JoGo: Joint Open Genome and Omics Platform

Search by Variant

Regionname

e.g. ALDH2_chr12_111761933_111822532, HBB_chr11_5220464_5232071.

Chr

Chromosome name (e.g., chr11).

Snpeff genename

Exact SnpEff gene name.

Sampleids

Target sampleid (e.g. HG02615).

Snpeff haplotype class

Haplotype-annotation class (e.g., ahapid, ahapid+chapid).

Snpeff annotation impact

Exact impact level (e.g., HIGH, MODERATE, LOW).

Snpeff annotation impact detail

Keyword match in SnpEff annotation.

Hapid

One or more haplotype IDs (comma-separated; e.g., a0001, a01, a0001c0001, a01c02, a1c2, a0001c0001t0005, a0001c0001t0005g0018).

Samplehapid

Sample haplotype IDs to include (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

No_hapid

Haplotype IDs to exclude (comma-separated; e.g., a0001, a0002, a0001c0001, a0001c0001t0005, a1, a01).

No_samplehapid

Sample haplotype IDs to exclude (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

Start

Start position (GRCh38).

End

End position (GRCh38).

Minac

Minimum alternate allele count (≥).

Maxac

Maximum alternate allele count (≤).

Minlen

Minimum variant length (≥).

Maxlen

Maximum variant length (≤).

Sort By

Select column to sort.

Order by

Ascending or descending.

Show

Results per page.

regionname	pos	ref	alt	annotation	impact	samples	ahapids	achapids	acthapids	actghapids	ac	an	af	len	hgvs_c	hgvs_p	genename	geneid	featuretype	featureid	transcript_biotype	rank	cdna cdna pos length	cds cds pos length	aa aa pos length	status	chr	external
OFD1_chrX_13729748_13774357	13760706	A A	AAATGT AAATGT	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA18992.hp2 NA18992.hp2	a0004 a0004	a0004c0012 a0004c0012	a0004c0012t0002 a0004c0012t0002	a0004c0012t0002g0155 a0004c0012t0002g0155	1	327	0.0031	5	c.224 others(14): Show c.2248_2252dupATGTA	p.Tyr others(5): Show p.Tyr751fs	OFD1	ENSG00000046651.16	transcript	ENST00000340096.11	protein_coding	16/23	2577/3612	2253/3039	751/1012	INFO_REALIGN_3_PRIME	chrX	TogoVar
OLFM1_chr9_135082668_135126180	135119911	C C	A A	stop_gained stop_gained	HIGH	NA19089.hp2 NA19089.hp2	a0002 a0002	a0002c0009 a0002c0009	a0002c0009t0023 a0002c0009t0023	a0002c0009t0023g0278 a0002c0009t0023g0278	1	360	0.0028	0	c.119 others(4): Show c.1191C>A	p.Tyr others(4): Show p.Tyr397*	OLFM1	ENSG00000130558.20	transcript	ENST00000371793.8	protein_coding	6/6	1513/2782	1191/1458	397/485		chr9	TogoVar
OLFM4_chr13_53023813_53057057	53043174	C C	T T	stop_gained stop_gained	HIGH	HG01978.hp2 HG01978.hp2	a0008 a0008	a0008c0018 a0008c0018	a0008c0018t0001 a0008c0018t0001	a0008c0018t0001g0157 a0008c0018t0001g0157	1	466	0.0022	0	c.640 others(3): Show c.640C>T	p.Arg others(4): Show p.Arg214*	OLFM4	ENSG00000102837.7	transcript	ENST00000219022.3	protein_coding	4/5	664/2843	640/1533	214/510		chr13	TogoVar
OLFM4_chr13_53023813_53057057	53050729	C C	A A	stop_gained stop_gained	HIGH	NA19081.hp1 NA19081.hp1	a0009 a0009	a0009c0015 a0009c0015	a0009c0015t0019 a0009c0015t0019	a0009c0015t0019g0001 a0009c0015t0019g0001	1	466	0.0022	0	c.149 others(4): Show c.1491C>A	p.Tyr others(4): Show p.Tyr497*	OLFM4	ENSG00000102837.7	transcript	ENST00000219022.3	protein_coding	5/5	1515/2843	1491/1533	497/510		chr13	TogoVar
OLFM4_chr13_53023813_53057057	53050755	T T	A A	stop_gained stop_gained	HIGH	NA19081.hp1 NA19081.hp1	a0009 a0009	a0009c0015 a0009c0015	a0009c0015t0019 a0009c0015t0019	a0009c0015t0019g0001 a0009c0015t0019g0001	1	466	0.0022	0	c.151 others(4): Show c.1517T>A	p.Leu others(4): Show p.Leu506*	OLFM4	ENSG00000102837.7	transcript	ENST00000219022.3	protein_coding	5/5	1541/2843	1517/1533	506/510		chr13	TogoVar
OMD_chr9_92407380_92429471	92415167	A A	T T	stop_gained stop_gained	HIGH	HG01255.hp1 HG01255.hp1	a0006 a0006	a0006c0007 a0006c0007	a0006c0007t0003 a0006c0007t0003	a0006c0007t0003g0155 a0006c0007t0003g0155	1	428	0.0023	0	c.125 others(4): Show c.1251T>A	p.Tyr others(4): Show p.Tyr417*	OMD	ENSG00000127083.8	transcript	ENST00000375550.5	protein_coding	3/3	1537/4324	1251/1266	417/421		chr9	TogoVar
OOSP1_chr11_59933432_59962480	59945232	C C	T T	stop_gained stop_gained	HIGH	HG02630.hp1 HG03041.hp2 HG02630.hp1 HG03041.hp2	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0002 a0002c0002t0002	a0002c0002t0002g0045 a0002c0002t0002g0046 a0002c0002t0002g0045 a0002c0002t0002g0046	2	386	0.0052	0	c.322 others(3): Show c.322C>T	p.Arg others(4): Show p.Arg108*	OOSP1	ENSG00000284873.1	transcript	ENST00000646685.1	protein_coding	3/5	345/795	322/555	108/184		chr11	TogoVar
OPN1LW_chrX_154139243_154164032	154156399	T T	TA TA	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	HG01169.hp1 HG01169.hp1	a0030 a0030	a0030c0025 a0030c0025	a0030c0025t0005 a0030c0025t0005	a0030c0025t0005g0065 a0030c0025t0005g0065	1	258	0.0039	1	c.851 others(4): Show c.851dupA	p.Tyr others(5): Show p.Tyr284fs	OPN1LW	ENSG00000102076.10	transcript	ENST00000369951.9	protein_coding	5/6	893/1242	852/1095	284/364	INFO_REALIGN_3_PRIME	chrX	TogoVar
OPRK1_chr8_53220724_53256637	53229653	G G	A A	stop_gained stop_gained	HIGH	HG01099.hp2 HG01099.hp2	a0004 a0004	a0004c0009 a0004c0009	a0004c0009t0006 a0004c0009t0006	a0004c0009t0006g0111 a0004c0009t0006g0111	1	372	0.0027	0	c.787 others(3): Show c.787C>T	p.Arg others(4): Show p.Arg263*	OPRK1	ENSG00000082556.14	transcript	ENST00000265572.8	protein_coding	4/4	1025/4954	787/1143	263/380		chr8	TogoVar
OPRPN_chr4_70392940_70415195	70409584	C C	T T	stop_gained stop_gained	HIGH	HG00597.hp1 HG00597.hp1	a0004 a0004	a0004c0008 a0004c0008	a0004c0008t0001 a0004c0008t0001	a0004c0008t0001g0003 a0004c0008t0001g0003	1	456	0.0022	0	c.256 others(3): Show c.256C>T	p.Gln others(3): Show p.Gln86*	OPRPN	ENSG00000171199.11	transcript	ENST00000399575.7	protein_coding	3/3	372/983	256/747	86/248		chr4	TogoVar
OR10A5_chr11_6840683_6851636	6845755	C C	T T	stop_gained stop_gained	HIGH	NA20300.hp1 NA20300.hp1	a0009 a0009	a0009c0013 a0009c0013	a0009c0013t0000 a0009c0013t0000	a0009c0013t0000g0000 a0009c0013t0000g0000	1	450	0.0022	0	c.73C others(2): Show c.73C>T	p.Gln others(3): Show p.Gln25*	OR10A5	ENSG00000166363.6	transcript	ENST00000299454.5	protein_coding	1/1	73/954	73/954	25/317		chr11	TogoVar
OR10A6_chr11_7919592_7936268	7927731	A A	T T	stop_gained stop_gained	HIGH	NA18963.hp2 NA18963.hp2	a0011 a0011	a0011c0015 a0011c0015	a0011c0015t0077 a0011c0015t0077	a0011c0015t0077g0184 a0011c0015t0077g0184	1	441	0.0023	0	c.932 others(3): Show c.932T>A	p.Leu others(4): Show p.Leu311*	OR10A6	ENSG00000279000.4	transcript	ENST00000641238.1	protein_coding	4/4	2913/6052	932/945	311/314		chr11	TogoVar
OR10A6_chr11_7919592_7936268	7927747	G G	A A	stop_gained stop_gained	HIGH	HG01928.hp1 HG06807.hp2 NA19056.hp2 others(1): Show HG01928.hp1 HG06807.hp2 NA19056.hp2 NA19064.hp2	a0006 a0006	a0006c0006 a0006c0006	a0006c0006t0004 a0006c0006t0034 a0006c0006t0004 a0006c0006t0034	a0006c0006t0004g0047 a0006c0006t0034g0046 a0006c0006t0004g0047 a0006c0006t0034g0046	4	441	0.0091	0	c.916 others(3): Show c.916C>T	p.Arg others(4): Show p.Arg306*	OR10A6	ENSG00000279000.4	transcript	ENST00000641238.1	protein_coding	4/4	2897/6052	916/945	306/314		chr11	TogoVar
OR10C1_chr6_29434306_29445977	29440178	C C	T T	stop_gained stop_gained	HIGH	HG02257.hp2 HG02572.hp2 HG02615.hp2 others(7): Show HG02257.hp2 HG02572.hp2 HG02615.hp2 HG02723.hp2 HG02809.hp1 HG02818.hp2 HG03041.hp1 HG03139.hp1 HG03486.hp2 NA19030.hp1	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0001 a0005c0005t0001	a0005c0005t0001g0000 a0005c0005t0001g0000	10	451	0.0222	0	c.163 others(3): Show c.163C>T	p.Gln others(3): Show p.Gln55*	OR10C1	ENSG00000206474.8	transcript	ENST00000444197.3	protein_coding	1/1	873/1672	163/939	55/312		chr6	TogoVar
OR10D3_chr11_124178345_124193780	124186025	T T	G G	stop_gained stop_gained	HIGH	HG00099.hp1 HG00099.hp2 HG00140.hp1 others(235): Show HG00099.hp1 HG00099.hp2 HG00140.hp1 HG00140.hp2 HG00280.hp1 HG00280.hp2 HG00323.hp2 HG00423.hp1 HG00423.hp2 HG00438.hp1 HG00544.hp2 HG00558.hp2 HG00597.hp1 HG00609.hp1 HG00609.hp2 HG00621.hp2 HG00642.hp2 HG00673.hp2 HG00738.hp1 HG00741.hp2 HG01070.hp2 HG01071.hp1 HG01099.hp1 HG01106.hp1 HG01106.hp2 HG01167.hp1 HG01168.hp1 HG01168.hp2 HG01169.hp1 HG01169.hp2 HG01175.hp1 HG01192.hp1 HG01192.hp2 HG01255.hp1 HG01256.hp2 HG01346.hp2 HG01358.hp2 HG01361.hp1 HG01433.hp1 HG01496.hp1 HG01516.hp1 HG01891.hp1 HG01891.hp2 HG01928.hp2 HG01943.hp1 HG01952.hp1 HG01978.hp1 HG01981.hp1 HG01993.hp1 HG01993.hp2 HG02004.hp2 HG02015.hp1 HG02027.hp2 HG02040.hp1 HG02055.hp2 HG02080.hp2 HG02109.hp1 HG02129.hp1 HG02145.hp1 HG02148.hp2 HG02165.hp1 HG02165.hp2 HG02258.hp2 HG02280.hp1 HG02280.hp2 HG02451.hp1 HG02559.hp2 HG02602.hp1 HG02622.hp1 HG02647.hp2 HG02698.hp2 HG02723.hp2 HG02735.hp2 HG02738.hp2 HG02809.hp2 HG02818.hp2 HG02895.hp2 HG02896.hp1 HG02897.hp1 HG02897.hp2 HG02922.hp2 HG02965.hp1 HG03017.hp2 HG03130.hp2 HG03139.hp1 HG03195.hp2 HG03209.hp2 HG03225.hp1 HG03453.hp1 HG03486.hp1 HG03490.hp1 HG03490.hp2 HG03492.hp1 HG03492.hp2 HG03516.hp2 HG03540.hp1 HG03540.hp2 HG03579.hp1 HG03579.hp2 HG03654.hp1 HG03688.hp1 HG03704.hp1 HG03704.hp2 HG03927.hp1 HG03927.hp2 HG03942.hp1 HG04115.hp2 HG04199.hp1 HG04204.hp1 HG04204.hp2 HG04228.hp2 HG06807.hp1 NA18522.hp1 NA18522.hp2 NA18612.hp2 NA18747.hp1 NA18747.hp2 NA18906.hp1 NA18906.hp2 NA18939.hp2 NA18941.hp1 NA18941.hp2 NA18942.hp1 NA18942.hp2 NA18944.hp1 NA18946.hp1 NA18947.hp1 NA18947.hp2 NA18948.hp2 NA18949.hp1 NA18950.hp2 NA18952.hp1 NA18952.hp2 NA18953.hp1 NA18954.hp2 NA18955.hp2 NA18956.hp1 NA18956.hp2 NA18957.hp1 NA18957.hp2 NA18959.hp1 NA18959.hp2 NA18960.hp1 NA18960.hp2 NA18962.hp1 NA18962.hp2 NA18963.hp1 NA18964.hp1 NA18964.hp2 NA18966.hp1 NA18966.hp2 NA18969.hp2 NA18970.hp2 NA18971.hp1 NA18971.hp2 NA18973.hp1 NA18973.hp2 NA18974.hp1 NA18974.hp2 NA18977.hp2 NA18978.hp1 NA18978.hp2 NA18979.hp2 NA18982.hp1 NA18983.hp1 NA18983.hp2 NA18984.hp1 NA18984.hp2 NA18986.hp2 NA18988.hp2 NA18989.hp1 NA18990.hp2 NA18993.hp1 NA18994.hp1 NA18994.hp2 NA18995.hp1 NA18995.hp2 NA18997.hp1 NA18997.hp2 NA18998.hp1 NA18999.hp1 NA19000.hp1 NA19002.hp1 NA19002.hp2 NA19003.hp1 NA19004.hp1 NA19004.hp2 NA19005.hp2 NA19006.hp2 NA19007.hp2 NA19010.hp1 NA19010.hp2 NA19011.hp1 NA19011.hp2 NA19012.hp2 NA19030.hp1 NA19055.hp1 NA19055.hp2 NA19057.hp1 NA19058.hp1 NA19058.hp2 NA19059.hp1 NA19059.hp2 NA19060.hp1 NA19060.hp2 NA19063.hp1 NA19064.hp2 NA19065.hp1 NA19065.hp2 NA19068.hp1 NA19070.hp1 NA19072.hp2 NA19074.hp1 NA19074.hp2 NA19075.hp2 NA19076.hp1 NA19076.hp2 NA19078.hp1 NA19078.hp2 NA19079.hp1 NA19081.hp1 NA19081.hp2 NA19082.hp2 NA19085.hp1 NA19085.hp2 NA19086.hp1 NA19087.hp1 NA19087.hp2 NA19088.hp1 NA19088.hp2 NA19090.hp1 NA19091.hp1 NA20300.hp1 NA20752.hp1 NA20752.hp2 NA20805.hp1 NA20905.hp1 homoSapiens_chm13v2.hp1	a0002 a0003 a0004 others(1): Show a0002 a0003 a0004 a0009	a0002c0002 a0002c0011 a0003c0003 others(4): Show a0002c0002 a0002c0011 a0003c0003 a0003c0004 a0003c0008 a0004c0005 a0009c0012	a0002c0002t0001 a0002c0002t0006 a0002c0002t0008 others(32): Show a0002c0002t0001 a0002c0002t0006 a0002c0002t0008 a0002c0002t0012 a0002c0002t0013 a0002c0002t0015 a0002c0002t0019 a0002c0002t0027 a0002c0002t0028 a0002c0002t0029 a0002c0002t0046 a0002c0002t0048 a0002c0002t0049 a0002c0002t0050 a0002c0002t0051 a0002c0002t0052 a0002c0002t0057 a0002c0011t0001 a0003c0003t0003 a0003c0003t0005 a0003c0003t0006 a0003c0003t0010 a0003c0003t0014 a0003c0003t0024 a0003c0003t0036 a0003c0003t0040 a0003c0003t0047 a0003c0004t0003 a0003c0004t0006 a0003c0004t0041 a0003c0008t0026 a0004c0005t0020 a0004c0005t0025 a0004c0005t0056 a0009c0012t0001	a0002c0002t0001g0001 a0002c0002t0001g0009 a0002c0002t0001g0023 others(45): Show a0002c0002t0001g0001 a0002c0002t0001g0009 a0002c0002t0001g0023 a0002c0002t0001g0024 a0002c0002t0001g0025 a0002c0002t0001g0026 a0002c0002t0001g0027 a0002c0002t0001g0036 a0002c0002t0006g0013 a0002c0002t0008g0001 a0002c0002t0012g0006 a0002c0002t0012g0014 a0002c0002t0013g0012 a0002c0002t0013g0013 a0002c0002t0015g0001 a0002c0002t0019g0006 a0002c0002t0027g0006 a0002c0002t0028g0006 a0002c0002t0029g0006 a0002c0002t0029g0014 a0002c0002t0046g0006 a0002c0002t0048g0009 a0002c0002t0049g0001 a0002c0002t0050g0001 a0002c0002t0051g0001 a0002c0002t0052g0001 a0002c0002t0057g0001 a0002c0011t0001g0001 a0003c0003t0003g0002 a0003c0003t0003g0030 a0003c0003t0005g0002 a0003c0003t0005g0029 a0003c0003t0006g0002 a0003c0003t0010g0002 a0003c0003t0014g0002 a0003c0003t0014g0028 a0003c0003t0024g0002 a0003c0003t0036g0002 a0003c0003t0040g0002 a0003c0003t0047g0002 a0003c0004t0003g0002 a0003c0004t0006g0002 a0003c0004t0041g0002 a0003c0008t0026g0002 a0004c0005t0020g0008 a0004c0005t0025g0008 a0004c0005t0056g0008 a0009c0012t0001g0009	238	436	0.5459	0	c.756 others(3): Show c.756T>G	p.Tyr others(4): Show p.Tyr252*	OR10D3	ENSG00000197309.5	transcript	ENST00000641351.3	protein_coding	2/2	806/3561	756/939	252/312		chr11	TogoVar
OR10G7_chr11_124031013_124046325	124038427	G G	T T	stop_gained stop_gained	HIGH	HG01167.hp1 HG02647.hp1 NA20129.hp1 others(1): Show HG01167.hp1 HG02647.hp1 NA20129.hp1 NA21309.hp1	a0010 a0017 a0010 a0017	a0010c0009 a0017c0032 a0010c0009 a0017c0032	a0010c0009t0001 a0017c0032t0004 a0010c0009t0001 a0017c0032t0004	a0010c0009t0001g0033 a0010c0009t0001g0074 a0017c0032t0004g0036 a0010c0009t0001g0033 a0010c0009t0001g0074 a0017c0032t0004g0036	4	482	0.0083	0	c.575 others(3): Show c.575C>A	p.Ser others(4): Show p.Ser192*	OR10G7	ENSG00000182634.9	transcript	ENST00000641585.1	protein_coding	2/2	1035/3449	575/936	192/311		chr11	TogoVar
OR10H2_chr19_15723024_15734052	15728113	C C	T T	stop_gained stop_gained	HIGH	NA18941.hp1 NA18941.hp1	a0006 a0006	a0006c0017 a0006c0017	a0006c0017t0001 a0006c0017t0001	a0006c0017t0001g0000 a0006c0017t0001g0000	1	414	0.0024	0	c.70C others(2): Show c.70C>T	p.Gln others(3): Show p.Gln24*	OR10H2	ENSG00000171942.5	transcript	ENST00000305899.5	protein_coding	1/1	90/1029	70/948	24/315		chr19	TogoVar
OR10J1_chr1_159434722_159445967	159440550	T T	A A	stop_gained stop_gained	HIGH	HG00280.hp2 HG00738.hp1 HG01070.hp2 others(20): Show HG00280.hp2 HG00738.hp1 HG01070.hp2 HG01071.hp1 HG01257.hp2 HG01258.hp1 HG01516.hp1 HG01517.hp1 HG01943.hp1 HG01952.hp1 HG01978.hp1 HG01981.hp1 HG02486.hp1 HG02683.hp2 HG02698.hp2 HG02738.hp1 HG03654.hp1 HG04115.hp1 NA19058.hp2 NA19076.hp1 NA19085.hp2 NA20300.hp2 NA20752.hp1	a0004 a0004	a0004c0004 a0004c0004	a0004c0004t0001 a0004c0004t0004 a0004c0004t0001 a0004c0004t0004	a0004c0004t0001g0000 a0004c0004t0004g0000 a0004c0004t0001g0000 a0004c0004t0004g0000	23	456	0.0504	0	c.759 others(3): Show c.759T>A	p.Cys others(4): Show p.Cys253*	OR10J1	ENSG00000196184.10	transcript	ENST00000423932.6	protein_coding	1/1	829/1246	759/930	253/309		chr1	TogoVar
OR10R2_chr1_158467220_158485936	158480352	C C	T T	stop_gained stop_gained	HIGH	HG01257.hp1 HG01928.hp1 HG01975.hp1 others(3): Show HG01257.hp1 HG01928.hp1 HG01975.hp1 HG01978.hp2 HG02523.hp2 NA19078.hp2	a0006 a0006	a0006c0007 a0006c0007	a0006c0007t0001 a0006c0007t0001	a0006c0007t0001g0018 a0006c0007t0001g0027 a0006c0007t0001g0119 a0006c0007t0001g0018 a0006c0007t0001g0027 a0006c0007t0001g0119	6	446	0.0135	0	c.442 others(3): Show c.442C>T	p.Gln others(4): Show p.Gln148*	OR10R2	ENSG00000198965.5	transcript	ENST00000641067.1	protein_coding	2/2	548/1132	442/975	148/324		chr1	TogoVar
OR10V1_chr11_59707916_59718845	59713479	G G	A A	stop_gained stop_gained	HIGH	HG00438.hp2 HG00639.hp2 HG00733.hp2 others(33): Show HG00438.hp2 HG00639.hp2 HG00733.hp2 HG01106.hp2 HG01243.hp1 HG01361.hp1 HG01891.hp1 HG01928.hp1 HG01934.hp1 HG01952.hp1 HG01978.hp1 HG01993.hp1 HG02148.hp1 HG02148.hp2 HG02258.hp2 HG02273.hp1 HG02280.hp2 HG02523.hp1 HG02970.hp1 HG03130.hp1 HG03710.hp2 NA18939.hp2 NA18941.hp1 NA18949.hp2 NA18960.hp1 NA18961.hp1 NA18967.hp2 NA18973.hp2 NA18991.hp2 NA19054.hp1 NA19055.hp2 NA19057.hp1 NA19067.hp1 NA19078.hp2 NA19079.hp2 NA20905.hp1	a0003 a0007 a0011 a0003 a0007 a0011	a0003c0002 a0007c0010 a0011c0015 a0003c0002 a0007c0010 a0011c0015	a0003c0002t0000 a0007c0010t0000 a0011c0015t0000 a0003c0002t0000 a0007c0010t0000 a0011c0015t0000	a0003c0002t0000g0000 a0007c0010t0000g0000 a0011c0015t0000g0000 a0003c0002t0000g0000 a0007c0010t0000g0000 a0011c0015t0000g0000	36	428	0.0841	0	c.367 others(3): Show c.367C>T	p.Gln others(4): Show p.Gln123*	OR10V1	ENSG00000172289.3	transcript	ENST00000307552.3	protein_coding	1/1	367/930	367/930	123/309		chr11	TogoVar
OR10X1_chr1_158573919_158584899	158579702	C C	T T	stop_gained stop_gained	HIGH	HG00140.hp2 HG00280.hp2 HG00408.hp1 others(209): Show HG00140.hp2 HG00280.hp2 HG00408.hp1 HG00408.hp2 HG00438.hp1 HG00438.hp2 HG00544.hp1 HG00544.hp2 HG00558.hp2 HG00609.hp2 HG00621.hp1 HG00621.hp2 HG00733.hp1 HG00733.hp2 HG00735.hp1 HG00738.hp1 HG00741.hp1 HG00741.hp2 HG01071.hp2 HG01074.hp1 HG01074.hp2 HG01081.hp2 HG01106.hp1 HG01106.hp2 HG01109.hp1 HG01109.hp2 HG01123.hp1 HG01123.hp2 HG01167.hp1 HG01168.hp2 HG01169.hp1 HG01175.hp2 HG01243.hp1 HG01256.hp1 HG01258.hp1 HG01261.hp1 HG01261.hp2 HG01433.hp1 HG01496.hp1 HG01515.hp2 HG01516.hp1 HG01516.hp2 HG01517.hp1 HG01884.hp2 HG01891.hp2 HG01943.hp1 HG01978.hp1 HG01981.hp1 HG01993.hp1 HG02004.hp1 HG02040.hp1 HG02040.hp2 HG02055.hp1 HG02055.hp2 HG02071.hp1 HG02074.hp1 HG02080.hp1 HG02083.hp2 HG02109.hp1 HG02109.hp2 HG02129.hp2 HG02132.hp1 HG02132.hp2 HG02145.hp1 HG02145.hp2 HG02148.hp1 HG02155.hp2 HG02165.hp2 HG02257.hp1 HG02257.hp2 HG02258.hp1 HG02258.hp2 HG02273.hp2 HG02280.hp1 HG02451.hp1 HG02486.hp1 HG02486.hp2 HG02559.hp1 HG02572.hp1 HG02572.hp2 HG02602.hp1 HG02615.hp2 HG02622.hp2 HG02630.hp1 HG02738.hp2 HG02896.hp1 HG02896.hp2 HG02897.hp1 HG02922.hp1 HG02922.hp2 HG02965.hp1 HG02965.hp2 HG02970.hp1 HG02970.hp2 HG02976.hp1 HG03017.hp1 HG03017.hp2 HG03041.hp1 HG03041.hp2 HG03098.hp1 HG03098.hp2 HG03130.hp1 HG03139.hp1 HG03139.hp2 HG03209.hp1 HG03225.hp1 HG03239.hp1 HG03453.hp1 HG03453.hp2 HG03486.hp1 HG03491.hp1 HG03516.hp2 HG03654.hp1 HG03654.hp2 HG03669.hp1 HG03669.hp2 HG03688.hp2 HG03704.hp1 HG03834.hp1 HG03834.hp2 HG03927.hp2 HG03942.hp1 HG04115.hp2 HG04199.hp2 HG04204.hp2 HG04228.hp2 NA18522.hp1 NA18747.hp2 NA18940.hp2 NA18942.hp1 NA18943.hp1 NA18944.hp1 NA18945.hp1 NA18946.hp1 NA18947.hp2 NA18948.hp2 NA18949.hp1 NA18950.hp1 NA18951.hp1 NA18952.hp1 NA18953.hp1 NA18953.hp2 NA18954.hp1 NA18955.hp1 NA18956.hp2 NA18957.hp1 NA18959.hp1 NA18960.hp2 NA18964.hp1 NA18965.hp1 NA18965.hp2 NA18966.hp2 NA18967.hp2 NA18969.hp1 NA18970.hp2 NA18973.hp1 NA18973.hp2 NA18974.hp2 NA18978.hp2 NA18979.hp1 NA18979.hp2 NA18981.hp2 NA18982.hp2 NA18985.hp2 NA18986.hp2 NA18990.hp1 NA18991.hp1 NA18993.hp2 NA18994.hp2 NA18995.hp2 NA18998.hp2 NA18999.hp1 NA18999.hp2 NA19000.hp2 NA19002.hp2 NA19003.hp1 NA19005.hp1 NA19006.hp2 NA19007.hp1 NA19009.hp1 NA19010.hp1 NA19011.hp1 NA19011.hp2 NA19030.hp1 NA19058.hp2 NA19063.hp1 NA19065.hp1 NA19066.hp1 NA19066.hp2 NA19068.hp1 NA19068.hp2 NA19070.hp2 NA19074.hp1 NA19074.hp2 NA19077.hp2 NA19078.hp2 NA19081.hp2 NA19083.hp1 NA19084.hp1 NA19084.hp2 NA19085.hp2 NA19087.hp1 NA19088.hp1 NA19089.hp2 NA19240.hp2 NA20129.hp1 NA20129.hp2 NA20300.hp2 NA20752.hp1 NA20805.hp2 NA20905.hp2 NA21309.hp2	a0001 a0001	a0001c0001 a0001c0004 a0001c0006 others(1): Show a0001c0001 a0001c0004 a0001c0006 a0001c0012	a0001c0001t0000 a0001c0004t0000 a0001c0006t0000 others(1): Show a0001c0001t0000 a0001c0004t0000 a0001c0006t0000 a0001c0012t0000	a0001c0001t0000g0000 a0001c0004t0000g0000 a0001c0006t0000g0000 others(1): Show a0001c0001t0000g0000 a0001c0004t0000g0000 a0001c0006t0000g0000 a0001c0012t0000g0000	212	430	0.4930	0	c.198 others(3): Show c.198G>A	p.Trp others(3): Show p.Trp66*	OR10X1	ENSG00000279111.2	transcript	ENST00000623167.1	protein_coding	1/1	198/981	198/981	66/326		chr1	TogoVar
OR10Z1_chr1_158600268_158617514	158606897	C C	A A	stop_gained stop_gained	HIGH	HG02109.hp2 HG02572.hp2 HG03098.hp1 HG02109.hp2 HG02572.hp2 HG03098.hp1	a0005 a0005	a0005c0006 a0005c0006	a0005c0006t0006 a0005c0006t0039 a0005c0006t0006 a0005c0006t0039	a0005c0006t0006g0005 a0005c0006t0039g0005 a0005c0006t0006g0005 a0005c0006t0039g0005	3	446	0.0067	0	c.459 others(3): Show c.459C>A	p.Tyr others(4): Show p.Tyr153*	OR10Z1	ENSG00000198967.5	transcript	ENST00000641002.1	protein_coding	2/2	706/6323	459/942	153/313		chr1	TogoVar
OR11G2_chr14_20185896_20206075	20198016	C C	A A	stop_gained stop_gained	HIGH	HG02886.hp1 HG02970.hp1 HG02886.hp1 HG02970.hp1	a0009 a0009	a0009c0012 a0009c0012	a0009c0012t0008 a0009c0012t0008	a0009c0012t0008g0006 a0009c0012t0008g0006	2	482	0.0042	0	c.579 others(3): Show c.579C>A	p.Cys others(4): Show p.Cys193*	OR11G2	ENSG00000196832.5	transcript	ENST00000641879.2	protein_coding	2/2	1354/4413	579/936	193/311		chr14	TogoVar
OR11H1_chr22_15523192_15534139	15528857	T T	G G	stop_gained stop_gained	HIGH	HG01167.hp2 HG02698.hp2 NA18982.hp2 others(1): Show HG01167.hp2 HG02698.hp2 NA18982.hp2 NA19084.hp2	a0005 a0005	a0005c0006 a0005c0006	a0005c0006t0000 a0005c0006t0000	a0005c0006t0000g0000 a0005c0006t0000g0000	4	263	0.0152	0	c.666 others(3): Show c.666T>G	p.Tyr others(4): Show p.Tyr222*	OR11H1	ENSG00000130538.6	transcript	ENST00000643195.1	protein_coding	1/1	666/948	666/948	222/315		chr22	TogoVar
OR11H4_chr14_20234286_20249349	20242962	T T	A A	stop_gained stop_gained	HIGH	HG02896.hp1 HG02897.hp1 HG02896.hp1 HG02897.hp1	a0003 a0003	a0003c0005 a0003c0005	a0003c0005t0002 a0003c0005t0002	a0003c0005t0002g0060 a0003c0005t0002g0060	2	439	0.0046	0	c.141 others(3): Show c.141T>A	p.Tyr others(3): Show p.Tyr47*	OR11H4	ENSG00000176198.4	transcript	ENST00000641082.1	protein_coding	2/2	198/1585	141/945	47/314		chr14	TogoVar
OR11H6_chr14_20218710_20229702	20224640	C C	T T	stop_gained stop_gained	HIGH	HG01255.hp2 HG01255.hp2	a0010 a0010	a0010c0010 a0010c0010	a0010c0010t0000 a0010c0010t0000	a0010c0010t0000g0000 a0010c0010t0000g0000	1	450	0.0022	0	c.931 others(3): Show c.931C>T	p.Arg others(4): Show p.Arg311*	OR11H6	ENSG00000176219.3	transcript	ENST00000315519.3	protein_coding	1/1	931/993	931/993	311/330		chr14	TogoVar
OR12D3_chr6_29368423_29380291	29374535	A A	T T	stop_gained stop_gained	HIGH	HG00558.hp2 HG00558.hp2	a0006 a0006	a0006c0010 a0006c0010	a0006c0010t0002 a0006c0010t0002	a0006c0010t0002g0000 a0006c0010t0002g0000	1	437	0.0023	0	c.753 others(3): Show c.753T>A	p.Tyr others(4): Show p.Tyr251*	OR12D3	ENSG00000112462.8	transcript	ENST00000396806.3	protein_coding	1/1	757/1869	753/951	251/316		chr6	TogoVar
OR13C3_chr9_104530749_104541856	104536619	G G	C C	stop_gained stop_gained	HIGH	HG02723.hp1 HG02723.hp1	a0008 a0008	a0008c0016 a0008c0016	a0008c0016t0001 a0008c0016t0001	a0008c0016t0001g0000 a0008c0016t0001g0000	1	456	0.0022	0	c.105 others(3): Show c.105C>G	p.Tyr others(3): Show p.Tyr35*	OR13C3	ENSG00000204246.4	transcript	ENST00000641090.1	protein_coding	1/1	238/1108	105/954	35/317		chr9	TogoVar
OR13C3_chr9_104530749_104541856	104536643	G G	C C	stop_gained stop_gained	HIGH	HG02723.hp1 HG02723.hp1	a0008 a0008	a0008c0016 a0008c0016	a0008c0016t0001 a0008c0016t0001	a0008c0016t0001g0000 a0008c0016t0001g0000	1	456	0.0022	0	c.81C others(2): Show c.81C>G	p.Tyr others(3): Show p.Tyr27*	OR13C3	ENSG00000204246.4	transcript	ENST00000641090.1	protein_coding	1/1	214/1108	81/954	27/317		chr9	TogoVar
OR13C3_chr9_104530749_104541856	104536654	C C	A A	stop_gained stop_gained	HIGH	HG02723.hp1 HG02723.hp1	a0008 a0008	a0008c0016 a0008c0016	a0008c0016t0001 a0008c0016t0001	a0008c0016t0001g0000 a0008c0016t0001g0000	1	456	0.0022	0	c.70G others(2): Show c.70G>T	p.Glu others(3): Show p.Glu24*	OR13C3	ENSG00000204246.4	transcript	ENST00000641090.1	protein_coding	1/1	203/1108	70/954	24/317		chr9	TogoVar
OR13C3_chr9_104530749_104541856	104536693	C C	A A	stop_gained stop_gained	HIGH	NA18963.hp1 NA18963.hp1	a0006 a0006	a0006c0018 a0006c0018	a0006c0018t0001 a0006c0018t0001	a0006c0018t0001g0000 a0006c0018t0001g0000	1	456	0.0022	0	c.31G others(2): Show c.31G>T	p.Glu others(3): Show p.Glu11*	OR13C3	ENSG00000204246.4	transcript	ENST00000641090.1	protein_coding	1/1	164/1108	31/954	11/317		chr9	TogoVar
OR13C4_chr9_104521253_104532209	104526433	A A	C C	stop_gained stop_gained	HIGH	HG02083.hp2 HG02129.hp2 NA18947.hp2 others(6): Show HG02083.hp2 HG02129.hp2 NA18947.hp2 NA18952.hp2 NA18955.hp2 NA18966.hp1 NA18969.hp1 NA18988.hp1 NA19055.hp1	a0003 a0003	a0003c0003 a0003c0003	a0003c0003t0000 a0003c0003t0000	a0003c0003t0000g0000 a0003c0003t0000g0000	9	458	0.0197	0	c.777 others(3): Show c.777T>G	p.Tyr others(4): Show p.Tyr259*	OR13C4	ENSG00000148136.5	transcript	ENST00000277216.3	protein_coding	1/1	777/957	777/957	259/318		chr9	TogoVar
OR13C8_chr9_104564168_104575130	104569193	C C	A A	stop_gained stop_gained	HIGH	HG02071.hp1 HG02523.hp2 NA18948.hp2 others(6): Show HG02071.hp1 HG02523.hp2 NA18948.hp2 NA18979.hp2 NA18994.hp1 NA19001.hp2 NA19054.hp2 NA19057.hp2 NA19091.hp2	a0003 a0003	a0003c0003 a0003c0006 a0003c0003 a0003c0006	a0003c0003t0000 a0003c0006t0000 a0003c0003t0000 a0003c0006t0000	a0003c0003t0000g0000 a0003c0006t0000g0000 a0003c0003t0000g0000 a0003c0006t0000g0000	9	432	0.0208	0	c.26C others(2): Show c.26C>A	p.Ser others(2): Show p.Ser9*	OR13C8	ENSG00000186943.1	transcript	ENST00000335040.1	protein_coding	1/1	26/963	26/963	9/320		chr9	TogoVar
OR13D1_chr9_104689518_104700462	104695393	C C	CAGGAATA others(40): Show CAGGAATAAAGAGGTCAAAGAGGCTGTAAAGAAAGTCCTGAGCAGACA	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	HG03704.hp1 HG03704.hp1	a0014 a0014	a0014c0020 a0014c0020	a0014c0020t0000 a0014c0020t0000	a0014c0020t0000g0000 a0014c0020t0000g0000	1	396	0.0025	47	c.877 others(54): Show c.877_923dupAGGAATAAAGAGGTCAAAGAGGCTGTAAAGAAAGTCCT GAGCAGACA	p.His others(5): Show p.His308fs	OR13D1	ENSG00000179055.8	transcript	ENST00000641530.1	protein_coding	1/1	924/945	924/945	308/314	INFO_REALIGN_3_PRIME	chr9	TogoVar
OR1A1_chr17_3202667_3223896	3215984	C C	T T	stop_gained stop_gained	HIGH	NA18956.hp2 NA18956.hp2	a0007 a0007	a0007c0013 a0007c0013	a0007c0013t0002 a0007c0013t0002	a0007c0013t0002g0002 a0007c0013t0002g0002	1	434	0.0023	0	c.364 others(3): Show c.364C>T	p.Arg others(4): Show p.Arg122*	OR1A1	ENSG00000172146.4	transcript	ENST00000641732.2	protein_coding	4/4	1254/4166	364/930	122/309		chr17	TogoVar
OR1A2_chr17_3192519_3203448	3197564	G G	T T	stop_gained stop_gained	HIGH	HG03225.hp1 HG03225.hp1	a0010 a0010	a0010c0012 a0010c0012	a0010c0012t0000 a0010c0012t0000	a0010c0012t0000g0000 a0010c0012t0000g0000	1	430	0.0023	0	c.46G others(2): Show c.46G>T	p.Gly others(3): Show p.Gly16*	OR1A2	ENSG00000172150.4	transcript	ENST00000381951.1	protein_coding	1/1	46/930	46/930	16/309		chr17	TogoVar
OR1A2_chr17_3192519_3203448	3197585	C C	T T	stop_gained stop_gained	HIGH	HG03225.hp1 HG03225.hp1	a0010 a0010	a0010c0012 a0010c0012	a0010c0012t0000 a0010c0012t0000	a0010c0012t0000g0000 a0010c0012t0000g0000	1	430	0.0023	0	c.67C others(2): Show c.67C>T	p.Gln others(3): Show p.Gln23*	OR1A2	ENSG00000172150.4	transcript	ENST00000381951.1	protein_coding	1/1	67/930	67/930	23/309		chr17	TogoVar
OR1B1_chr9_122623125_122662627	122628962	G G	A A	stop_gained stop_gained	HIGH	HG00140.hp2 HG00280.hp2 HG00323.hp1 others(158): Show HG00140.hp2 HG00280.hp2 HG00323.hp1 HG00408.hp1 HG00408.hp2 HG00423.hp1 HG00423.hp2 HG00544.hp1 HG00597.hp1 HG00609.hp1 HG00609.hp2 HG00621.hp1 HG00621.hp2 HG00673.hp1 HG00733.hp1 HG00733.hp2 HG01069.hp1 HG01074.hp1 HG01106.hp1 HG01106.hp2 HG01167.hp2 HG01192.hp2 HG01255.hp1 HG01255.hp2 HG01256.hp1 HG01257.hp2 HG01258.hp2 HG01346.hp2 HG01358.hp1 HG01358.hp2 HG01433.hp2 HG01516.hp2 HG01928.hp1 HG01943.hp1 HG01943.hp2 HG01952.hp1 HG01952.hp2 HG01978.hp1 HG01981.hp1 HG01981.hp2 HG01993.hp1 HG01993.hp2 HG02015.hp1 HG02027.hp1 HG02027.hp2 HG02040.hp1 HG02056.hp1 HG02056.hp2 HG02071.hp2 HG02080.hp1 HG02083.hp1 HG02083.hp2 HG02148.hp1 HG02148.hp2 HG02155.hp2 HG02165.hp2 HG02293.hp2 HG02486.hp2 HG02523.hp1 HG02523.hp2 HG02602.hp2 HG02622.hp1 HG02683.hp2 HG02698.hp2 HG02738.hp2 HG03017.hp1 HG03239.hp1 HG03491.hp2 HG03492.hp1 HG03654.hp1 HG03688.hp1 HG03704.hp2 HG03831.hp1 HG03831.hp2 HG03834.hp1 HG03834.hp2 HG03927.hp1 HG03942.hp2 HG04115.hp1 HG04115.hp2 HG04184.hp1 HG04204.hp2 NA18941.hp1 NA18941.hp2 NA18942.hp2 NA18943.hp1 NA18943.hp2 NA18944.hp2 NA18945.hp1 NA18945.hp2 NA18946.hp2 NA18947.hp1 NA18947.hp2 NA18949.hp1 NA18949.hp2 NA18951.hp1 NA18951.hp2 NA18952.hp1 NA18952.hp2 NA18954.hp1 NA18954.hp2 NA18955.hp2 NA18956.hp2 NA18957.hp1 NA18959.hp1 NA18962.hp1 NA18965.hp1 NA18967.hp2 NA18968.hp1 NA18968.hp2 NA18969.hp1 NA18970.hp1 NA18970.hp2 NA18974.hp1 NA18975.hp1 NA18979.hp2 NA18980.hp2 NA18981.hp2 NA18982.hp1 NA18983.hp1 NA18984.hp1 NA18987.hp1 NA18987.hp2 NA18988.hp2 NA18989.hp1 NA18990.hp2 NA18991.hp1 NA18991.hp2 NA18992.hp1 NA18992.hp2 NA18993.hp2 NA18994.hp2 NA18998.hp1 NA18999.hp1 NA19009.hp2 NA19010.hp1 NA19010.hp2 NA19011.hp1 NA19011.hp2 NA19054.hp1 NA19054.hp2 NA19058.hp1 NA19059.hp2 NA19060.hp2 NA19062.hp1 NA19063.hp1 NA19063.hp2 NA19064.hp1 NA19064.hp2 NA19065.hp1 NA19067.hp1 NA19067.hp2 NA19072.hp2 NA19076.hp2 NA19079.hp2 NA19084.hp2 NA19087.hp2 NA19088.hp2 NA20300.hp1 NA20752.hp2 NA20905.hp1	a0002 a0003 a0006 a0002 a0003 a0006	a0002c0002 a0002c0016 a0002c0017 others(2): Show a0002c0002 a0002c0016 a0002c0017 a0003c0003 a0006c0008	a0002c0002t0002 a0002c0002t0012 a0002c0016t0002 others(3): Show a0002c0002t0002 a0002c0002t0012 a0002c0016t0002 a0002c0017t0011 a0003c0003t0003 a0006c0008t0002	a0002c0002t0002g0001 a0002c0002t0002g0007 a0002c0002t0002g0021 others(81): Show a0002c0002t0002g0001 a0002c0002t0002g0007 a0002c0002t0002g0021 a0002c0002t0002g0022 a0002c0002t0002g0028 a0002c0002t0002g0029 a0002c0002t0002g0038 a0002c0002t0002g0043 a0002c0002t0002g0055 a0002c0002t0002g0057 a0002c0002t0002g0065 a0002c0002t0002g0070 a0002c0002t0002g0073 a0002c0002t0002g0074 a0002c0002t0002g0079 a0002c0002t0002g0080 a0002c0002t0002g0090 a0002c0002t0002g0092 a0002c0002t0002g0100 a0002c0002t0002g0110 a0002c0002t0002g0121 a0002c0002t0002g0135 a0002c0002t0002g0143 a0002c0002t0002g0146 a0002c0002t0002g0153 a0002c0002t0002g0162 a0002c0002t0002g0165 a0002c0002t0002g0169 a0002c0002t0002g0172 a0002c0002t0002g0174 a0002c0002t0002g0176 a0002c0002t0002g0177 a0002c0002t0002g0178 a0002c0002t0002g0182 a0002c0002t0002g0184 a0002c0002t0002g0194 a0002c0002t0002g0196 a0002c0002t0002g0199 a0002c0002t0002g0200 a0002c0002t0002g0201 a0002c0002t0002g0234 a0002c0002t0002g0241 a0002c0002t0002g0244 a0002c0002t0002g0245 a0002c0002t0002g0247 a0002c0002t0002g0251 a0002c0002t0012g0066 a0002c0016t0002g0195 a0002c0017t0011g0179 a0003c0003t0003g0002 a0003c0003t0003g0006 a0003c0003t0003g0008 a0003c0003t0003g0034 a0003c0003t0003g0039 a0003c0003t0003g0069 a0003c0003t0003g0075 a0003c0003t0003g0077 a0003c0003t0003g0091 a0003c0003t0003g0108 a0003c0003t0003g0113 a0003c0003t0003g0116 a0003c0003t0003g0124 a0003c0003t0003g0125 a0003c0003t0003g0127 a0003c0003t0003g0131 a0003c0003t0003g0134 a0003c0003t0003g0144 a0003c0003t0003g0145 a0003c0003t0003g0148 a0003c0003t0003g0149 a0003c0003t0003g0171 a0003c0003t0003g0175 a0003c0003t0003g0180 a0003c0003t0003g0186 a0003c0003t0003g0189 a0003c0003t0003g0190 a0003c0003t0003g0192 a0003c0003t0003g0202 a0003c0003t0003g0203 a0003c0003t0003g0238 a0003c0003t0003g0242 a0003c0003t0003g0255 a0006c0008t0002g0013 a0006c0008t0002g0173	161	420	0.3833	0	c.571 others(3): Show c.571C>T	p.Arg others(4): Show p.Arg191*	OR1B1	ENSG00000280094.3	transcript	ENST00000623530.2	protein_coding	2/2	1104/1941	571/954	191/317		chr9	TogoVar
OR1D5_chr17_3057669_3068607	3063094	G G	A A	stop_gained stop_gained	HIGH	HG00597.hp2 HG03688.hp2 HG00597.hp2 HG03688.hp2	a0009 a0010 a0009 a0010	a0009c0012 a0010c0011 a0009c0012 a0010c0011	a0009c0012t0000 a0010c0011t0000 a0009c0012t0000 a0010c0011t0000	a0009c0012t0000g0000 a0010c0011t0000g0000 a0009c0012t0000g0000 a0010c0011t0000g0000	2	444	0.0045	0	c.514 others(3): Show c.514C>T	p.Arg others(4): Show p.Arg172*	OR1D5	ENSG00000262628.1	transcript	ENST00000575751.1	protein_coding	1/1	514/939	514/939	172/312		chr17	TogoVar
OR1E1_chr17_3392104_3403410	3398263	G G	A A	stop_gained stop_gained	HIGH	homoSapiens_chm13v2.hp1 homoSapiens_chm13v2.hp1	a0007 a0007	a0007c0019 a0007c0019	a0007c0019t0001 a0007c0019t0001	a0007c0019t0001g0000 a0007c0019t0001g0000	1	380	0.0026	0	c.148 others(3): Show c.148C>T	p.Arg others(3): Show p.Arg50*	OR1E1	ENSG00000180016.2	transcript	ENST00000322608.2	protein_coding	1/1	148/1307	148/945	50/314		chr17	TogoVar
OR1J1_chr9_122471958_122482926	122477222	G G	T T	stop_gained stop_gained	HIGH	HG00280.hp2 HG00280.hp2	a0009 a0009	a0009c0010 a0009c0010	a0009c0010t0000 a0009c0010t0000	a0009c0010t0000g0000 a0009c0010t0000g0000	1	472	0.0021	0	c.705 others(3): Show c.705C>A	p.Cys others(4): Show p.Cys235*	OR1J1	ENSG00000136834.3	transcript	ENST00000259357.3	protein_coding	1/1	705/969	705/969	235/322		chr9	TogoVar
OR1L1_chr9_122656716_122667648	122662013	C C	T T	stop_gained stop_gained	HIGH	NA18992.hp2 NA18992.hp2	a0010 a0010	a0010c0016 a0010c0016	a0010c0016t0000 a0010c0016t0000	a0010c0016t0000g0000 a0010c0016t0000g0000	1	454	0.0022	0	c.298 others(3): Show c.298C>T	p.Gln others(4): Show p.Gln100*	OR1L1	ENSG00000173679.2	transcript	ENST00000309623.1	protein_coding	1/1	298/933	298/933	100/310		chr9	TogoVar
OR2A2_chr7_144104583_144115539	144110378	C C	T T	stop_gained stop_gained	HIGH	HG02523.hp1 HG02523.hp1	a0007 a0007	a0007c0010 a0007c0010	a0007c0010t0000 a0007c0010t0000	a0007c0010t0000g0000 a0007c0010t0000g0000	1	408	0.0025	0	c.796 others(3): Show c.796C>T	p.Arg others(4): Show p.Arg266*	OR2A2	ENSG00000221989.3	transcript	ENST00000408979.3	protein_coding	1/1	796/957	796/957	266/318		chr7	TogoVar
OR2A4_chr6_131694644_131706401	131701036	G G	C C	stop_gained stop_gained	HIGH	NA19004.hp1 NA19011.hp1 NA19087.hp1 NA19004.hp1 NA19011.hp1 NA19087.hp1	a0007 a0007	a0007c0008 a0007c0008	a0007c0008t0001 a0007c0008t0001	a0007c0008t0001g0000 a0007c0008t0001g0000	3	379	0.0079	0	c.366 others(3): Show c.366C>G	p.Tyr others(4): Show p.Tyr122*	OR2A4	ENSG00000180658.4	transcript	ENST00000315453.4	protein_coding	1/1	366/1758	366/933	122/310		chr6	TogoVar
OR2AE1_chr7_99871062_99882033	99876070	G G	A A	stop_gained stop_gained	HIGH	HG01952.hp1 HG01952.hp1	a0009 a0009	a0009c0011 a0009c0011	a0009c0011t0000 a0009c0011t0000	a0009c0011t0000g0000 a0009c0011t0000g0000	1	388	0.0026	0	c.964 others(3): Show c.964C>T	p.Arg others(4): Show p.Arg322*	OR2AE1	ENSG00000244623.2	transcript	ENST00000316368.3	protein_coding	1/1	964/972	964/972	322/323		chr7	TogoVar
OR2AG1_chr11_6778020_6796558	6785743	A A	T T	stop_gained stop_gained	HIGH	HG03654.hp2 HG03654.hp2	a0011 a0011	a0011c0013 a0011c0013	a0011c0013t0003 a0011c0013t0003	a0011c0013t0003g0001 a0011c0013t0003g0001	1	468	0.0021	0	c.706 others(3): Show c.706A>T	p.Lys others(4): Show p.Lys236*	OR2AG1	ENSG00000279486.6	transcript	ENST00000641258.1	protein_coding	2/2	1178/6993	706/951	236/316		chr11	TogoVar
OR2AP1_chr12_55567468_55580612	55575062	T T	A A	stop_gained stop_gained	HIGH	NA18967.hp1 NA18967.hp1	a0007 a0007	a0007c0010 a0007c0010	a0007c0010t0001 a0007c0010t0001	a0007c0010t0001g0006 a0007c0010t0001g0006	1	478	0.0021	0	c.648 others(3): Show c.648T>A	p.Tyr others(4): Show p.Tyr216*	OR2AP1	ENSG00000179615.3	transcript	ENST00000641114.1	protein_coding	2/2	998/1548	648/930	216/309		chr12	TogoVar
OR2AP1_chr12_55567468_55580612	55575075	A A	T T	stop_gained stop_gained	HIGH	NA18967.hp1 NA18967.hp1	a0007 a0007	a0007c0010 a0007c0010	a0007c0010t0001 a0007c0010t0001	a0007c0010t0001g0006 a0007c0010t0001g0006	1	478	0.0021	0	c.661 others(3): Show c.661A>T	p.Lys others(4): Show p.Lys221*	OR2AP1	ENSG00000179615.3	transcript	ENST00000641114.1	protein_coding	2/2	1011/1548	661/930	221/309		chr12	TogoVar
OR2AP1_chr12_55567468_55580612	55575131	T T	A A	stop_gained stop_gained	HIGH	NA18967.hp1 NA18967.hp1	a0007 a0007	a0007c0010 a0007c0010	a0007c0010t0001 a0007c0010t0001	a0007c0010t0001g0006 a0007c0010t0001g0006	1	478	0.0021	0	c.717 others(3): Show c.717T>A	p.Cys others(4): Show p.Cys239*	OR2AP1	ENSG00000179615.3	transcript	ENST00000641114.1	protein_coding	2/2	1067/1548	717/930	239/309		chr12	TogoVar
OR2AP1_chr12_55567468_55580612	55575165	G G	T T	stop_gained stop_gained	HIGH	NA18967.hp1 NA18967.hp1	a0007 a0007	a0007c0010 a0007c0010	a0007c0010t0001 a0007c0010t0001	a0007c0010t0001g0006 a0007c0010t0001g0006	1	478	0.0021	0	c.751 others(3): Show c.751G>T	p.Gly others(4): Show p.Gly251*	OR2AP1	ENSG00000179615.3	transcript	ENST00000641114.1	protein_coding	2/2	1101/1548	751/930	251/309		chr12	TogoVar

Search by Variant

Search

Search Results (Total: 3004 hits)