Joint Open Genome and Omics Platform (JoGo)

Search by Variant

Regionname

e.g. ALDH2_chr12_111761933_111822532, HBB_chr11_5220464_5232071.

Chr

Chromosome name (e.g., chr11).

Snpeff genename

Exact SnpEff gene name.

Sampleids

Target sampleid (e.g. HG02615).

Snpeff haplotype class

Haplotype-annotation class (e.g., ahapid, ahapid+chapid).

Snpeff annotation impact

Exact impact level (e.g., HIGH, MODERATE, LOW).

Snpeff annotation impact detail

Keyword match in SnpEff annotation.

Hapid

One or more haplotype IDs (comma-separated; e.g., a0001, a01, a0001c0001, a01c02, a1c2, a0001c0001t0005, a0001c0001t0005g0018).

Samplehapid

Sample haplotype IDs to include (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

No_hapid

Haplotype IDs to exclude (comma-separated; e.g., a0001, a0002, a0001c0001, a0001c0001t0005, a1, a01).

No_samplehapid

Sample haplotype IDs to exclude (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

Start

Start position (GRCh38).

End

End position (GRCh38).

Minac

Minimum alternate allele count (≥).

Maxac

Maximum alternate allele count (≤).

Minlen

Minimum variant length (≥).

Maxlen

Maximum variant length (≤).

Sort By

Select column to sort.

Order by

Ascending or descending.

Show

Results per page.

regionname	pos	ref	alt	annotation	impact	samples	ahapids	achapids	acthapids	actghapids	ac	an	af	len	hgvs_c	hgvs_p	genename	geneid	featuretype	featureid	transcript_biotype	rank	cdna cdna pos length	cds cds pos length	aa aa pos length	status	chr	external
GPRASP3_chrX_102715743_102758540	102750218	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA18998.hp1 NA18998.hp1	a0003 a0003	a0003c0005 a0003c0005	a0003c0005t0028 a0003c0005t0028	a0003c0005t0028g0147 a0003c0005t0028g0147	1	278	0.0036	1	c.122 others(5): Show c.1224dupG	p.Cys others(5): Show p.Cys409fs	GPRASP3	ENSG00000198908.12	transcript	ENST00000457056.6	protein_coding	4/4	1835/5155	1225/1644	409/547	INFO_REALIGN_3_PRIME	chrX	TogoVar
GREB1_chr2_11529045_11647788	11638660	TTCTTTTT others(34): Show TTCTTTTTCAGATTTCTGTTTGCTATGTGAGCTCCAGGCCCC	T T	frameshift_variant others(3): Show frameshift_variant splice_acceptor_variant splice_region_variant intron_variant	HIGH	HG01175.hp1 HG01175.hp1	a0040 a0040	a0040c0072 a0040c0072	a0040c0072t0058 a0040c0072t0058	a0040c0072t0058g0111 a0040c0072t0058g0111	1	308	0.0033	-41	c.554 others(53): Show c.5548-10_5578delTCTTTTTCAGATTTCTGTTTGCTATGTGAGCTC CAGGCCCC	p.Ile others(6): Show p.Ile1850fs	GREB1	ENSG00000196208.14	transcript	ENST00000381486.7	protein_coding	32/33		5548/5850	1850/1949		chr2	TogoVar
GRIA3_chrX_123179278_123495915	123184594	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA18968.hp2 NA18968.hp2	a0002 a0002	a0002c0004 a0002c0004	a0002c0004t0002 a0002c0004t0002	a0002c0004t0002g0001 a0002c0004t0002g0001	1	207	0.0048	-1	c.63d others(3): Show c.63delG	p.Leu others(4): Show p.Leu22fs	GRIA3	ENSG00000125675.20	transcript	ENST00000620443.2	protein_coding	1/16	321/5148	63/2685	21/894	INFO_REALIGN_3_PRIME	chrX	TogoVar
GRIA3_chrX_123179278_123495915	123185915	AC AC	A A	frameshift_variant frameshift_variant	HIGH	NA18968.hp2 NA18968.hp2	a0002 a0002	a0002c0004 a0002c0004	a0002c0004t0002 a0002c0004t0002	a0002c0004t0002g0001 a0002c0004t0002g0001	1	207	0.0048	-1	c.195 others(4): Show c.195delC	p.Glu others(4): Show p.Glu66fs	GRIA3	ENSG00000125675.20	transcript	ENST00000620443.2	protein_coding	2/16	453/5148	195/2685	65/894	INFO_REALIGN_3_PRIME	chrX	TogoVar
GRIN2C_chr17_74837023_74864885	74842676	TGGGCGTG others(4): Show TGGGCGTGCAGG	T T	frameshift_variant frameshift_variant	HIGH	NA18962.hp2 NA18962.hp2	a0020 a0020	a0020c0026 a0020c0026	a0020c0026t0001 a0020c0026t0001	a0020c0026t0001g0146 a0020c0026t0001g0146	1	360	0.0028	-11	c.345 others(20): Show c.3450_3460delCCTGCACGCCC	p.Cys others(6): Show p.Cys1150fs	GRIN2C	ENSG00000161509.14	transcript	ENST00000293190.10	protein_coding	13/13	3617/4271	3450/3702	1150/1233		chr17	TogoVar
GRIN2C_chr17_74837023_74864885	74842991	A A	AGCTCCGG others(3): Show AGCTCCGGGGG	frameshift_variant frameshift_variant	HIGH	NA18955.hp2 NA18955.hp2	a0000 a0000	a0000c0029 a0000c0029	a0000c0029t0001 a0000c0029t0001	a0000c0029t0001g0051 a0000c0029t0001g0051	1	360	0.0028	10	c.314 others(19): Show c.3145_3146insCCCCCGGAGC	p.Leu others(6): Show p.Leu1049fs	GRIN2C	ENSG00000161509.14	transcript	ENST00000293190.10	protein_coding	13/13	3302/4271	3145/3702	1049/1233		chr17	TogoVar
GRIN2C_chr17_74837023_74864885	74850237	A A	AC AC	frameshift_variant frameshift_variant	HIGH	HG00408.hp2 HG00673.hp1 HG01099.hp2 others(14): Show HG00408.hp2 HG00673.hp1 HG01099.hp2 HG01106.hp1 HG01175.hp2 HG01433.hp1 HG01433.hp2 HG02071.hp2 HG02572.hp1 HG02602.hp2 HG03654.hp1 HG03669.hp2 HG04204.hp2 NA18949.hp1 NA18980.hp2 NA19030.hp1 NA19087.hp2	a0004 a0004	a0004c0005 a0004c0007 a0004c0010 others(2): Show a0004c0005 a0004c0007 a0004c0010 a0004c0023 a0004c0034	a0004c0005t0001 a0004c0007t0001 a0004c0010t0001 others(2): Show a0004c0005t0001 a0004c0007t0001 a0004c0010t0001 a0004c0023t0001 a0004c0034t0001	a0004c0005t0001g0022 a0004c0005t0001g0121 a0004c0005t0001g0134 others(12): Show a0004c0005t0001g0022 a0004c0005t0001g0121 a0004c0005t0001g0134 a0004c0005t0001g0135 a0004c0005t0001g0136 a0004c0007t0001g0050 a0004c0007t0001g0059 a0004c0007t0001g0060 a0004c0007t0001g0061 a0004c0010t0001g0080 a0004c0010t0001g0090 a0004c0010t0001g0098 a0004c0010t0001g0100 a0004c0023t0001g0155 a0004c0034t0001g0089	17	360	0.0472	1	c.145 others(5): Show c.1459dupG	p.Val others(5): Show p.Val487fs	GRIN2C	ENSG00000161509.14	transcript	ENST00000293190.10	protein_coding	6/13	1616/4271	1459/3702	487/1233		chr17	TogoVar
GRIN2C_chr17_74837023_74864885	74850238	C C	CA CA	frameshift_variant frameshift_variant	HIGH	HG01109.hp2 NA18944.hp2 NA18966.hp1 others(2): Show HG01109.hp2 NA18944.hp2 NA18966.hp1 NA18997.hp1 NA19057.hp1	a0006 a0006	a0006c0016 a0006c0031 a0006c0033 others(1): Show a0006c0016 a0006c0031 a0006c0033 a0006c0035	a0006c0016t0001 a0006c0031t0001 a0006c0033t0001 others(1): Show a0006c0016t0001 a0006c0031t0001 a0006c0033t0001 a0006c0035t0001	a0006c0016t0001g0151 a0006c0016t0001g0152 a0006c0031t0001g0150 others(2): Show a0006c0016t0001g0151 a0006c0016t0001g0152 a0006c0031t0001g0150 a0006c0033t0001g0045 a0006c0035t0001g0088	5	360	0.0139	1	c.145 others(10): Show c.1458_1459insT	p.Val others(5): Show p.Val487fs	GRIN2C	ENSG00000161509.14	transcript	ENST00000293190.10	protein_coding	6/13	1615/4271	1458/3702	486/1233		chr17	TogoVar
GRIN3B_chr19_995419_1014732	1004897	G G	GCGTT GCGTT	frameshift_variant frameshift_variant	HIGH	HG00642.hp2 HG00741.hp2 HG01069.hp1 others(55): Show HG00642.hp2 HG00741.hp2 HG01069.hp1 HG01074.hp1 HG01074.hp2 HG01081.hp2 HG01099.hp1 HG01168.hp1 HG01256.hp2 HG01257.hp1 HG01258.hp2 HG01261.hp2 HG01361.hp1 HG01515.hp1 HG01515.hp2 HG01517.hp1 HG01928.hp1 HG01934.hp2 HG01975.hp2 HG01981.hp1 HG02056.hp2 HG02135.hp1 HG02451.hp1 HG02602.hp2 HG02630.hp1 HG02647.hp1 HG02738.hp2 HG02895.hp1 HG02965.hp1 HG03195.hp1 HG03225.hp2 HG03453.hp2 HG03471.hp2 HG03490.hp2 HG03579.hp2 HG03669.hp1 HG03688.hp1 HG03834.hp2 HG03942.hp1 HG04184.hp2 HG04204.hp1 HG04204.hp2 HG06807.hp1 HG06807.hp2 NA18944.hp1 NA18947.hp1 NA18953.hp2 NA18982.hp2 NA18985.hp2 NA18990.hp2 NA18993.hp1 NA19030.hp1 NA19065.hp1 NA19067.hp1 NA19089.hp2 NA20300.hp2 NA21309.hp1 NA21309.hp2	a0003 a0010 a0023 others(6): Show a0003 a0010 a0023 a0034 a0058 a0070 a0091 a0092 a0103	a0003c0005 a0003c0025 a0003c0026 others(21): Show a0003c0005 a0003c0025 a0003c0026 a0003c0027 a0003c0028 a0003c0038 a0003c0039 a0003c0068 a0003c0069 a0003c0070 a0003c0071 a0003c0072 a0003c0073 a0010c0023 a0010c0054 a0010c0057 a0010c0142 a0023c0033 a0034c0050 a0058c0100 a0070c0139 a0091c0080 a0092c0060 a0103c0091	a0003c0005t0002 a0003c0025t0002 a0003c0026t0002 others(21): Show a0003c0005t0002 a0003c0025t0002 a0003c0026t0002 a0003c0027t0002 a0003c0028t0002 a0003c0038t0002 a0003c0039t0002 a0003c0068t0002 a0003c0069t0002 a0003c0070t0002 a0003c0071t0002 a0003c0072t0002 a0003c0073t0002 a0010c0023t0001 a0010c0054t0001 a0010c0057t0002 a0010c0142t0003 a0023c0033t0002 a0034c0050t0001 a0058c0100t0001 a0070c0139t0003 a0091c0080t0004 a0092c0060t0002 a0103c0091t0001	a0003c0005t0002g0006 a0003c0005t0002g0017 a0003c0005t0002g0047 others(35): Show a0003c0005t0002g0006 a0003c0005t0002g0017 a0003c0005t0002g0047 a0003c0005t0002g0067 a0003c0005t0002g0075 a0003c0005t0002g0087 a0003c0005t0002g0088 a0003c0005t0002g0092 a0003c0025t0002g0006 a0003c0025t0002g0095 a0003c0026t0002g0006 a0003c0026t0002g0091 a0003c0026t0002g0100 a0003c0027t0002g0006 a0003c0027t0002g0047 a0003c0028t0002g0012 a0003c0028t0002g0094 a0003c0038t0002g0012 a0003c0039t0002g0046 a0003c0068t0002g0086 a0003c0069t0002g0017 a0003c0070t0002g0093 a0003c0071t0002g0012 a0003c0072t0002g0090 a0003c0073t0002g0089 a0010c0023t0001g0034 a0010c0023t0001g0144 a0010c0054t0001g0057 a0010c0057t0002g0068 a0010c0142t0003g0163 a0023c0033t0002g0029 a0034c0050t0001g0114 a0034c0050t0001g0115 a0058c0100t0001g0169 a0070c0139t0003g0165 a0091c0080t0004g0085 a0092c0060t0002g0006 a0103c0091t0001g0194	58	446	0.1300	4	c.139 others(13): Show c.1396_1397insCGTT	p.Gly others(5): Show p.Gly466fs	GRIN3B	ENSG00000116032.5	transcript	ENST00000234389.3	protein_coding	3/9	1416/3281	1397/3132	466/1043		chr19	TogoVar
GRIPAP1_chrX_48968723_49007264	48976023	CG CG	C C	frameshift_variant frameshift_variant	HIGH	NA19058.hp1 NA19058.hp1	a0006 a0006	a0006c0010 a0006c0010	a0006c0010t0004 a0006c0010t0004	a0006c0010t0004g0187 a0006c0010t0004g0187	1	297	0.0034	-1	c.227 others(5): Show c.2272delC	p.Arg others(5): Show p.Arg758fs	GRIPAP1	ENSG00000068400.14	transcript	ENST00000376423.8	protein_coding	24/26	2307/3031	2272/2526	758/841		chrX	TogoVar
GRIPAP1_chrX_48968723_49007264	48985275	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19055.hp1 NA19055.hp1	a0008 a0008	a0008c0013 a0008c0013	a0008c0013t0001 a0008c0013t0001	a0008c0013t0001g0072 a0008c0013t0001g0072	1	297	0.0034	-1	c.116 others(5): Show c.1168delC	p.Gln others(5): Show p.Gln390fs	GRIPAP1	ENSG00000068400.14	transcript	ENST00000376423.8	protein_coding	14/26	1203/3031	1168/2526	390/841		chrX	TogoVar
GRIPAP1_chrX_48968723_49007264	48989660	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA18946.hp1 NA18946.hp1	a0009 a0009	a0009c0007 a0009c0007	a0009c0007t0001 a0009c0007t0001	a0009c0007t0001g0066 a0009c0007t0001g0066	1	297	0.0034	-1	c.820 others(4): Show c.820delC	p.Gln others(5): Show p.Gln274fs	GRIPAP1	ENSG00000068400.14	transcript	ENST00000376423.8	protein_coding	11/26	855/3031	820/2526	274/841		chrX	TogoVar
GRIPAP1_chrX_48968723_49007264	48998159	C C	CT CT	frameshift_variant frameshift_variant	HIGH	NA18985.hp1 NA18985.hp1	a0011 a0011	a0011c0006 a0011c0006	a0011c0006t0001 a0011c0006t0001	a0011c0006t0001g0021 a0011c0006t0001g0021	1	297	0.0034	1	c.192 others(4): Show c.192dupA	p.Ala others(4): Show p.Ala65fs	GRIPAP1	ENSG00000068400.14	transcript	ENST00000376423.8	protein_coding	4/26	227/3031	192/2526	64/841		chrX	TogoVar
GRIPAP1_chrX_48968723_49007264	48999485	CG CG	C C	frameshift_variant frameshift_variant	HIGH	NA19072.hp1 NA19072.hp1	a0003 a0003	a0003c0015 a0003c0015	a0003c0015t0001 a0003c0015t0001	a0003c0015t0001g0276 a0003c0015t0001g0276	1	297	0.0034	-1	c.61d others(3): Show c.61delC	p.Arg others(4): Show p.Arg21fs	GRIPAP1	ENSG00000068400.14	transcript	ENST00000376423.8	protein_coding	2/26	96/3031	61/2526	21/841		chrX	TogoVar
GSE1_chr16_85608322_85681200	85654328	G G	GC GC	frameshift_variant frameshift_variant	HIGH	HG00639.hp2 HG01978.hp1 HG02027.hp1 others(5): Show HG00639.hp2 HG01978.hp1 HG02027.hp1 HG04184.hp2 HG04199.hp1 NA18950.hp1 NA19043.hp1 NA20300.hp1	a0003 a0012 a0013 a0003 a0012 a0013	a0003c0009 a0003c0010 a0012c0023 others(1): Show a0003c0009 a0003c0010 a0012c0023 a0013c0022	a0003c0009t0002 a0003c0009t0005 a0003c0009t0050 others(5): Show a0003c0009t0002 a0003c0009t0005 a0003c0009t0050 a0003c0010t0002 a0003c0010t0004 a0003c0010t0016 a0012c0023t0001 a0013c0022t0030	a0003c0009t0002g0109 a0003c0009t0005g0244 a0003c0009t0050g0134 others(5): Show a0003c0009t0002g0109 a0003c0009t0005g0244 a0003c0009t0050g0134 a0003c0010t0002g0110 a0003c0010t0004g0008 a0003c0010t0016g0067 a0012c0023t0001g0175 a0013c0022t0030g0072	8	290	0.0276	1	c.482 others(4): Show c.482dupC	p.Leu others(5): Show p.Leu162fs	GSE1	ENSG00000131149.19	transcript	ENST00000253458.12	protein_coding	4/16	553/7385	483/3654	161/1217	INFO_REALIGN_3_PRIME	chr16	TogoVar
GSE1_chr16_85608322_85681200	85657287	G G	GGATGCCG others(4): Show GGATGCCGGCCT	frameshift_variant frameshift_variant	HIGH	NA19090.hp2 NA19090.hp2	a0016 a0016	a0016c0029 a0016c0029	a0016c0029t0003 a0016c0029t0003	a0016c0029t0003g0100 a0016c0029t0003g0100	1	290	0.0035	11	c.132 others(20): Show c.1325_1335dupATGCCGGCCTG	p.Gln others(5): Show p.Gln446fs	GSE1	ENSG00000131149.19	transcript	ENST00000253458.12	protein_coding	8/16	1406/7385	1336/3654	446/1217	INFO_REALIGN_3_PRIME	chr16	TogoVar
GSG1L2_chr17_9795608_9827079	9808880	A A	AACCCAGG others(3): Show AACCCAGGGCT	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA18949.hp1 NA18949.hp1	a0008 a0008	a0008c0019 a0008c0019	a0008c0019t0016 a0008c0019t0016	a0008c0019t0016g0434 a0008c0019t0016g0434	1	474	0.0021	10	c.451 others(17): Show c.451_460dupAGCCCTGGGT	p.Phe others(5): Show p.Phe154fs	GSG1L2	ENSG00000214978.8	transcript	ENST00000399363.5	protein_coding	3/5	468/2668	460/882	154/293		chr17	TogoVar
GSPT2_chrX_51738442_51751232	51743716	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0003 a0003	a0003c0008 a0003c0008	a0003c0008t0004 a0003c0008t0004	a0003c0008t0004g0000 a0003c0008t0004g0000	1	312	0.0032	1	c.92d others(3): Show c.92dupG	p.Val others(4): Show p.Val32fs	GSPT2	ENSG00000189369.9	transcript	ENST00000340438.6	protein_coding	1/1	278/2791	93/1887	31/628	INFO_REALIGN_3_PRIME	chrX	TogoVar
GSPT2_chrX_51738442_51751232	51743984	TCGCTTGA others(7): Show TCGCTTGAAGGTTCC	T T	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0003 a0003	a0003c0008 a0003c0008	a0003c0008t0004 a0003c0008t0004	a0003c0008t0004g0000 a0003c0008t0004g0000	1	312	0.0032	-14	c.359 others(21): Show c.359_372delCGCTTGAAGGTTCC	p.Ser others(5): Show p.Ser120fs	GSPT2	ENSG00000189369.9	transcript	ENST00000340438.6	protein_coding	1/1	544/2791	359/1887	120/628		chrX	TogoVar
GSPT2_chrX_51738442_51751232	51744026	GA GA	G G	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0003 a0003	a0003c0008 a0003c0008	a0003c0008t0004 a0003c0008t0004	a0003c0008t0004g0000 a0003c0008t0004g0000	1	312	0.0032	-1	c.402 others(4): Show c.402delA	p.Glu others(5): Show p.Glu134fs	GSPT2	ENSG00000189369.9	transcript	ENST00000340438.6	protein_coding	1/1	587/2791	402/1887	134/628	INFO_REALIGN_3_PRIME	chrX	TogoVar
GSPT2_chrX_51738442_51751232	51744168	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0003 a0003	a0003c0008 a0003c0008	a0003c0008t0004 a0003c0008t0004	a0003c0008t0004g0000 a0003c0008t0004g0000	1	312	0.0032	1	c.544 others(4): Show c.544dupG	p.Glu others(5): Show p.Glu182fs	GSPT2	ENSG00000189369.9	transcript	ENST00000340438.6	protein_coding	1/1	730/2791	545/1887	182/628	INFO_REALIGN_3_PRIME	chrX	TogoVar
GSPT2_chrX_51738442_51751232	51744186	GA GA	G G	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0003 a0003	a0003c0008 a0003c0008	a0003c0008t0004 a0003c0008t0004	a0003c0008t0004g0000 a0003c0008t0004g0000	1	312	0.0032	-1	c.564 others(4): Show c.564delA	p.Lys others(5): Show p.Lys188fs	GSPT2	ENSG00000189369.9	transcript	ENST00000340438.6	protein_coding	1/1	749/2791	564/1887	188/628	INFO_REALIGN_3_PRIME	chrX	TogoVar
GSPT2_chrX_51738442_51751232	51744207	T T	TAATACAA others(7): Show TAATACAAGTAAACA	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0003 a0003	a0003c0008 a0003c0008	a0003c0008t0004 a0003c0008t0004	a0003c0008t0004g0000 a0003c0008t0004g0000	1	312	0.0032	14	c.582 others(21): Show c.582_583insATACAAGTAAACAA	p.Pro others(5): Show p.Pro195fs	GSPT2	ENSG00000189369.9	transcript	ENST00000340438.6	protein_coding	1/1	768/2791	583/1887	195/628	INFO_REALIGN_3_PRIME	chrX	TogoVar
GSPT2_chrX_51738442_51751232	51744424	T T	TA TA	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0003 a0003	a0003c0008 a0003c0008	a0003c0008t0004 a0003c0008t0004	a0003c0008t0004g0000 a0003c0008t0004g0000	1	312	0.0032	1	c.802 others(4): Show c.802dupA	p.Thr others(5): Show p.Thr268fs	GSPT2	ENSG00000189369.9	transcript	ENST00000340438.6	protein_coding	1/1	988/2791	803/1887	268/628	INFO_REALIGN_3_PRIME	chrX	TogoVar
GSPT2_chrX_51738442_51751232	51744521	A A	AT AT	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0003 a0003	a0003c0008 a0003c0008	a0003c0008t0004 a0003c0008t0004	a0003c0008t0004g0000 a0003c0008t0004g0000	1	312	0.0032	1	c.897 others(4): Show c.897dupT	p.Gly others(5): Show p.Gly300fs	GSPT2	ENSG00000189369.9	transcript	ENST00000340438.6	protein_coding	1/1	1083/2791	898/1887	300/628	INFO_REALIGN_3_PRIME	chrX	TogoVar
GSPT2_chrX_51738442_51751232	51745312	CA CA	C C	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0003 a0003	a0003c0008 a0003c0008	a0003c0008t0004 a0003c0008t0004	a0003c0008t0004g0000 a0003c0008t0004g0000	1	312	0.0032	-1	c.169 others(5): Show c.1692delA	p.Lys others(5): Show p.Lys564fs	GSPT2	ENSG00000189369.9	transcript	ENST00000340438.6	protein_coding	1/1	1877/2791	1692/1887	564/628	INFO_REALIGN_3_PRIME	chrX	TogoVar
GSTO1_chr10_104249892_104272455	104263071	AGAG AGAG	A A	frameshift_variant others(3): Show frameshift_variant splice_donor_variant splice_region_variant intron_variant	HIGH	HG00738.hp1 HG01069.hp2 HG01071.hp2 others(15): Show HG00738.hp1 HG01069.hp2 HG01071.hp2 HG01167.hp2 HG02055.hp2 HG02155.hp1 HG02559.hp2 HG02602.hp2 HG03491.hp2 HG03688.hp2 HG03831.hp1 HG04228.hp2 NA18747.hp2 NA18948.hp1 NA18997.hp1 NA19056.hp2 NA19240.hp1 NA21309.hp1	a0003 a0003	a0003c0003 a0003c0003	a0003c0003t0001 a0003c0003t0001	a0003c0003t0001g0004 a0003c0003t0001g0071 a0003c0003t0001g0081 a0003c0003t0001g0004 a0003c0003t0001g0071 a0003c0003t0001g0081	18	378	0.0476	-3	c.464 others(12): Show c.464_465+1delAGG	p.Glu others(5): Show p.Glu155fs	GSTO1	ENSG00000148834.13	transcript	ENST00000369713.10	protein_coding	4/6	501/813	464/726	155/241	INFO_REALIGN_3_PRIME	chr10	TogoVar
GTF2A2_chr15_59633062_59662515	59639131	T T	TTCATTCT others(6): Show TTCATTCTGTAGTA	frameshift_variant frameshift_variant	HIGH	HG03195.hp2 HG03195.hp2	a0001 a0001	a0001c0002 a0001c0002	a0001c0002t0003 a0001c0002t0003	a0001c0002t0003g0227 a0001c0002t0003g0227	1	436	0.0023	13	c.318 others(20): Show c.318_330dupTACTACAGAATGA	p.Ter others(5): Show p.Ter110fs	GTF2A2	ENSG00000140307.11	transcript	ENST00000396060.7	protein_coding	5/5	489/1559	330/330	110/109		chr15	TogoVar
GTF2IRD1_chr7_74448906_74607605	74515481	G G	GAAGGGTG others(9): Show GAAGGGTGCAGCGGGGC	frameshift_variant frameshift_variant	HIGH	NA18939.hp1 NA18939.hp1	a0004 a0004	a0004c0013 a0004c0013	a0004c0013t0001 a0004c0013t0001	a0004c0013t0001g0045 a0004c0013t0001g0045	1	262	0.0038	16	c.310 others(23): Show c.310_311insGTGCAGCGGGGCAAGG	p.Val others(5): Show p.Val104fs	GTF2IRD1	ENSG00000006704.11	transcript	ENST00000424337.7	protein_coding	4/27	588/3284	311/2835	104/944	INFO_REALIGN_3_PRIME	chr7	TogoVar
GTPBP3_chr19_17332553_17347731	17341646	A A	AG AG	frameshift_variant frameshift_variant	HIGH	HG00423.hp1 HG00558.hp2 HG01099.hp2 others(46): Show HG00423.hp1 HG00558.hp2 HG01099.hp2 HG01192.hp1 HG01192.hp2 HG01261.hp1 HG01346.hp2 HG01928.hp1 HG01975.hp1 HG01975.hp2 HG01978.hp2 HG02027.hp1 HG02486.hp2 HG02523.hp1 HG02559.hp2 HG02602.hp2 HG02622.hp1 HG02738.hp1 HG02809.hp2 HG02896.hp1 HG02896.hp2 HG02970.hp1 HG03098.hp1 HG03098.hp2 HG03209.hp2 HG03239.hp1 HG03486.hp2 HG03492.hp1 HG03927.hp1 HG04199.hp1 NA18946.hp1 NA18951.hp1 NA18960.hp2 NA18961.hp1 NA18963.hp1 NA18964.hp2 NA18977.hp2 NA18981.hp1 NA18985.hp1 NA18986.hp1 NA18997.hp1 NA18997.hp2 NA18998.hp2 NA19011.hp1 NA19057.hp1 NA19068.hp1 NA19085.hp2 NA19090.hp2 NA20805.hp2	a0000 a0000	a0000c0004 a0000c0005 a0000c0007 others(1): Show a0000c0004 a0000c0005 a0000c0007 a0000c0020	a0000c0004t0001 a0000c0004t0002 a0000c0004t0005 others(7): Show a0000c0004t0001 a0000c0004t0002 a0000c0004t0005 a0000c0005t0001 a0000c0005t0002 a0000c0005t0003 a0000c0005t0007 a0000c0005t0015 a0000c0007t0001 a0000c0020t0002	a0000c0004t0001g0006 a0000c0004t0001g0007 a0000c0004t0001g0019 others(19): Show a0000c0004t0001g0006 a0000c0004t0001g0007 a0000c0004t0001g0019 a0000c0004t0001g0042 a0000c0004t0002g0002 a0000c0004t0002g0004 a0000c0004t0002g0006 a0000c0004t0002g0010 a0000c0004t0002g0017 a0000c0004t0002g0035 a0000c0004t0002g0046 a0000c0004t0005g0026 a0000c0005t0001g0001 a0000c0005t0001g0013 a0000c0005t0002g0003 a0000c0005t0002g0011 a0000c0005t0003g0005 a0000c0005t0003g0014 a0000c0005t0007g0011 a0000c0005t0015g0005 a0000c0007t0001g0001 a0000c0020t0002g0003	49	408	0.1201	1	c.142 others(5): Show c.1427dupG	p.Thr others(5): Show p.Thr477fs	GTPBP3	ENSG00000130299.17	transcript	ENST00000324894.13	protein_coding	9/9	1487/2566	1428/1479	476/492	INFO_REALIGN_3_PRIME	chr19	TogoVar
GTPBP6_chrX_299759_323796	314211	G G	GT GT	frameshift_variant frameshift_variant	HIGH	NA18973.hp1 NA18973.hp1	a0022 a0022	a0022c0033 a0022c0033	a0022c0033t0002 a0022c0033t0002	a0022c0033t0002g0140 a0022c0033t0002g0140	1	155	0.0065	1	c.695 others(4): Show c.695dupA	p.Asn others(5): Show p.Asn232fs	GTPBP6	ENSG00000178605.14	transcript	ENST00000326153.10	protein_coding	5/10	704/1875	695/1551	232/516		chrX	TogoVar
GTPBP6_chrX_299759_323796	318481	G G	GT GT	frameshift_variant frameshift_variant	HIGH	HG01169.hp1 HG01169.hp1	a0025 a0025	a0025c0020 a0025c0020	a0025c0020t0002 a0025c0020t0002	a0025c0020t0002g0026 a0025c0020t0002g0026	1	155	0.0065	1	c.306 others(8): Show c.306_307insA	p.Pro others(5): Show p.Pro103fs	GTPBP6	ENSG00000178605.14	transcript	ENST00000326153.10	protein_coding	1/10	315/1875	306/1551	102/516		chrX	TogoVar
GTPBP6_chrX_299759_323796	318567	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA18964.hp1 NA18964.hp1	a0029 a0029	a0029c0015 a0029c0015	a0029c0015t0001 a0029c0015t0001	a0029c0015t0001g0008 a0029c0015t0001g0008	1	155	0.0065	-1	c.220 others(4): Show c.220delG	p.Glu others(4): Show p.Glu74fs	GTPBP6	ENSG00000178605.14	transcript	ENST00000326153.10	protein_coding	1/10	229/1875	220/1551	74/516		chrX	TogoVar
GTPBP6_chrX_299759_323796	318612	G G	GC GC	frameshift_variant frameshift_variant	HIGH	HG01361.hp2 HG01361.hp2	a0027 a0027	a0027c0040 a0027c0040	a0027c0040t0002 a0027c0040t0002	a0027c0040t0002g0148 a0027c0040t0002g0148	1	155	0.0065	1	c.175 others(4): Show c.175dupG	p.Ala others(4): Show p.Ala59fs	GTPBP6	ENSG00000178605.14	transcript	ENST00000326153.10	protein_coding	1/10	184/1875	175/1551	59/516		chrX	TogoVar
GTPBP6_chrX_299759_323796	318691	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA19089.hp1 NA19089.hp1	a0028 a0028	a0028c0017 a0028c0017	a0028c0017t0002 a0028c0017t0002	a0028c0017t0002g0010 a0028c0017t0002g0010	1	155	0.0065	1	c.96d others(3): Show c.96dupC	p.Ala others(4): Show p.Ala33fs	GTPBP6	ENSG00000178605.14	transcript	ENST00000326153.10	protein_coding	1/10	105/1875	96/1551	32/516		chrX	TogoVar
GTPBP6_chrX_299759_323796	318741	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA19078.hp2 NA19078.hp2	a0013 a0013	a0013c0016 a0013c0016	a0013c0016t0002 a0013c0016t0002	a0013c0016t0002g0009 a0013c0016t0002g0009	1	155	0.0065	1	c.46d others(3): Show c.46dupC	p.Arg others(4): Show p.Arg16fs	GTPBP6	ENSG00000178605.14	transcript	ENST00000326153.10	protein_coding	1/10	55/1875	46/1551	16/516		chrX	TogoVar
GTPBP6_chrX_299759_323796	318771	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA18964.hp1 NA18964.hp1	a0029 a0029	a0029c0015 a0029c0015	a0029c0015t0001 a0029c0015t0001	a0029c0015t0001g0008 a0029c0015t0001g0008	1	155	0.0065	-1	c.16d others(3): Show c.16delG	p.Ala others(3): Show p.Ala6fs	GTPBP6	ENSG00000178605.14	transcript	ENST00000326153.10	protein_coding	1/10	25/1875	16/1551	6/516		chrX	TogoVar
GUF1_chr4_44673420_44705928	44691698	T T	TATTGATC others(15): Show TATTGATCAAAATAGATATCATA	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	HG01168.hp2 HG01168.hp2	a0007 a0007	a0007c0008 a0007c0008	a0007c0008t0003 a0007c0008t0003	a0007c0008t0003g0002 a0007c0008t0003g0002	1	390	0.0026	22	c.152 others(31): Show c.1527_1528insTATCATAATTGATCAAAATAGA	p.Val others(5): Show p.Val510fs	GUF1	ENSG00000151806.14	transcript	ENST00000281543.6	protein_coding	13/17	1731/4460	1528/2010	510/669	INFO_REALIGN_3_PRIME	chr4	TogoVar
GYG2_chrX_2823930_2887818	2843234	C C	CA CA	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0015 a0015	a0015c0011 a0015c0011	a0015c0011t0002 a0015c0011t0002	a0015c0011t0002g0185 a0015c0011t0002g0185	1	316	0.0032	1	c.30d others(3): Show c.30dupA	p.Leu others(4): Show p.Leu11fs	GYG2	ENSG00000056998.21	transcript	ENST00000398806.8	protein_coding	3/11	205/3192	31/1413	11/470	INFO_REALIGN_3_PRIME	chrX	TogoVar
GYG2_chrX_2823930_2887818	2843276	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA18985.hp1 NA18985.hp1	a0014 a0014	a0014c0012 a0014c0012	a0014c0012t0001 a0014c0012t0001	a0014c0012t0001g0305 a0014c0012t0001g0305	1	316	0.0032	-1	c.75d others(3): Show c.75delG	p.Gln others(4): Show p.Gln26fs	GYG2	ENSG00000056998.21	transcript	ENST00000398806.8	protein_coding	3/11	249/3192	75/1413	25/470	INFO_REALIGN_3_PRIME	chrX	TogoVar
GYG2_chrX_2823930_2887818	2861538	T T	TG TG	frameshift_variant frameshift_variant	HIGH	HG01175.hp2 HG01175.hp2	a0011 a0011	a0011c0019 a0011c0019	a0011c0019t0004 a0011c0019t0004	a0011c0019t0004g0003 a0011c0019t0004g0003	1	316	0.0032	1	c.861 others(4): Show c.861dupG	p.Pro others(5): Show p.Pro288fs	GYG2	ENSG00000056998.21	transcript	ENST00000398806.8	protein_coding	8/11	1036/3192	862/1413	288/470	INFO_REALIGN_3_PRIME	chrX	TogoVar
GYG2_chrX_2823930_2887818	2877241	C C	CT CT	frameshift_variant frameshift_variant	HIGH	NA18987.hp1 NA18987.hp1	a0008 a0008	a0008c0014 a0008c0014	a0008c0014t0018 a0008c0014t0018	a0008c0014t0018g0147 a0008c0014t0018g0147	1	316	0.0032	1	c.118 others(5): Show c.1187dupT	p.Glu others(5): Show p.Glu397fs	GYG2	ENSG00000056998.21	transcript	ENST00000398806.8	protein_coding	10/11	1362/3192	1188/1413	396/470	INFO_REALIGN_3_PRIME	chrX	TogoVar
GZF1_chr20_23357182_23378062	23367016	G G	GAAAAACC others(6): Show GAAAAACCTTTTGT	frameshift_variant frameshift_variant	HIGH	NA19062.hp2 NA19062.hp2	a0007 a0007	a0007c0010 a0007c0010	a0007c0010t0001 a0007c0010t0001	a0007c0010t0001g0033 a0007c0010t0001g0033	1	428	0.0023	13	c.137 others(22): Show c.1379_1391dupAAAAACCTTTTGT	p.Cys others(5): Show p.Cys465fs	GZF1	ENSG00000125812.16	transcript	ENST00000338121.10	protein_coding	3/6	1469/4834	1392/2136	464/711	INFO_REALIGN_3_PRIME	chr20	TogoVar
GZMM_chr19_539053_554922	549702	GTCTGCAC others(36): Show GTCTGCACTGACATCTTCAAGCCTCCCGTGGCCACCGCTGTGGC	G G	frameshift_variant frameshift_variant	HIGH	NA19083.hp2 NA19083.hp2	a0000 a0000	a0000c0015 a0000c0015	a0000c0015t0001 a0000c0015t0001	a0000c0015t0001g0230 a0000c0015t0001g0230	1	398	0.0025	-43	c.686 others(50): Show c.686_728delTCTGCACTGACATCTTCAAGCCTCCCGTGGCCACCGCT GTGGC	p.Val others(5): Show p.Val229fs	GZMM	ENSG00000197540.8	transcript	ENST00000264553.6	protein_coding	5/5	705/924	686/774	229/257		chr19	TogoVar
H1-8_chr3_129538175_129556467	129547457	A A	AC AC	frameshift_variant frameshift_variant	HIGH	HG01109.hp2 HG01175.hp2 HG01433.hp2 others(12): Show HG01109.hp2 HG01175.hp2 HG01433.hp2 HG01496.hp2 HG02055.hp2 HG02615.hp2 HG02698.hp2 HG02738.hp1 HG02738.hp2 HG03098.hp2 NA18941.hp2 NA19011.hp1 NA19062.hp2 NA19083.hp1 NA19083.hp2	a0005 a0007 a0009 a0005 a0007 a0009	a0005c0007 a0005c0019 a0005c0020 others(3): Show a0005c0007 a0005c0019 a0005c0020 a0007c0017 a0007c0018 a0009c0014	a0005c0007t0001 a0005c0007t0003 a0005c0019t0001 others(4): Show a0005c0007t0001 a0005c0007t0003 a0005c0019t0001 a0005c0020t0001 a0007c0017t0001 a0007c0018t0001 a0009c0014t0001	a0005c0007t0001g0001 a0005c0007t0001g0002 a0005c0007t0001g0004 others(10): Show a0005c0007t0001g0001 a0005c0007t0001g0002 a0005c0007t0001g0004 a0005c0007t0001g0005 a0005c0007t0001g0017 a0005c0007t0001g0099 a0005c0007t0001g0109 a0005c0007t0003g0001 a0005c0019t0001g0006 a0005c0020t0001g0002 a0007c0017t0001g0024 a0007c0018t0001g0008 a0009c0014t0001g0003	15	422	0.0356	1	c.161 others(4): Show c.161dupC	p.Val others(4): Show p.Val55fs	H1-8	ENSG00000178804.8	transcript	ENST00000324382.7	protein_coding	2/5	206/1212	162/1041	54/346	INFO_REALIGN_3_PRIME	chr3	TogoVar
H2AB1_chrX_154879972_154890558	154885301	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0007 a0007	a0007c0006 a0007c0006	a0007c0006t0003 a0007c0006t0003	a0007c0006t0003g0000 a0007c0006t0003g0000	1	318	0.0031	-1	c.256 others(4): Show c.256delC	p.Leu others(4): Show p.Leu86fs	H2AB1	ENSG00000274183.2	transcript	ENST00000620016.2	protein_coding	1/1	334/587	256/348	86/115	INFO_REALIGN_3_PRIME	chrX	TogoVar
H2AB2_chrX_155375709_155386299	155380873	GT GT	G G	frameshift_variant frameshift_variant	HIGH	NA18975.hp1 NA18975.hp1	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0004 a0005c0005t0004	a0005c0005t0004g0000 a0005c0005t0004g0000	1	229	0.0044	-1	c.91d others(3): Show c.91delT	p.Ser others(4): Show p.Ser31fs	H2AB2	ENSG00000277858.2	transcript	ENST00000354514.6	protein_coding	1/1	169/591	91/348	31/115	INFO_REALIGN_3_PRIME	chrX	TogoVar
H2AB2_chrX_155375709_155386299	155380938	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA18975.hp1 NA18975.hp1	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0004 a0005c0005t0004	a0005c0005t0004g0000 a0005c0005t0004g0000	1	229	0.0044	1	c.154 others(4): Show c.154dupG	p.Ala others(4): Show p.Ala52fs	H2AB2	ENSG00000277858.2	transcript	ENST00000354514.6	protein_coding	1/1	233/591	155/348	52/115	INFO_REALIGN_3_PRIME	chrX	TogoVar
H2AB2_chrX_155375709_155386299	155381049	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA18975.hp1 NA18975.hp1	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0004 a0005c0005t0004	a0005c0005t0004g0000 a0005c0005t0004g0000	1	229	0.0044	1	c.265 others(4): Show c.265dupG	p.Asp others(4): Show p.Asp89fs	H2AB2	ENSG00000277858.2	transcript	ENST00000354514.6	protein_coding	1/1	344/591	266/348	89/115	INFO_REALIGN_3_PRIME	chrX	TogoVar
H2AB2_chrX_155375709_155386299	155381065	CA CA	C C	frameshift_variant frameshift_variant	HIGH	NA18975.hp1 NA18975.hp1	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0004 a0005c0005t0004	a0005c0005t0004g0000 a0005c0005t0004g0000	1	229	0.0044	-1	c.281 others(4): Show c.281delA	p.Asn others(4): Show p.Asn94fs	H2AB2	ENSG00000277858.2	transcript	ENST00000354514.6	protein_coding	1/1	359/591	281/348	94/115	INFO_REALIGN_3_PRIME	chrX	TogoVar

Search by Variant

Search

Search Results (Total: 5828 hits)