transcript	ENST00000445148.2	protein_coding	4/5	326/561	210/354	70/117		chrX	TogoVar
GAGE12G_chrX_49565400_49582754	49575121	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA18956.hp2 NA18956.hp2	a0010 a0010	a0010c0010 a0010c0010	a0010c0010t0005 a0010c0010t0005	a0010c0010t0005g0039 a0010c0010t0005g0039	1	95	0.0105	-1	c.282 others(4): Show c.282delG	p.Gln others(4): Show p.Gln95fs	GAGE12G	ENSG00000215269.6	transcript	ENST00000445148.2	protein_coding	4/5	398/561	282/354	94/117	INFO_REALIGN_3_PRIME	chrX	TogoVar
GAGE12H_chrX_49574949_49592301	49581725	C C	CT CT	frameshift_variant frameshift_variant	HIGH	NA19082.hp1 NA19082.hp1	a0009 a0009	a0009c0009 a0009c0009	a0009c0009t0011 a0009c0009t0011	a0009c0009t0011g0090 a0009c0009t0011g0090	1	116	0.0086	1	c.157 others(8): Show c.157_158insT	p.Pro others(4): Show p.Pro53fs	GAGE12H	ENSG00000224902.6	transcript	ENST00000381722.2	protein_coding	3/5	274/561	158/354	53/117		chrX	TogoVar
GAGE12H_chrX_49574949_49592301	49581753	AG AG	A A	frameshift_variant frameshift_variant	HIGH	NA19082.hp1 NA19082.hp1	a0009 a0009	a0009c0009 a0009c0009	a0009c0009t0011 a0009c0009t0011	a0009c0009t0011g0090 a0009c0009t0011g0090	1	116	0.0086	-1	c.188 others(4): Show c.188delG	p.Gly others(4): Show p.Gly63fs	GAGE12H	ENSG00000224902.6	transcript	ENST00000381722.2	protein_coding	3/5	304/561	188/354	63/117	INFO_REALIGN_3_PRIME	chrX	TogoVar
GAGE12H_chrX_49574949_49592301	49581760	A A	ATC ATC	frameshift_variant frameshift_variant	HIGH	NA18947.hp2 NA18947.hp2	a0010 a0010	a0010c0008 a0010c0008	a0010c0008t0004 a0010c0008t0004	a0010c0008t0004g0078 a0010c0008t0004g0078	1	116	0.0086	2	c.194 others(9): Show c.194_195dupCT	p.Ala others(4): Show p.Ala66fs	GAGE12H	ENSG00000224902.6	transcript	ENST00000381722.2	protein_coding	3/5	312/561	196/354	66/117	INFO_REALIGN_3_PRIME	chrX	TogoVar
GAGE12H_chrX_49574949_49592301	49581770	CA CA	C C	frameshift_variant others(1): Show frameshift_variant splice_region_variant	HIGH	HG03927.hp1 HG03927.hp1	a0012 a0012	a0012c0013 a0012c0013	a0012c0013t0002 a0012c0013t0002	a0012c0013t0002g0050 a0012c0013t0002g0050	1	116	0.0086	-1	c.204 others(4): Show c.204delA	p.Pro others(4): Show p.Pro70fs	GAGE12H	ENSG00000224902.6	transcript	ENST00000381722.2	protein_coding	3/5	320/561	204/354	68/117	INFO_REALIGN_3_PRIME	chrX	TogoVar
GAGE12J_chrX_49317037_49334384	49326726	A A	AC AC	frameshift_variant frameshift_variant	HIGH	HG01192.hp1 HG01192.hp1	a0011 a0011	a0011c0013 a0011c0013	a0011c0013t0002 a0011c0013t0002	a0011c0013t0002g0065 a0011c0013t0002g0065	1	194	0.0052	1	c.245 others(4): Show c.245dupC	p.Gln others(4): Show p.Gln83fs	GAGE12J	ENSG00000224659.3	transcript	ENST00000442437.3	protein_coding	4/5	362/561	246/354	82/117	INFO_REALIGN_3_PRIME	chrX	TogoVar
GAGE13_chrX_49326582_49343949	49336319	AT AT	A A	frameshift_variant frameshift_variant	HIGH	NA18946.hp2 NA18946.hp2	a0009 a0009	a0009c0009 a0009c0009	a0009c0009t0003 a0009c0009t0003	a0009c0009t0003g0034 a0009c0009t0003g0034	1	93	0.0108	-1	c.279 others(4): Show c.279delT	p.Asp others(4): Show p.Asp93fs	GAGE13	ENSG00000274274.2	transcript	ENST00000612958.2	protein_coding	4/5	395/561	279/354	93/117		chrX	TogoVar
GAGE13_chrX_49326582_49343949	49336334	AC AC	A A	frameshift_variant frameshift_variant	HIGH	NA18946.hp2 NA18946.hp2	a0009 a0009	a0009c0009 a0009c0009	a0009c0009t0003 a0009c0009t0003	a0009c0009t0003g0034 a0009c0009t0003g0034	1	93	0.0108	-1	c.296 others(4): Show c.296delC	p.Pro others(4): Show p.Pro99fs	GAGE13	ENSG00000274274.2	transcript	ENST00000612958.2	protein_coding	4/5	412/561	296/354	99/117	INFO_REALIGN_3_PRIME	chrX	TogoVar
GAGE1_chrX_49594020_49613538	49600752	CA CA	C C	frameshift_variant frameshift_variant	HIGH	NA19077.hp1 NA19077.hp1	a0010 a0010	a0010c0011 a0010c0011	a0010c0011t0012 a0010c0011t0012	a0010c0011t0012g0062 a0010c0011t0012g0062	1	311	0.0032	-1	c.114 others(4): Show c.114delA	p.Ala others(4): Show p.Ala39fs	GAGE1	ENSG00000205777.19	transcript	ENST00000381700.11	protein_coding	3/5	230/2993	114/354	38/117		chrX	TogoVar
GAGE1_chrX_49594020_49613538	49603666	A A	AG AG	frameshift_variant others(1): Show frameshift_variant splice_region_variant	HIGH	NA18985.hp1 NA18985.hp1	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0003 a0002c0002t0003	a0002c0002t0003g0058 a0002c0002t0003g0058	1	311	0.0032	1	c.207 others(4): Show c.207dupG	p.Pro others(4): Show p.Pro70fs	GAGE1	ENSG00000205777.19	transcript	ENST00000381700.11	protein_coding	4/5	324/2993	208/354	70/117	INFO_REALIGN_3_PRIME	chrX	TogoVar
GAGE1_chrX_49594020_49613538	49603765	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA19077.hp1 NA19077.hp1	a0010 a0010	a0010c0011 a0010c0011	a0010c0011t0012 a0010c0011t0012	a0010c0011t0012g0062 a0010c0011t0012g0062	1	311	0.0032	-1	c.305 others(4): Show c.305delC	p.Pro others(5): Show p.Pro102fs	GAGE1	ENSG00000205777.19	transcript	ENST00000381700.11	protein_coding	4/5	421/2993	305/354	102/117	INFO_REALIGN_3_PRIME	chrX	TogoVar
GAGE2A_chrX_49584496_49601824	49591228	C C	CA CA	frameshift_variant frameshift_variant	HIGH	NA18964.hp2 NA18964.hp2	a0008 a0008	a0008c0008 a0008c0008	a0008c0008t0001 a0008c0008t0001	a0008c0008t0001g0060 a0008c0008t0001g0060	1	130	0.0077	1	c.115 others(4): Show c.115dupA	p.Thr others(4): Show p.Thr39fs	GAGE2A	ENSG00000189064.9	transcript	ENST00000362097.2	protein_coding	3/5	232/558	116/351	39/116	INFO_REALIGN_3_PRIME	chrX	TogoVar
GAGE2A_chrX_49584496_49601824	49591274	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA18964.hp2 NA18964.hp2	a0008 a0008	a0008c0008 a0008c0008	a0008c0008t0001 a0008c0008t0001	a0008c0008t0001g0060 a0008c0008t0001g0060	1	130	0.0077	1	c.160 others(4): Show c.160dupG	p.Ala others(4): Show p.Ala54fs	GAGE2A	ENSG00000189064.9	transcript	ENST00000362097.2	protein_coding	3/5	277/558	161/351	54/116	INFO_REALIGN_3_PRIME	chrX	TogoVar
GAGE2A_chrX_49584496_49601824	49591291	AG AG	A A	frameshift_variant frameshift_variant	HIGH	HG02004.hp1 HG02004.hp1	a0009 a0009	a0009c0011 a0009c0011	a0009c0011t0005 a0009c0011t0005	a0009c0011t0005g0058 a0009c0011t0005g0058	1	130	0.0077	-1	c.178 others(4): Show c.178delG	p.Asp others(4): Show p.Asp60fs	GAGE2A	ENSG00000189064.9	transcript	ENST00000362097.2	protein_coding	3/5	294/558	178/351	60/116	INFO_REALIGN_3_PRIME	chrX	TogoVar
GAGE2A_chrX_49584496_49601824	49591299	G G	GA GA	frameshift_variant frameshift_variant	HIGH	NA18964.hp2 NA18964.hp2	a0008 a0008	a0008c0008 a0008c0008	a0008c0008t0001 a0008c0008t0001	a0008c0008t0001g0060 a0008c0008t0001g0060	1	130	0.0077	1	c.184 others(8): Show c.184_185insA	p.Gly others(4): Show p.Gly62fs	GAGE2A	ENSG00000189064.9	transcript	ENST00000362097.2	protein_coding	3/5	301/558	185/351	62/116		chrX	TogoVar
GAGE2A_chrX_49584496_49601824	49591311	G G	GGT GGT	frameshift_variant frameshift_variant	HIGH	NA18964.hp2 NA18964.hp2	a0008 a0008	a0008c0008 a0008c0008	a0008c0008t0001 a0008c0008t0001	a0008c0008t0001g0060 a0008c0008t0001g0060	1	130	0.0077	2	c.197 others(9): Show c.197_198dupGT	p.Gln others(4): Show p.Gln67fs	GAGE2A	ENSG00000189064.9	transcript	ENST00000362097.2	protein_coding	3/5	315/558	199/351	67/116	INFO_REALIGN_3_PRIME	chrX	TogoVar
GAK_chr4_844277_937316	898115	CACAGCTT others(6): Show CACAGCTTAATGGT	C C	frameshift_variant frameshift_variant	HIGH	NA19068.hp2 NA19068.hp2	a0023 a0023	a0023c0049 a0023c0049	a0023c0049t0002 a0023c0049t0002	a0023c0049t0002g0126 a0023c0049t0002g0126	1	390	0.0026	-13	c.556 others(20): Show c.556_568delACCATTAAGCTGT	p.Thr others(5): Show p.Thr186fs	GAK	ENSG00000178950.18	transcript	ENST00000314167.9	protein_coding	6/28	697/4461	556/3936	186/1311		chr4	TogoVar
GAL3ST3_chr11_66035765_66054161	66043477	C C	CG CG	frameshift_variant frameshift_variant	HIGH	HG00621.hp1 HG00673.hp1 HG00673.hp2 others(19): Show HG00621.hp1 HG00673.hp1 HG00673.hp2 HG00735.hp2 HG01109.hp1 HG02145.hp2 HG02572.hp1 HG03669.hp2 NA18906.hp1 NA18954.hp2 NA18956.hp1 NA18982.hp2 NA18985.hp2 NA18999.hp2 NA19001.hp2 NA19005.hp2 NA19067.hp2 NA19083.hp1 NA19083.hp2 NA19086.hp1 NA19087.hp1 NA19090.hp2	a0003 a0004 a0006 a0003 a0004 a0006	a0003c0005 a0003c0015 a0003c0016 others(2): Show a0003c0005 a0003c0015 a0003c0016 a0004c0008 a0006c0013	a0003c0005t0001 a0003c0005t0002 a0003c0005t0005 others(5): Show a0003c0005t0001 a0003c0005t0002 a0003c0005t0005 a0003c0015t0005 a0003c0016t0003 a0004c0008t0005 a0004c0008t0021 a0006c0013t0004	a0003c0005t0001g0017 a0003c0005t0001g0062 a0003c0005t0002g0016 others(11): Show a0003c0005t0001g0017 a0003c0005t0001g0062 a0003c0005t0002g0016 a0003c0005t0002g0039 a0003c0005t0002g0051 a0003c0005t0002g0061 a0003c0005t0002g0063 a0003c0005t0005g0052 a0003c0015t0005g0043 a0003c0016t0003g0053 a0004c0008t0005g0026 a0004c0008t0005g0041 a0004c0008t0021g0042 a0006c0013t0004g0027	22	394	0.0558	1	c.325 others(4): Show c.325dupC	p.Arg others(5): Show p.Arg109fs	GAL3ST3	ENSG00000175229.7	transcript	ENST00000312006.5	protein_coding	3/3	588/3301	325/1296	109/431		chr11	TogoVar
GALNT9_chr12_132191372_132334589	132203685	CCACACCT others(62): Show CCACACCTGCGGGGAGACGGCGCTGGGTGCCGGCGTCCTTCCCAACGGAA GCGGGCAGCCCGGCCAGCTA	C C	frameshift_variant others(3): Show frameshift_variant splice_acceptor_variant splice_region_variant intron_variant	HIGH	NA19002.hp2 NA19002.hp2	a0003 a0003	a0003c0033 a0003c0033	a0003c0033t0001 a0003c0033t0001	a0003c0033t0001g0114 a0003c0033t0001g0114	1	183	0.0055	-69	c.107 others(81): Show c.1078-64_1082delTAGCTGGCCGGGCTGCCCGCTTCCGTTGGGAAG GACGCCGGCACCCAGCGCCGTCTCCCCGCAGGTGTG	p.Val others(5): Show p.Val360fs	GALNT9	ENSG00000182870.13	transcript	ENST00000328957.13	protein_coding	7/11	1468/2933	1078/1812	360/603		chr12	TogoVar
GALR2_chr17_76069781_76082537	76077366	TGTCCTGG others(3): Show TGTCCTGGCCC	T T	frameshift_variant frameshift_variant	HIGH	HG01074.hp2 HG01243.hp1 HG01361.hp2 others(7): Show HG01074.hp2 HG01243.hp1 HG01361.hp2 HG02145.hp2 HG03098.hp1 HG03239.hp2 HG03471.hp2 HG04115.hp2 NA18522.hp1 NA19240.hp1	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0001 a0002c0002t0001	a0002c0002t0001g0001 a0002c0002t0001g0005 a0002c0002t0001g0001 a0002c0002t0001g0005	10	405	0.0247	-10	c.110 others(19): Show c.1108_1117delCCGTCCTGGC	p.Pro others(5): Show p.Pro370fs	GALR2	ENSG00000182687.4	transcript	ENST00000329003.4	protein_coding	2/2	1211/1373	1108/1164	370/387	INFO_REALIGN_3_PRIME	chr17	TogoVar
GARIN2_chr14_67184440_67228940	67204765	C C	CT CT	frameshift_variant frameshift_variant	HIGH	HG01081.hp2 HG01106.hp2 HG01167.hp1 others(2): Show HG01081.hp2 HG01106.hp2 HG01167.hp1 HG02055.hp1 HG02683.hp1	a0003 a0003	a0003c0006 a0003c0006	a0003c0006t0001 a0003c0006t0001	a0003c0006t0001g0185 a0003c0006t0001g0239 a0003c0006t0001g0240 others(2): Show a0003c0006t0001g0185 a0003c0006t0001g0239 a0003c0006t0001g0240 a0003c0006t0001g0244 a0003c0006t0001g0245	5	332	0.0151	1	c.588 others(8): Show c.588_589insT	p.Thr others(5): Show p.Thr197fs	GARIN2	ENSG00000172717.17	transcript	ENST00000696955.1	protein_coding	5/8	832/1620	589/1254	197/417		chr14	TogoVar
GATA1_chrX_48781590_48799311	48792204	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19083.hp1 NA19083.hp1	a0005 a0005	a0005c0008 a0005c0008	a0005c0008t0001 a0005c0008t0001	a0005c0008t0001g0027 a0005c0008t0001g0027	1	268	0.0037	1	c.586 others(4): Show c.586dupC	p.Leu others(5): Show p.Leu196fs	GATA1	ENSG00000102145.16	transcript	ENST00000376670.9	protein_coding	3/6	662/1464	587/1242	196/413	INFO_REALIGN_3_PRIME	chrX	TogoVar
GATA1_chrX_48781590_48799311	48792214	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA19083.hp1 NA19083.hp1	a0005 a0005	a0005c0008 a0005c0008	a0005c0008t0001 a0005c0008t0001	a0005c0008t0001g0027 a0005c0008t0001g0027	1	268	0.0037	-1	c.594 others(4): Show c.594delC	p.Cys others(5): Show p.Cys199fs	GATA1	ENSG00000102145.16	transcript	ENST00000376670.9	protein_coding	3/6	669/1464	594/1242	198/413	INFO_REALIGN_3_PRIME	chrX	TogoVar
GATA1_chrX_48781590_48799311	48792424	A A	AT AT	frameshift_variant frameshift_variant	HIGH	NA19083.hp1 NA19083.hp1	a0005 a0005	a0005c0008 a0005c0008	a0005c0008t0001 a0005c0008t0001	a0005c0008t0001g0027 a0005c0008t0001g0027	1	268	0.0037	1	c.701 others(4): Show c.701dupT	p.Met others(5): Show p.Met234fs	GATA1	ENSG00000102145.16	transcript	ENST00000376670.9	protein_coding	4/6	777/1464	702/1242	234/413	INFO_REALIGN_3_PRIME	chrX	TogoVar
GATA1_chrX_48781590_48799311	48793204	CA CA	C C	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0004 a0004	a0004c0011 a0004c0011	a0004c0011t0001 a0004c0011t0001	a0004c0011t0001g0041 a0004c0011t0001g0041	1	268	0.0037	-1	c.779 others(4): Show c.779delA	p.Asn others(5): Show p.Asn260fs	GATA1	ENSG00000102145.16	transcript	ENST00000376670.9	protein_coding	5/6	854/1464	779/1242	260/413	INFO_REALIGN_3_PRIME	chrX	TogoVar
GATA5_chr20_62458497_62480995	62475261	C C	CG CG	frameshift_variant frameshift_variant	HIGH	HG01099.hp1 HG01175.hp1 HG01433.hp2 others(3): Show HG01099.hp1 HG01175.hp1 HG01433.hp2 HG02004.hp2 NA18948.hp1 NA18965.hp2	a0003 a0007 a0003 a0007	a0003c0016 a0003c0017 a0003c0024 others(1): Show a0003c0016 a0003c0017 a0003c0024 a0007c0029	a0003c0016t0001 a0003c0016t0011 a0003c0017t0011 others(3): Show a0003c0016t0001 a0003c0016t0011 a0003c0017t0011 a0003c0017t0035 a0003c0024t0002 a0007c0029t0001	a0003c0016t0001g0054 a0003c0016t0011g0053 a0003c0017t0011g0050 others(3): Show a0003c0016t0001g0054 a0003c0016t0011g0053 a0003c0017t0011g0050 a0003c0017t0035g0051 a0003c0024t0002g0052 a0007c0029t0001g0224	6	382	0.0157	1	c.260 others(4): Show c.260dupC	p.Pro others(4): Show p.Pro88fs	GATA5	ENSG00000130700.7	transcript	ENST00000252997.3	protein_coding	2/7	347/2620	260/1194	87/397		chr20	TogoVar
GATA5_chr20_62458497_62480995	62475264	G G	GGTGCGCG others(3): Show GGTGCGCGGCT	frameshift_variant frameshift_variant	HIGH	NA18981.hp1 NA18981.hp1	a0010 a0010	a0010c0023 a0010c0023	a0010c0023t0001 a0010c0023t0001	a0010c0023t0001g0049 a0010c0023t0001g0049	1	382	0.0026	10	c.257 others(17): Show c.257_258insAGCCGCGCAC	p.His others(4): Show p.His86fs	GATA5	ENSG00000130700.7	transcript	ENST00000252997.3	protein_coding	2/7	344/2620	257/1194	86/397		chr20	TogoVar
GATAD2A_chr19_19400675_19513932	19495865	C C	CCACTCGT others(10): Show CCACTCGTCAGGGGGGCT	frameshift_variant others(1): Show frameshift_variant splice_region_variant	HIGH	NA18994.hp2 NA18994.hp2	a0003 a0003	a0003c0007 a0003c0007	a0003c0007t0001 a0003c0007t0001	a0003c0007t0001g0225 a0003c0007t0001g0225	1	298	0.0034	17	c.739 others(24): Show c.739_755dupCTCGTCAGGGGGGCTCA	p.Gln others(5): Show p.Gln252fs	GATAD2A	ENSG00000167491.18	transcript	ENST00000683918.1	protein_coding	6/12	1107/5714	756/1905	252/634	INFO_REALIGN_3_PRIME	chr19	TogoVar
GCNA_chrX_71573437_71618583	71603835	GGATGTTC others(10): Show GGATGTTCCCGACGACAA	G G	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0010 a0010	a0010c0010 a0010c0010	a0010c0010t0001 a0010c0010t0001	a0010c0010t0001g0060 a0010c0010t0001g0060	1	265	0.0038	-17	c.559 others(24): Show c.559_575delGATGTTCCCGACGACAA	p.Asp others(5): Show p.Asp187fs	GCNA	ENSG00000147174.12	transcript	ENST00000373696.8	protein_coding	8/13	647/2765	559/2076	187/691		chrX	TogoVar

Search by Variant

Search

Search Results (Total: 5828 hits)