Joint Open Genome and Omics Platform (JoGo)

Search by Variant

Regionname

e.g. ALDH2_chr12_111761933_111822532, HBB_chr11_5220464_5232071.

Chr

Chromosome name (e.g., chr11).

Snpeff genename

Exact SnpEff gene name.

Sampleids

Target sampleid (e.g. HG02615).

Snpeff haplotype class

Haplotype-annotation class (e.g., ahapid, ahapid+chapid).

Snpeff annotation impact

Exact impact level (e.g., HIGH, MODERATE, LOW).

Snpeff annotation impact detail

Keyword match in SnpEff annotation.

Hapid

One or more haplotype IDs (comma-separated; e.g., a0001, a01, a0001c0001, a01c02, a1c2, a0001c0001t0005, a0001c0001t0005g0018).

Samplehapid

Sample haplotype IDs to include (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

No_hapid

Haplotype IDs to exclude (comma-separated; e.g., a0001, a0002, a0001c0001, a0001c0001t0005, a1, a01).

No_samplehapid

Sample haplotype IDs to exclude (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

Start

Start position (GRCh38).

End

End position (GRCh38).

Minac

Minimum alternate allele count (≥).

Maxac

Maximum alternate allele count (≤).

Minlen

Minimum variant length (≥).

Maxlen

Maximum variant length (≤).

Sort By

Select column to sort.

Order by

Ascending or descending.

Show

Results per page.

regionname	pos	ref	alt	annotation	impact	samples	ahapids	achapids	acthapids	actghapids	ac	an	af	len	hgvs_c	hgvs_p	genename	geneid	featuretype	featureid	transcript_biotype	rank	cdna cdna pos length	cds cds pos length	aa aa pos length	status	chr	external
GCNA_chrX_71573437_71618583	71603874	C C	CA CA	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0010 a0010	a0010c0010 a0010c0010	a0010c0010t0001 a0010c0010t0001	a0010c0010t0001g0060 a0010c0010t0001g0060	1	265	0.0038	1	c.599 others(4): Show c.599dupA	p.Asn others(5): Show p.Asn200fs	GCNA	ENSG00000147174.12	transcript	ENST00000373696.8	protein_coding	8/13	688/2765	600/2076	200/691	INFO_REALIGN_3_PRIME	chrX	TogoVar
GCNA_chrX_71573437_71618583	71604088	GA GA	G G	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0010 a0010	a0010c0010 a0010c0010	a0010c0010t0001 a0010c0010t0001	a0010c0010t0001g0060 a0010c0010t0001g0060	1	265	0.0038	-1	c.812 others(4): Show c.812delA	p.Asp others(5): Show p.Asp271fs	GCNA	ENSG00000147174.12	transcript	ENST00000373696.8	protein_coding	8/13	900/2765	812/2076	271/691		chrX	TogoVar
GCNA_chrX_71573437_71618583	71604160	T T	TTC TTC	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0010 a0010	a0010c0010 a0010c0010	a0010c0010t0001 a0010c0010t0001	a0010c0010t0001g0060 a0010c0010t0001g0060	1	265	0.0038	2	c.883 others(9): Show c.883_884insTC	p.Ser others(5): Show p.Ser295fs	GCNA	ENSG00000147174.12	transcript	ENST00000373696.8	protein_coding	8/13	972/2765	884/2076	295/691		chrX	TogoVar
GCNA_chrX_71573437_71618583	71604198	C C	CA CA	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0010 a0010	a0010c0010 a0010c0010	a0010c0010t0001 a0010c0010t0001	a0010c0010t0001g0060 a0010c0010t0001g0060	1	265	0.0038	1	c.923 others(4): Show c.923dupA	p.Ser others(5): Show p.Ser309fs	GCNA	ENSG00000147174.12	transcript	ENST00000373696.8	protein_coding	8/13	1012/2765	924/2076	308/691	INFO_REALIGN_3_PRIME	chrX	TogoVar
GCNA_chrX_71573437_71618583	71604654	C C	CA CA	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0010 a0010	a0010c0010 a0010c0010	a0010c0010t0001 a0010c0010t0001	a0010c0010t0001g0060 a0010c0010t0001g0060	1	265	0.0038	1	c.138 others(5): Show c.1382dupA	p.Asn others(5): Show p.Asn461fs	GCNA	ENSG00000147174.12	transcript	ENST00000373696.8	protein_coding	8/13	1471/2765	1383/2076	461/691	INFO_REALIGN_3_PRIME	chrX	TogoVar
GCNA_chrX_71573437_71618583	71605705	C C	CA CA	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0010 a0010	a0010c0010 a0010c0010	a0010c0010t0001 a0010c0010t0001	a0010c0010t0001g0060 a0010c0010t0001g0060	1	265	0.0038	1	c.144 others(5): Show c.1446dupA	p.Val others(5): Show p.Val483fs	GCNA	ENSG00000147174.12	transcript	ENST00000373696.8	protein_coding	9/13	1535/2765	1447/2076	483/691	INFO_REALIGN_3_PRIME	chrX	TogoVar
GCNA_chrX_71573437_71618583	71605713	G G	GA GA	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0010 a0010	a0010c0010 a0010c0010	a0010c0010t0001 a0010c0010t0001	a0010c0010t0001g0060 a0010c0010t0001g0060	1	265	0.0038	1	c.145 others(5): Show c.1455dupA	p.Arg others(5): Show p.Arg486fs	GCNA	ENSG00000147174.12	transcript	ENST00000373696.8	protein_coding	9/13	1544/2765	1456/2076	486/691	INFO_REALIGN_3_PRIME	chrX	TogoVar
GCNT2_chr6_10550809_10634368	10556581	A A	ATGGAAAA others(12): Show ATGGAAAAACACGTTTCCTG	frameshift_variant frameshift_variant	HIGH	NA19080.hp1 NA19080.hp1	a0004 a0004	a0004c0009 a0004c0009	a0004c0009t0001 a0004c0009t0001	a0004c0009t0001g0081 a0004c0009t0001g0081	1	344	0.0029	19	c.169 others(26): Show c.169_187dupCGTTTCCTGTGGAAAAACA	p.Lys others(4): Show p.Lys63fs	GCNT2	ENSG00000111846.20	transcript	ENST00000316170.9	protein_coding	1/3	803/4579	188/1203	63/400	INFO_REALIGN_3_PRIME	chr6	TogoVar
GDF7_chr2_20662144_20684243	20667362	G G	GCGGCGGC others(3): Show GCGGCGGCGGC	frameshift_variant frameshift_variant	HIGH	HG02015.hp2 HG02015.hp2	a0017 a0017	a0017c0019 a0017c0019	a0017c0019t0139 a0017c0019t0139	a0017c0019t0139g0004 a0017c0019t0139g0004	1	442	0.0023	10	c.123 others(17): Show c.123_124insCGGCGGCGGC	p.Gly others(4): Show p.Gly42fs	GDF7	ENSG00000143869.7	transcript	ENST00000272224.5	protein_coding	1/2	220/9267	124/1353	42/450		chr2	TogoVar
GDI1_chrX_154432154_154448467	154438787	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA18977.hp1 NA18977.hp1	a0006 a0006	a0006c0009 a0006c0009	a0006c0009t0001 a0006c0009t0001	a0006c0009t0001g0023 a0006c0009t0001g0023	1	283	0.0035	-1	c.178 others(4): Show c.178delG	p.Glu others(4): Show p.Glu60fs	GDI1	ENSG00000203879.12	transcript	ENST00000447750.7	protein_coding	3/11	279/2240	178/1344	60/447	INFO_REALIGN_3_PRIME	chrX	TogoVar
GDI1_chrX_154432154_154448467	154438821	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0005 a0005	a0005c0008 a0005c0008	a0005c0008t0005 a0005c0008t0005	a0005c0008t0005g0024 a0005c0008t0005g0024	1	283	0.0035	1	c.211 others(4): Show c.211dupG	p.Asp others(4): Show p.Asp71fs	GDI1	ENSG00000203879.12	transcript	ENST00000447750.7	protein_coding	3/11	313/2240	212/1344	71/447	INFO_REALIGN_3_PRIME	chrX	TogoVar
GDI1_chrX_154432154_154448467	154439042	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0005 a0005	a0005c0008 a0005c0008	a0005c0008t0005 a0005c0008t0005	a0005c0008t0005g0024 a0005c0008t0005g0024	1	283	0.0035	1	c.290 others(8): Show c.290_291insG	p.Arg others(4): Show p.Arg98fs	GDI1	ENSG00000203879.12	transcript	ENST00000447750.7	protein_coding	4/11	392/2240	291/1344	97/447		chrX	TogoVar
GDI1_chrX_154432154_154448467	154440013	AC AC	A A	frameshift_variant frameshift_variant	HIGH	NA18977.hp1 NA18977.hp1	a0006 a0006	a0006c0009 a0006c0009	a0006c0009t0001 a0006c0009t0001	a0006c0009t0001g0023 a0006c0009t0001g0023	1	283	0.0035	-1	c.465 others(4): Show c.465delC	p.Lys others(5): Show p.Lys156fs	GDI1	ENSG00000203879.12	transcript	ENST00000447750.7	protein_coding	5/11	566/2240	465/1344	155/447	INFO_REALIGN_3_PRIME	chrX	TogoVar
GDI1_chrX_154432154_154448467	154440032	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0005 a0005	a0005c0008 a0005c0008	a0005c0008t0005 a0005c0008t0005	a0005c0008t0005g0024 a0005c0008t0005g0024	1	283	0.0035	1	c.481 others(4): Show c.481dupG	p.Val others(5): Show p.Val161fs	GDI1	ENSG00000203879.12	transcript	ENST00000447750.7	protein_coding	5/11	583/2240	482/1344	161/447	INFO_REALIGN_3_PRIME	chrX	TogoVar
GDI1_chrX_154432154_154448467	154440064	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0005 a0005	a0005c0008 a0005c0008	a0005c0008t0005 a0005c0008t0005	a0005c0008t0005g0024 a0005c0008t0005g0024	1	283	0.0035	1	c.513 others(4): Show c.513dupC	p.Tyr others(5): Show p.Tyr172fs	GDI1	ENSG00000203879.12	transcript	ENST00000447750.7	protein_coding	5/11	615/2240	514/1344	172/447	INFO_REALIGN_3_PRIME	chrX	TogoVar
GDI1_chrX_154432154_154448467	154440127	A A	AAC AAC	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA19006.hp1 NA19006.hp1	a0005 a0005	a0005c0008 a0005c0008	a0005c0008t0005 a0005c0008t0005	a0005c0008t0005g0024 a0005c0008t0005g0024	1	283	0.0035	2	c.575 others(9): Show c.575_576insAC	p.Tyr others(5): Show p.Tyr192fs	GDI1	ENSG00000203879.12	transcript	ENST00000447750.7	protein_coding	5/11	677/2240	576/1344	192/447		chrX	TogoVar
GDI1_chrX_154432154_154448467	154440489	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19072.hp1 NA19072.hp1	a0004 a0004	a0004c0004 a0004c0004	a0004c0004t0001 a0004c0004t0001	a0004c0004t0001g0039 a0004c0004t0001g0039	1	283	0.0035	-1	c.706 others(4): Show c.706delC	p.Gln others(5): Show p.Gln236fs	GDI1	ENSG00000203879.12	transcript	ENST00000447750.7	protein_coding	6/11	807/2240	706/1344	236/447	INFO_REALIGN_3_PRIME	chrX	TogoVar
GDI1_chrX_154432154_154448467	154441111	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19072.hp1 NA19072.hp1	a0004 a0004	a0004c0004 a0004c0004	a0004c0004t0001 a0004c0004t0001	a0004c0004t0001g0039 a0004c0004t0001g0039	1	283	0.0035	-1	c.741 others(4): Show c.741delG	p.Thr others(5): Show p.Thr248fs	GDI1	ENSG00000203879.12	transcript	ENST00000447750.7	protein_coding	7/11	842/2240	741/1344	247/447	INFO_REALIGN_3_PRIME	chrX	TogoVar
GDI1_chrX_154432154_154448467	154441626	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19086.hp1 NA19086.hp1	a0002 a0002	a0002c0006 a0002c0006	a0002c0006t0010 a0002c0006t0010	a0002c0006t0010g0036 a0002c0006t0010g0036	1	283	0.0035	-1	c.826 others(4): Show c.826delC	p.Arg others(5): Show p.Arg276fs	GDI1	ENSG00000203879.12	transcript	ENST00000447750.7	protein_coding	8/11	927/2240	826/1344	276/447	INFO_REALIGN_3_PRIME	chrX	TogoVar
GDI1_chrX_154432154_154448467	154441736	CA CA	C C	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0005 a0005	a0005c0008 a0005c0008	a0005c0008t0005 a0005c0008t0005	a0005c0008t0005g0024 a0005c0008t0005g0024	1	283	0.0035	-1	c.935 others(4): Show c.935delA	p.Asn others(5): Show p.Asn312fs	GDI1	ENSG00000203879.12	transcript	ENST00000447750.7	protein_coding	8/11	1036/2240	935/1344	312/447	INFO_REALIGN_3_PRIME	chrX	TogoVar
GDI1_chrX_154432154_154448467	154442152	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA18992.hp1 NA19006.hp1 NA18992.hp1 NA19006.hp1	a0003 a0005 a0003 a0005	a0003c0005 a0005c0008 a0003c0005 a0005c0008	a0003c0005t0007 a0005c0008t0005 a0003c0005t0007 a0005c0008t0005	a0003c0005t0007g0044 a0005c0008t0005g0024 a0003c0005t0007g0044 a0005c0008t0005g0024	2	283	0.0071	-1	c.103 others(5): Show c.1036delC	p.Gln others(5): Show p.Gln346fs	GDI1	ENSG00000203879.12	transcript	ENST00000447750.7	protein_coding	9/11	1137/2240	1036/1344	346/447	INFO_REALIGN_3_PRIME	chrX	TogoVar
GDI1_chrX_154432154_154448467	154442194	A A	ACCACGGA others(21): Show ACCACGGACCCTGAAAAGGAGGTGGGAGC	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA19006.hp1 NA19006.hp1	a0005 a0005	a0005c0008 a0005c0008	a0005c0008t0005 a0005c0008t0005	a0005c0008t0005g0024 a0005c0008t0005g0024	1	283	0.0035	28	c.109 others(37): Show c.1099_1100insGAGCCCACGGACCCTGAAAAGGAGGTGG	p.Glu others(5): Show p.Glu367fs	GDI1	ENSG00000203879.12	transcript	ENST00000447750.7	protein_coding	9/11	1201/2240	1100/1344	367/447	INFO_REALIGN_3_PRIME	chrX	TogoVar
GDI1_chrX_154432154_154448467	154442382	C C	CT CT	frameshift_variant frameshift_variant	HIGH	NA19072.hp1 NA19072.hp1	a0004 a0004	a0004c0004 a0004c0004	a0004c0004t0001 a0004c0004t0001	a0004c0004t0001g0039 a0004c0004t0001g0039	1	283	0.0035	1	c.114 others(5): Show c.1146dupT	p.Ile others(5): Show p.Ile383fs	GDI1	ENSG00000203879.12	transcript	ENST00000447750.7	protein_coding	10/11	1248/2240	1147/1344	383/447	INFO_REALIGN_3_PRIME	chrX	TogoVar
GDPD2_chrX_70418314_70438381	70425009	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA18989.hp1 NA18989.hp1	a0003 a0003	a0003c0015 a0003c0015	a0003c0015t0007 a0003c0015t0007	a0003c0015t0007g0029 a0003c0015t0007g0029	1	318	0.0031	-1	c.27d others(3): Show c.27delC	p.Val others(4): Show p.Val10fs	GDPD2	ENSG00000130055.14	transcript	ENST00000374382.4	protein_coding	2/16	105/1993	27/1620	9/539	INFO_REALIGN_3_PRIME	chrX	TogoVar
GDPD2_chrX_70418314_70438381	70427319	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19072.hp1 NA19072.hp1	a0006 a0006	a0006c0012 a0006c0012	a0006c0012t0001 a0006c0012t0001	a0006c0012t0001g0057 a0006c0012t0001g0057	1	318	0.0031	-1	c.796 others(4): Show c.796delG	p.Val others(5): Show p.Val266fs	GDPD2	ENSG00000130055.14	transcript	ENST00000374382.4	protein_coding	10/16	874/1993	796/1620	266/539	INFO_REALIGN_3_PRIME	chrX	TogoVar
GDPD2_chrX_70418314_70438381	70427430	GA GA	G G	frameshift_variant frameshift_variant	HIGH	NA19072.hp1 NA19072.hp1	a0006 a0006	a0006c0012 a0006c0012	a0006c0012t0001 a0006c0012t0001	a0006c0012t0001g0057 a0006c0012t0001g0057	1	318	0.0031	-1	c.905 others(4): Show c.905delA	p.Lys others(5): Show p.Lys302fs	GDPD2	ENSG00000130055.14	transcript	ENST00000374382.4	protein_coding	10/16	983/1993	905/1620	302/539	INFO_REALIGN_3_PRIME	chrX	TogoVar
GDPD2_chrX_70418314_70438381	70429600	C C	CA CA	frameshift_variant frameshift_variant	HIGH	NA19077.hp2 NA19077.hp2	a0007 a0007	a0007c0011 a0007c0011	a0007c0011t0001 a0007c0011t0001	a0007c0011t0001g0054 a0007c0011t0001g0054	1	318	0.0031	1	c.104 others(5): Show c.1046dupA	p.Asn others(5): Show p.Asn349fs	GDPD2	ENSG00000130055.14	transcript	ENST00000374382.4	protein_coding	11/16	1125/1993	1047/1620	349/539	INFO_REALIGN_3_PRIME	chrX	TogoVar
GDPD4_chr11_77211558_77306686	77243743	T T	TA TA	frameshift_variant frameshift_variant	HIGH	HG00099.hp1 HG00099.hp2 HG00280.hp1 others(81): Show HG00099.hp1 HG00099.hp2 HG00280.hp1 HG00544.hp1 HG00597.hp1 HG00639.hp1 HG00642.hp2 HG00733.hp2 HG00738.hp1 HG01069.hp2 HG01109.hp2 HG01167.hp1 HG01168.hp1 HG01169.hp1 HG01175.hp2 HG01255.hp2 HG01257.hp1 HG01258.hp1 HG01358.hp2 HG01433.hp2 HG01496.hp1 HG01517.hp1 HG01891.hp2 HG02027.hp1 HG02040.hp1 HG02074.hp1 HG02109.hp2 HG02129.hp1 HG02132.hp2 HG02135.hp2 HG02165.hp1 HG02486.hp2 HG02683.hp2 HG02698.hp2 HG02965.hp2 HG03490.hp2 HG03491.hp1 HG03688.hp2 HG03704.hp1 HG04115.hp2 HG04199.hp2 HG04228.hp2 NA18939.hp2 NA18940.hp2 NA18941.hp1 NA18945.hp2 NA18946.hp1 NA18948.hp2 NA18951.hp2 NA18957.hp1 NA18965.hp1 NA18967.hp1 NA18969.hp2 NA18973.hp2 NA18974.hp1 NA18978.hp2 NA18981.hp1 NA18984.hp2 NA18986.hp1 NA18987.hp1 NA18990.hp1 NA18992.hp2 NA18997.hp2 NA18998.hp1 NA18999.hp2 NA19001.hp1 NA19002.hp1 NA19004.hp1 NA19005.hp2 NA19009.hp2 NA19054.hp2 NA19055.hp1 NA19057.hp1 NA19063.hp2 NA19065.hp1 NA19074.hp1 NA19077.hp2 NA19081.hp1 NA19081.hp2 NA19085.hp1 NA19087.hp2 NA19090.hp1 NA20129.hp1 NA20905.hp1	a0003 a0004 a0006 others(1): Show a0003 a0004 a0006 a0010	a0003c0003 a0004c0004 a0006c0006 others(1): Show a0003c0003 a0004c0004 a0006c0006 a0010c0010	a0003c0003t0001 a0003c0003t0002 a0003c0003t0003 others(6): Show a0003c0003t0001 a0003c0003t0002 a0003c0003t0003 a0003c0003t0007 a0003c0003t0009 a0003c0003t0012 a0004c0004t0006 a0006c0006t0006 a0010c0010t0003	a0003c0003t0001g0042 a0003c0003t0001g0055 a0003c0003t0001g0073 others(79): Show a0003c0003t0001g0042 a0003c0003t0001g0055 a0003c0003t0001g0073 a0003c0003t0002g0001 a0003c0003t0002g0002 a0003c0003t0002g0010 a0003c0003t0002g0011 a0003c0003t0002g0012 a0003c0003t0002g0013 a0003c0003t0002g0014 a0003c0003t0002g0015 a0003c0003t0002g0016 a0003c0003t0002g0017 a0003c0003t0002g0018 a0003c0003t0002g0019 a0003c0003t0002g0020 a0003c0003t0002g0021 a0003c0003t0002g0022 a0003c0003t0002g0023 a0003c0003t0002g0025 a0003c0003t0002g0026 a0003c0003t0002g0027 a0003c0003t0002g0028 a0003c0003t0002g0029 a0003c0003t0002g0030 a0003c0003t0002g0031 a0003c0003t0002g0032 a0003c0003t0002g0033 a0003c0003t0002g0034 a0003c0003t0002g0035 a0003c0003t0002g0037 a0003c0003t0002g0038 a0003c0003t0002g0039 a0003c0003t0002g0040 a0003c0003t0002g0041 a0003c0003t0002g0043 a0003c0003t0002g0044 a0003c0003t0002g0045 a0003c0003t0002g0046 a0003c0003t0002g0049 a0003c0003t0002g0050 a0003c0003t0002g0051 a0003c0003t0002g0053 a0003c0003t0002g0054 a0003c0003t0002g0056 a0003c0003t0002g0057 a0003c0003t0002g0058 a0003c0003t0002g0059 a0003c0003t0002g0060 a0003c0003t0002g0062 a0003c0003t0002g0063 a0003c0003t0002g0064 a0003c0003t0002g0065 a0003c0003t0002g0066 a0003c0003t0002g0067 a0003c0003t0002g0068 a0003c0003t0002g0069 a0003c0003t0002g0071 a0003c0003t0002g0072 a0003c0003t0002g0074 a0003c0003t0002g0075 a0003c0003t0002g0076 a0003c0003t0002g0077 a0003c0003t0002g0078 a0003c0003t0002g0079 a0003c0003t0002g0080 a0003c0003t0002g0083 a0003c0003t0002g0084 a0003c0003t0002g0342 a0003c0003t0003g0009 a0003c0003t0007g0047 a0003c0003t0007g0048 a0003c0003t0007g0081 a0003c0003t0009g0036 a0003c0003t0009g0061 a0003c0003t0012g0070 a0004c0004t0006g0204 a0004c0004t0006g0205 a0004c0004t0006g0208 a0006c0006t0006g0206 a0006c0006t0006g0207 a0010c0010t0003g0086	84	350	0.2400	1	c.119 others(5): Show c.1191dupT	p.Ile others(5): Show p.Ile398fs	GDPD4	ENSG00000178795.10	transcript	ENST00000315938.5	protein_coding	13/17	1526/2617	1191/1563	397/520		chr11	TogoVar
GEMIN7_chr19_45074260_45096518	45090407	A A	ATGTGGCC others(9): Show ATGTGGCCAACTTCTAC	frameshift_variant frameshift_variant	HIGH	NA18963.hp2 NA18963.hp2	a0002 a0002	a0002c0003 a0002c0003	a0002c0003t0001 a0002c0003t0001	a0002c0003t0001g0005 a0002c0003t0001g0005	1	420	0.0024	16	c.294 others(23): Show c.294_309dupTGTGGCCAACTTCTAC	p.Val others(5): Show p.Val104fs	GEMIN7	ENSG00000142252.11	transcript	ENST00000270257.9	protein_coding	3/3	559/1653	310/396	104/131	INFO_REALIGN_3_PRIME	chr19	TogoVar
GEMIN8_chrX_14001726_14034892	14008956	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0004 a0004	a0004c0004 a0004c0004	a0004c0004t0006 a0004c0004t0006	a0004c0004t0006g0099 a0004c0004t0006g0099	1	273	0.0037	1	c.685 others(4): Show c.685dupC	p.Arg others(5): Show p.Arg229fs	GEMIN8	ENSG00000046647.14	transcript	ENST00000680255.1	protein_coding	5/5	916/3147	685/729	229/242		chrX	TogoVar
GEMIN8_chrX_14001726_14034892	14008995	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0004 a0004	a0004c0004 a0004c0004	a0004c0004t0006 a0004c0004t0006	a0004c0004t0006g0099 a0004c0004t0006g0099	1	273	0.0037	1	c.646 others(4): Show c.646dupG	p.Glu others(5): Show p.Glu216fs	GEMIN8	ENSG00000046647.14	transcript	ENST00000680255.1	protein_coding	5/5	877/3147	646/729	216/242		chrX	TogoVar
GEMIN8_chrX_14001726_14034892	14009011	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0004 a0004	a0004c0004 a0004c0004	a0004c0004t0006 a0004c0004t0006	a0004c0004t0006g0099 a0004c0004t0006g0099	1	273	0.0037	1	c.630 others(4): Show c.630dupC	p.Lys others(5): Show p.Lys211fs	GEMIN8	ENSG00000046647.14	transcript	ENST00000680255.1	protein_coding	5/5	861/3147	630/729	210/242		chrX	TogoVar
GEMIN8_chrX_14001726_14034892	14009022	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0004 a0004	a0004c0004 a0004c0004	a0004c0004t0006 a0004c0004t0006	a0004c0004t0006g0099 a0004c0004t0006g0099	1	273	0.0037	1	c.619 others(4): Show c.619dupG	p.Asp others(5): Show p.Asp207fs	GEMIN8	ENSG00000046647.14	transcript	ENST00000680255.1	protein_coding	5/5	850/3147	619/729	207/242		chrX	TogoVar
GEMIN8_chrX_14001726_14034892	14009094	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0004 a0004	a0004c0004 a0004c0004	a0004c0004t0006 a0004c0004t0006	a0004c0004t0006g0099 a0004c0004t0006g0099	1	273	0.0037	1	c.547 others(4): Show c.547dupC	p.Arg others(5): Show p.Arg183fs	GEMIN8	ENSG00000046647.14	transcript	ENST00000680255.1	protein_coding	5/5	778/3147	547/729	183/242		chrX	TogoVar
GEMIN8_chrX_14001726_14034892	14009099	G G	GT GT	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0004 a0004	a0004c0004 a0004c0004	a0004c0004t0006 a0004c0004t0006	a0004c0004t0006g0099 a0004c0004t0006g0099	1	273	0.0037	1	c.542 others(4): Show c.542dupA	p.Asn others(5): Show p.Asn181fs	GEMIN8	ENSG00000046647.14	transcript	ENST00000680255.1	protein_coding	5/5	773/3147	542/729	181/242		chrX	TogoVar
GEN1_chr2_17749138_17793946	17781726	CAAGTT CAAGTT	C C	frameshift_variant frameshift_variant	HIGH	HG00408.hp1 HG00423.hp1 HG00438.hp2 others(27): Show HG00408.hp1 HG00423.hp1 HG00438.hp2 HG00558.hp1 HG00621.hp1 HG00642.hp1 HG00735.hp2 HG00738.hp1 HG00741.hp1 HG01074.hp1 HG01106.hp1 HG01175.hp2 HG01192.hp1 HG02015.hp1 HG02258.hp1 HG02602.hp2 HG03669.hp2 HG06807.hp1 NA18612.hp2 NA18939.hp1 NA18945.hp1 NA18952.hp2 NA18954.hp2 NA18964.hp2 NA18970.hp2 NA18982.hp2 NA18993.hp2 NA19010.hp2 NA19060.hp2 NA20805.hp1	a0004 a0004	a0004c0004 a0004c0004	a0004c0004t0001 a0004c0004t0023 a0004c0004t0039 a0004c0004t0001 a0004c0004t0023 a0004c0004t0039	a0004c0004t0001g0003 a0004c0004t0001g0006 a0004c0004t0001g0039 others(14): Show a0004c0004t0001g0003 a0004c0004t0001g0006 a0004c0004t0001g0039 a0004c0004t0001g0040 a0004c0004t0001g0041 a0004c0004t0001g0042 a0004c0004t0001g0192 a0004c0004t0001g0193 a0004c0004t0001g0194 a0004c0004t0001g0195 a0004c0004t0001g0196 a0004c0004t0001g0203 a0004c0004t0001g0204 a0004c0004t0001g0205 a0004c0004t0023g0144 a0004c0004t0023g0148 a0004c0004t0039g0042	30	318	0.0943	-5	c.251 others(14): Show c.2515_2519delAAGTT	p.Lys others(5): Show p.Lys839fs	GEN1	ENSG00000178295.15	transcript	ENST00000381254.7	protein_coding	14/14	2738/9957	2515/2727	839/908		chr2	TogoVar
GFER_chr16_1979193_1992749	1984463	GGACGCAG others(14): Show GGACGCAGCAGAAGGTGCAGTT	G G	frameshift_variant others(3): Show frameshift_variant splice_donor_variant splice_region_variant intron_variant	HIGH	NA19072.hp1 NA19072.hp1	a0003 a0003	a0003c0005 a0003c0005	a0003c0005t0001 a0003c0005t0001	a0003c0005t0001g0014 a0003c0005t0001g0014	1	426	0.0024	-21	c.246 others(30): Show c.246_258+8delGACGCAGCAGAAGGTGCAGTT	p.Thr others(4): Show p.Thr83fs	GFER	ENSG00000127554.13	transcript	ENST00000248114.7	protein_coding	1/3	272/2365	246/618	82/205		chr16	TogoVar
GFM1_chr3_158639527_158700581	158645635	TGGAAGGC others(4): Show TGGAAGGCCTGC	T T	frameshift_variant frameshift_variant	HIGH	HG02622.hp1 HG02622.hp1	a0005 a0005	a0005c0006 a0005c0006	a0005c0006t0011 a0005c0006t0011	a0005c0006t0011g0298 a0005c0006t0011g0298	1	372	0.0027	-11	c.89_ others(16): Show c.89_99delGGAAGGCCTGC	p.Trp others(4): Show p.Trp30fs	GFM1	ENSG00000168827.15	transcript	ENST00000486715.6	protein_coding	2/18	197/6478	89/2256	30/751		chr3	TogoVar
GFPT2_chr5_180295698_180358336	180316994	CATAGTAT others(3): Show CATAGTATTGA	C C	frameshift_variant frameshift_variant	HIGH	NA18997.hp1 NA18997.hp1	a0006 a0006	a0006c0016 a0006c0016	a0006c0016t0003 a0006c0016t0003	a0006c0016t0003g0063 a0006c0016t0003g0063	1	412	0.0024	-10	c.101 others(19): Show c.1013_1022delTCAATACTAT	p.Phe others(5): Show p.Phe338fs	GFPT2	ENSG00000131459.13	transcript	ENST00000253778.13	protein_coding	11/19	1141/3034	1013/2049	338/682		chr5	TogoVar
GGT6_chr17_4551927_4565577	4560398	G G	GGAGATAG others(3): Show GGAGATAGGGA	frameshift_variant frameshift_variant	HIGH	NA19083.hp1 NA19083.hp1	a0014 a0014	a0014c0023 a0014c0023	a0014c0023t0004 a0014c0023t0004	a0014c0023t0004g0053 a0014c0023t0004g0053	1	458	0.0022	10	c.123 others(17): Show c.123_124insTCCCTATCTC	p.His others(4): Show p.His42fs	GGT6	ENSG00000167741.11	transcript	ENST00000381550.8	protein_coding	1/4	179/2644	123/1500	41/499		chr17	TogoVar
GHRHR_chr7_30958953_30984528	30971149	TACACCGT others(4): Show TACACCGTGGGC	T T	frameshift_variant frameshift_variant	HIGH	NA18951.hp1 NA18951.hp1	a0010 a0010	a0010c0016 a0010c0016	a0010c0016t0001 a0010c0016t0001	a0010c0016t0001g0071 a0010c0016t0001g0071	1	422	0.0024	-11	c.398 others(18): Show c.398_408delACACCGTGGGC	p.Tyr others(5): Show p.Tyr133fs	GHRHR	ENSG00000106128.19	transcript	ENST00000326139.7	protein_coding	5/13	514/1672	398/1272	133/423		chr7	TogoVar
GIMAP8_chr7_150445630_150484393	150474433	T T	TTTAGGGG others(9): Show TTTAGGGGATCAGGATC	frameshift_variant frameshift_variant	HIGH	NA18981.hp1 NA18981.hp1	a0008 a0008	a0008c0018 a0008c0018	a0008c0018t0001 a0008c0018t0001	a0008c0018t0001g0171 a0008c0018t0001g0171	1	372	0.0027	16	c.110 others(25): Show c.1106_1121dupTAGGGGATCAGGATCT	p.Asp others(5): Show p.Asp375fs	GIMAP8	ENSG00000171115.4	transcript	ENST00000307271.4	protein_coding	4/5	1696/4185	1122/1998	374/665	INFO_REALIGN_3_PRIME	chr7	TogoVar
GJA4_chr1_34787999_34800747	34794548	A A	AGCTGCGG others(15): Show AGCTGCGGGCACTGCCGGCCAAG	frameshift_variant frameshift_variant	HIGH	HG01258.hp2 HG01258.hp2	a0007 a0007	a0007c0014 a0007c0014	a0007c0014t0002 a0007c0014t0002	a0007c0014t0002g0002 a0007c0014t0002g0002	1	416	0.0024	22	c.337 others(29): Show c.337_358dupCTGCGGGCACTGCCGGCCAAGG	p.Asp others(5): Show p.Asp120fs	GJA4	ENSG00000187513.9	transcript	ENST00000342280.5	protein_coding	2/2	446/1621	359/1002	120/333	INFO_REALIGN_3_PRIME	chr1	TogoVar
GJB1_chrX_71218224_71230516	71224045	A A	AC AC	frameshift_variant frameshift_variant	HIGH	HG00438.hp1 HG00438.hp1	a0003 a0003	a0003c0003 a0003c0003	a0003c0003t0001 a0003c0003t0001	a0003c0003t0001g0001 a0003c0003t0001g0001	1	328	0.0031	1	c.343 others(4): Show c.343dupC	p.Leu others(5): Show p.Leu115fs	GJB1	ENSG00000169562.13	transcript	ENST00000361726.7	protein_coding	2/2	472/1937	344/852	115/283	INFO_REALIGN_3_PRIME	chrX	TogoVar
GJB2_chr13_20182470_20197938	20188894	CAATGCGT others(3): Show CAATGCGTTAA	C C	frameshift_variant others(1): Show frameshift_variant stop_lost	HIGH	NA18989.hp1 NA18989.hp1	a0000 a0000	a0000c0011 a0000c0011	a0000c0011t0020 a0000c0011t0020	a0000c0011t0020g0042 a0000c0011t0020g0042	1	420	0.0024	-10	c.678 others(16): Show c.678_*6delTTAACGCATT	p.Val others(5): Show p.Val226fs	GJB2	ENSG00000165474.8	transcript	ENST00000382848.5	protein_coding	2/2	865/2290	678/681	226/226		chr13	TogoVar
GJB4_chr1_34754740_34767327	34761404	CT CT	C C	frameshift_variant frameshift_variant	HIGH	HG01109.hp1 HG02258.hp1 HG02647.hp1 others(7): Show HG01109.hp1 HG02258.hp1 HG02647.hp1 HG02886.hp2 HG02922.hp1 HG03041.hp1 HG03130.hp2 HG03195.hp2 HG03516.hp2 HG06807.hp1	a0005 a0005	a0005c0006 a0005c0008 a0005c0009 a0005c0006 a0005c0008 a0005c0009	a0005c0006t0001 a0005c0006t0004 a0005c0008t0001 others(1): Show a0005c0006t0001 a0005c0006t0004 a0005c0008t0001 a0005c0009t0001	a0005c0006t0001g0002 a0005c0006t0004g0002 a0005c0008t0001g0002 others(1): Show a0005c0006t0001g0002 a0005c0006t0004g0002 a0005c0008t0001g0002 a0005c0009t0001g0002	10	462	0.0217	-1	c.153 others(4): Show c.153delT	p.Phe others(4): Show p.Phe51fs	GJB4	ENSG00000189433.7	transcript	ENST00000339480.3	protein_coding	2/2	524/1444	153/801	51/266	INFO_REALIGN_3_PRIME	chr1	TogoVar
GJC2_chr1_228144930_228164826	228158838	C C	CG CG	frameshift_variant frameshift_variant	HIGH	HG00408.hp1 HG00738.hp2 HG01261.hp1 others(5): Show HG00408.hp1 HG00738.hp2 HG01261.hp1 HG01433.hp2 HG02135.hp2 HG03927.hp1 NA18985.hp1 NA18988.hp2	a0000 a0000	a0000c0003 a0000c0011 a0000c0003 a0000c0011	a0000c0003t0001 a0000c0011t0002 a0000c0003t0001 a0000c0011t0002	a0000c0003t0001g0001 a0000c0003t0001g0002 a0000c0003t0001g0003 others(4): Show a0000c0003t0001g0001 a0000c0003t0001g0002 a0000c0003t0001g0003 a0000c0003t0001g0064 a0000c0003t0001g0083 a0000c0003t0001g0084 a0000c0011t0002g0029	8	414	0.0193	1	c.108 others(5): Show c.1084dupG	p.Ala others(5): Show p.Ala362fs	GJC2	ENSG00000198835.4	transcript	ENST00000366714.3	protein_coding	2/2	1182/2165	1085/1320	362/439	INFO_REALIGN_3_PRIME	chr1	TogoVar
GK3_chr4_165272807_165284704	165279117	T T	TTTGGACA others(7): Show TTTGGACAGGAGGCG	frameshift_variant frameshift_variant	HIGH	NA19063.hp2 NA19063.hp2	a0009 a0009	a0009c0025 a0009c0025	a0009c0025t0001 a0009c0025t0001	a0009c0025t0001g0000 a0009c0025t0001g0000	1	384	0.0026	14	c.528 others(21): Show c.528_529insCGCCTCCTGTCCAA	p.Thr others(5): Show p.Thr177fs	GK3	ENSG00000229894.5	transcript	ENST00000505354.3	protein_coding	1/1	587/1898	528/1662	176/553		chr4	TogoVar
GLA_chrX_101392803_101412925	101397932	AG AG	A A	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0002 a0002	a0002c0003 a0002c0003	a0002c0003t0001 a0002c0003t0001	a0002c0003t0001g0091 a0002c0003t0001g0091	1	318	0.0031	-1	c.116 others(5): Show c.1166delC	p.Pro others(5): Show p.Pro389fs	GLA	ENSG00000102393.15	transcript	ENST00000218516.4	protein_coding	7/7	1188/1318	1166/1290	389/429		chrX	TogoVar
GLA_chrX_101392803_101412925	101398077	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0002 a0002	a0002c0003 a0002c0003	a0002c0003t0001 a0002c0003t0001	a0002c0003t0001g0091 a0002c0003t0001g0091	1	318	0.0031	1	c.102 others(5): Show c.1021dupG	p.Glu others(5): Show p.Glu341fs	GLA	ENSG00000102393.15	transcript	ENST00000218516.4	protein_coding	7/7	1043/1318	1021/1290	341/429		chrX	TogoVar

Search by Variant

Search

Search Results (Total: 5828 hits)