Joint Open Genome and Omics Platform (JoGo)

Search by Variant

Regionname

e.g. ALDH2_chr12_111761933_111822532, HBB_chr11_5220464_5232071.

Chr

Chromosome name (e.g., chr11).

Snpeff genename

Exact SnpEff gene name.

Sampleids

Target sampleid (e.g. HG02615).

Snpeff haplotype class

Haplotype-annotation class (e.g., ahapid, ahapid+chapid).

Snpeff annotation impact

Exact impact level (e.g., HIGH, MODERATE, LOW).

Snpeff annotation impact detail

Keyword match in SnpEff annotation.

Hapid

One or more haplotype IDs (comma-separated; e.g., a0001, a01, a0001c0001, a01c02, a1c2, a0001c0001t0005, a0001c0001t0005g0018).

Samplehapid

Sample haplotype IDs to include (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

No_hapid

Haplotype IDs to exclude (comma-separated; e.g., a0001, a0002, a0001c0001, a0001c0001t0005, a1, a01).

No_samplehapid

Sample haplotype IDs to exclude (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

Start

Start position (GRCh38).

End

End position (GRCh38).

Minac

Minimum alternate allele count (≥).

Maxac

Maximum alternate allele count (≤).

Minlen

Minimum variant length (≥).

Maxlen

Maximum variant length (≤).

Sort By

Select column to sort.

Order by

Ascending or descending.

Show

Results per page.

regionname	pos	ref	alt	annotation	impact	samples	ahapids	achapids	acthapids	actghapids	ac	an	af	len	hgvs_c	hgvs_p	genename	geneid	featuretype	featureid	transcript_biotype	rank	cdna cdna pos length	cds cds pos length	aa aa pos length	status	chr	external
IGFN1_chr1_201185824_201233952	201210972	C C	CGGTCAAT others(210): Show CGGTCAATGGATGAGGCAGGTTATAGGAAGGATTTGGGGGCTCCTAAGGG AATGGGTTCAGGCAGTAAGGCAAGTTTTAGGGATGGTTTAGGGGGTTCTG GAGAAATGGGGTCAGTGAATGAAGCAGGTTATAGGAAGGATTTGGGGGGC TCCTAAGGGAATGGGTTCAGGGAGCAAGGCAGGTTTTAGGGATGGTTTAG GGAGTTCTGGGGAAATGG	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA18941.hp1 NA18941.hp1	a0095 a0095	a0095c0161 a0095c0161	a0095c0161t0001 a0095c0161t0001	a0095c0161t0001g0276 a0095c0161t0001g0276	1	428	0.0023	217	c.612 others(226): Show c.6123_6124insAAGGGAATGGGTTCAGGCAGTAAGGCAAGTTTTAGG GATGGTTTAGGGGGTTCTGGAGAAATGGGGTCAGTGAATGAAGCAGGTTA TAGGAAGGATTTGGGGGGCTCCTAAGGGAATGGGTTCAGGGAGCAAGGCA GGTTTTAGGGATGGTTTAGGGAGTTCTGGGGAAATGGGGTCAATGGATGA GGCAGGTTATAGGAAGGATTTGGGGGCTCCT	p.Glu others(6): Show p.Glu2042fs	IGFN1	ENSG00000163395.17	transcript	ENST00000335211.9	protein_coding	12/24	6255/11811	6124/11127	2042/3708	INFO_REALIGN_3_PRIME	chr1	TogoVar
IGSF1_chrX_131268506_131294306	131274099	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19089.hp1 NA19089.hp1	a0007 a0007	a0007c0024 a0007c0024	a0007c0024t0003 a0007c0024t0003	a0007c0024t0003g0097 a0007c0024t0003g0097	1	328	0.0031	-1	c.385 others(5): Show c.3858delG	p.Trp others(6): Show p.Trp1286fs	IGSF1	ENSG00000147255.19	transcript	ENST00000361420.8	protein_coding	19/20	4018/4461	3858/4011	1286/1336		chrX	TogoVar
IGSF1_chrX_131268506_131294306	131275121	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0012 a0012	a0012c0027 a0012c0027	a0012c0027t0001 a0012c0027t0001	a0012c0027t0001g0166 a0012c0027t0001g0166	1	328	0.0031	-1	c.334 others(5): Show c.3349delG	p.Ala others(6): Show p.Ala1117fs	IGSF1	ENSG00000147255.19	transcript	ENST00000361420.8	protein_coding	17/20	3509/4461	3349/4011	1117/1336		chrX	TogoVar
IGSF1_chrX_131268506_131294306	131275143	G G	GT GT	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0012 a0012	a0012c0027 a0012c0027	a0012c0027t0001 a0012c0027t0001	a0012c0027t0001g0166 a0012c0027t0001g0166	1	328	0.0031	1	c.332 others(5): Show c.3327dupA	p.Gln others(6): Show p.Gln1110fs	IGSF1	ENSG00000147255.19	transcript	ENST00000361420.8	protein_coding	17/20	3487/4461	3327/4011	1109/1336		chrX	TogoVar
IGSF1_chrX_131268506_131294306	131275215	GA GA	G G	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0012 a0012	a0012c0027 a0012c0027	a0012c0027t0001 a0012c0027t0001	a0012c0027t0001g0166 a0012c0027t0001g0166	1	328	0.0031	-1	c.325 others(5): Show c.3255delT	p.Gln others(6): Show p.Gln1086fs	IGSF1	ENSG00000147255.19	transcript	ENST00000361420.8	protein_coding	17/20	3415/4461	3255/4011	1085/1336		chrX	TogoVar
IGSF1_chrX_131268506_131294306	131275245	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0012 a0012	a0012c0027 a0012c0027	a0012c0027t0001 a0012c0027t0001	a0012c0027t0001g0166 a0012c0027t0001g0166	1	328	0.0031	-1	c.322 others(5): Show c.3225delC	p.Met others(6): Show p.Met1076fs	IGSF1	ENSG00000147255.19	transcript	ENST00000361420.8	protein_coding	17/20	3385/4461	3225/4011	1075/1336		chrX	TogoVar
IGSF1_chrX_131268506_131294306	131275495	AG AG	A A	frameshift_variant frameshift_variant	HIGH	NA18968.hp1 NA18968.hp1	a0011 a0011	a0011c0026 a0011c0026	a0011c0026t0001 a0011c0026t0001	a0011c0026t0001g0159 a0011c0026t0001g0159	1	328	0.0031	-1	c.316 others(5): Show c.3166delC	p.Leu others(6): Show p.Leu1056fs	IGSF1	ENSG00000147255.19	transcript	ENST00000361420.8	protein_coding	16/20	3326/4461	3166/4011	1056/1336		chrX	TogoVar
IGSF1_chrX_131268506_131294306	131275552	C C	CT CT	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0012 a0012	a0012c0027 a0012c0027	a0012c0027t0001 a0012c0027t0001	a0012c0027t0001g0166 a0012c0027t0001g0166	1	328	0.0031	1	c.310 others(5): Show c.3109dupA	p.Ser others(6): Show p.Ser1037fs	IGSF1	ENSG00000147255.19	transcript	ENST00000361420.8	protein_coding	16/20	3269/4461	3109/4011	1037/1336		chrX	TogoVar
IGSF1_chrX_131268506_131294306	131275559	G G	GCA GCA	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0012 a0012	a0012c0027 a0012c0027	a0012c0027t0001 a0012c0027t0001	a0012c0027t0001g0166 a0012c0027t0001g0166	1	328	0.0031	2	c.310 others(11): Show c.3102_3103insTG	p.Arg others(6): Show p.Arg1035fs	IGSF1	ENSG00000147255.19	transcript	ENST00000361420.8	protein_coding	16/20	3262/4461	3102/4011	1034/1336		chrX	TogoVar
IGSF1_chrX_131268506_131294306	131275762	G G	GT GT	frameshift_variant others(1): Show frameshift_variant splice_region_variant	HIGH	NA19006.hp1 NA19006.hp1	a0012 a0012	a0012c0027 a0012c0027	a0012c0027t0001 a0012c0027t0001	a0012c0027t0001g0166 a0012c0027t0001g0166	1	328	0.0031	1	c.289 others(5): Show c.2899dupA	p.Thr others(5): Show p.Thr967fs	IGSF1	ENSG00000147255.19	transcript	ENST00000361420.8	protein_coding	16/20	3059/4461	2899/4011	967/1336		chrX	TogoVar
IGSF1_chrX_131268506_131294306	131276014	G G	GT GT	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0012 a0012	a0012c0027 a0012c0027	a0012c0027t0001 a0012c0027t0001	a0012c0027t0001g0166 a0012c0027t0001g0166	1	328	0.0031	1	c.284 others(5): Show c.2842dupA	p.Thr others(5): Show p.Thr948fs	IGSF1	ENSG00000147255.19	transcript	ENST00000361420.8	protein_coding	15/20	3002/4461	2842/4011	948/1336		chrX	TogoVar
IGSF1_chrX_131268506_131294306	131276034	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0012 a0012	a0012c0027 a0012c0027	a0012c0027t0001 a0012c0027t0001	a0012c0027t0001g0166 a0012c0027t0001g0166	1	328	0.0031	1	c.282 others(5): Show c.2822dupG	p.Ser others(5): Show p.Ser941fs	IGSF1	ENSG00000147255.19	transcript	ENST00000361420.8	protein_coding	15/20	2982/4461	2822/4011	941/1336		chrX	TogoVar
IGSF1_chrX_131268506_131294306	131276105	GA GA	G G	frameshift_variant frameshift_variant	HIGH	NA19089.hp1 NA19089.hp1	a0007 a0007	a0007c0024 a0007c0024	a0007c0024t0003 a0007c0024t0003	a0007c0024t0003g0097 a0007c0024t0003g0097	1	328	0.0031	-1	c.275 others(5): Show c.2751delT	p.Arg others(5): Show p.Arg918fs	IGSF1	ENSG00000147255.19	transcript	ENST00000361420.8	protein_coding	15/20	2911/4461	2751/4011	917/1336		chrX	TogoVar
IGSF1_chrX_131268506_131294306	131281802	GA GA	G G	frameshift_variant frameshift_variant	HIGH	NA19054.hp1 NA19054.hp1	a0006 a0006	a0006c0028 a0006c0028	a0006c0028t0001 a0006c0028t0001	a0006c0028t0001g0057 a0006c0028t0001g0057	1	328	0.0031	-1	c.138 others(5): Show c.1388delT	p.Phe others(5): Show p.Phe463fs	IGSF1	ENSG00000147255.19	transcript	ENST00000361420.8	protein_coding	8/20	1548/4461	1388/4011	463/1336		chrX	TogoVar
IGSF1_chrX_131268506_131294306	131281845	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA19054.hp1 NA19054.hp1	a0006 a0006	a0006c0028 a0006c0028	a0006c0028t0001 a0006c0028t0001	a0006c0028t0001g0057 a0006c0028t0001g0057	1	328	0.0031	-1	c.134 others(5): Show c.1345delG	p.Glu others(5): Show p.Glu449fs	IGSF1	ENSG00000147255.19	transcript	ENST00000361420.8	protein_coding	8/20	1505/4461	1345/4011	449/1336		chrX	TogoVar
IGSF1_chrX_131268506_131294306	131281912	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19054.hp1 NA19054.hp1	a0006 a0006	a0006c0028 a0006c0028	a0006c0028t0001 a0006c0028t0001	a0006c0028t0001g0057 a0006c0028t0001g0057	1	328	0.0031	-1	c.127 others(5): Show c.1278delG	p.Trp others(5): Show p.Trp426fs	IGSF1	ENSG00000147255.19	transcript	ENST00000361420.8	protein_coding	8/20	1438/4461	1278/4011	426/1336		chrX	TogoVar
IGSF1_chrX_131268506_131294306	131282547	AT AT	A A	frameshift_variant frameshift_variant	HIGH	NA19054.hp1 NA19054.hp1	a0006 a0006	a0006c0028 a0006c0028	a0006c0028t0001 a0006c0028t0001	a0006c0028t0001g0057 a0006c0028t0001g0057	1	328	0.0031	-1	c.114 others(5): Show c.1142delA	p.Asn others(5): Show p.Asn381fs	IGSF1	ENSG00000147255.19	transcript	ENST00000361420.8	protein_coding	7/20	1302/4461	1142/4011	381/1336		chrX	TogoVar
IKBKG_chrX_154542620_154570033	154552009	A A	AC AC	frameshift_variant frameshift_variant	HIGH	NA19089.hp1 NA19089.hp1	a0007 a0007	a0007c0004 a0007c0004	a0007c0004t0001 a0007c0004t0001	a0007c0004t0001g0058 a0007c0004t0001g0058	1	246	0.0041	1	c.7_8 others(4): Show c.7_8insC	p.Arg others(3): Show p.Arg3fs	IKBKG	ENSG00000269335.7	transcript	ENST00000594239.6	protein_coding	2/10	149/1973	8/1260	3/419		chrX	TogoVar
IKBKG_chrX_154542620_154570033	154552115	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19089.hp1 NA19089.hp1	a0007 a0007	a0007c0004 a0007c0004	a0007c0004t0001 a0007c0004t0001	a0007c0004t0001g0058 a0007c0004t0001g0058	1	246	0.0041	1	c.114 others(4): Show c.114dupG	p.Leu others(4): Show p.Leu39fs	IKBKG	ENSG00000269335.7	transcript	ENST00000594239.6	protein_coding	2/10	256/1973	115/1260	39/419	INFO_REALIGN_3_PRIME	chrX	TogoVar
IKBKG_chrX_154542620_154570033	154552132	G G	GA GA	frameshift_variant frameshift_variant	HIGH	NA19089.hp1 NA19089.hp1	a0007 a0007	a0007c0004 a0007c0004	a0007c0004t0001 a0007c0004t0001	a0007c0004t0001g0058 a0007c0004t0001g0058	1	246	0.0041	1	c.132 others(4): Show c.132dupA	p.Gln others(4): Show p.Gln45fs	IKBKG	ENSG00000269335.7	transcript	ENST00000594239.6	protein_coding	2/10	274/1973	133/1260	45/419	INFO_REALIGN_3_PRIME	chrX	TogoVar
IKBKG_chrX_154542620_154570033	154556236	AG AG	A A	frameshift_variant frameshift_variant	HIGH	NA18965.hp1 NA18965.hp1	a0006 a0006	a0006c0005 a0006c0005	a0006c0005t0001 a0006c0005t0001	a0006c0005t0001g0047 a0006c0005t0001g0047	1	246	0.0041	-1	c.262 others(4): Show c.262delG	p.Glu others(4): Show p.Glu88fs	IKBKG	ENSG00000269335.7	transcript	ENST00000594239.6	protein_coding	3/10	403/1973	262/1260	88/419	INFO_REALIGN_3_PRIME	chrX	TogoVar
IKBKG_chrX_154542620_154570033	154556267	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA18965.hp1 NA18965.hp1	a0006 a0006	a0006c0005 a0006c0005	a0006c0005t0001 a0006c0005t0001	a0006c0005t0001g0047 a0006c0005t0001g0047	1	246	0.0041	-1	c.292 others(4): Show c.292delC	p.Gln others(4): Show p.Gln98fs	IKBKG	ENSG00000269335.7	transcript	ENST00000594239.6	protein_coding	3/10	433/1973	292/1260	98/419	INFO_REALIGN_3_PRIME	chrX	TogoVar
IKBKG_chrX_154542620_154570033	154558562	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0005 a0005	a0005c0006 a0005c0006	a0005c0006t0007 a0005c0006t0007	a0005c0006t0007g0056 a0005c0006t0007g0056	1	246	0.0041	-1	c.433 others(4): Show c.433delC	p.Gln others(5): Show p.Gln145fs	IKBKG	ENSG00000269335.7	transcript	ENST00000594239.6	protein_coding	4/10	574/1973	433/1260	145/419	INFO_REALIGN_3_PRIME	chrX	TogoVar
IKBKG_chrX_154542620_154570033	154560411	C C	CT CT	frameshift_variant frameshift_variant	HIGH	NA18967.hp1 NA18967.hp1	a0003 a0003	a0003c0009 a0003c0009	a0003c0009t0001 a0003c0009t0001	a0003c0009t0001g0004 a0003c0009t0001g0004	1	246	0.0041	1	c.523 others(8): Show c.523_524insT	p.Arg others(5): Show p.Arg175fs	IKBKG	ENSG00000269335.7	transcript	ENST00000594239.6	protein_coding	5/10	665/1973	524/1260	175/419		chrX	TogoVar
IK_chr5_140642829_140667480	140660784	A A	ATGGGTTG others(27): Show ATGGGTTGGGGGGGGGGGATGGTGATGGGGGATGG	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA19005.hp1 NA19005.hp1	a0003 a0003	a0003c0004 a0003c0004	a0003c0004t0001 a0003c0004t0001	a0003c0004t0001g0127 a0003c0004t0001g0127	1	380	0.0026	34	c.138 others(43): Show c.1384_1385insGGTTGGGGGGGGGGGATGGTGATGGGGGATGGTG	p.Glu others(5): Show p.Glu462fs	IK	ENSG00000113141.19	transcript	ENST00000417647.7	protein_coding	16/20	1465/1905	1385/1674	462/557	INFO_REALIGN_3_PRIME	chr5	TogoVar
IL13RA1_chrX_118722606_118799533	118727695	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA18974.hp2 NA19001.hp1 NA19078.hp1 NA18974.hp2 NA19001.hp1 NA19078.hp1	a0002 a0002	a0002c0003 a0002c0003	a0002c0003t0001 a0002c0003t0015 a0002c0003t0001 a0002c0003t0015	a0002c0003t0001g0122 a0002c0003t0001g0251 a0002c0003t0015g0091 a0002c0003t0001g0122 a0002c0003t0001g0251 a0002c0003t0015g0091	3	280	0.0107	1	c.62d others(3): Show c.62dupG	p.Gly others(4): Show p.Gly22fs	IL13RA1	ENSG00000131724.11	transcript	ENST00000371666.8	protein_coding	1/11	96/3996	63/1284	21/427	INFO_REALIGN_3_PRIME	chrX	TogoVar
IL13RA1_chrX_118722606_118799533	118727707	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0007 a0007	a0007c0009 a0007c0009	a0007c0009t0002 a0007c0009t0002	a0007c0009t0002g0264 a0007c0009t0002g0264	1	280	0.0036	1	c.74d others(3): Show c.74dupG	p.Ala others(4): Show p.Ala26fs	IL13RA1	ENSG00000131724.11	transcript	ENST00000371666.8	protein_coding	1/11	108/3996	75/1284	25/427	INFO_REALIGN_3_PRIME	chrX	TogoVar
IL17B_chr5_149369267_149384292	149374436	C C	CGGGGCGG others(9): Show CGGGGCGGTGGCGGGGA	frameshift_variant frameshift_variant	HIGH	HG03688.hp2 HG03688.hp2	a0000 a0000	a0000c0005 a0000c0005	a0000c0005t0001 a0000c0005t0001	a0000c0005t0001g0025 a0000c0005t0001g0025	1	386	0.0026	16	c.475 others(23): Show c.475_476insTCCCCGCCACCGCCCC	p.Arg others(5): Show p.Arg159fs	IL17B	ENSG00000127743.6	transcript	ENST00000261796.4	protein_coding	3/3	542/712	475/543	159/180		chr5	TogoVar
IL17D_chr13_20698699_20728098	20704042	GGGCCGCG others(31): Show GGGCCGCGGGCGCCCCGAGGGCGGGCAGGCGCCCCGCGC	G G	frameshift_variant frameshift_variant	HIGH	HG02615.hp1 HG02615.hp1	a0003 a0003	a0003c0006 a0003c0006	a0003c0006t0003 a0003c0006t0003	a0003c0006t0003g0029 a0003c0006t0003g0029	1	346	0.0029	-38	c.51_ others(43): Show c.51_88delCGCCCCGAGGGCGGGCAGGCGCCCCGCGCGGCCGCGGG	p.Ala others(4): Show p.Ala18fs	IL17D	ENSG00000172458.5	transcript	ENST00000682841.1	protein_coding	1/2	354/2056	51/609	17/202	INFO_REALIGN_3_PRIME	chr13	TogoVar
IL1RAPL1_chrX_28582446_29961718	29917568	GA GA	G G	frameshift_variant frameshift_variant	HIGH	NA19058.hp1 NA19058.hp1	a0002 a0002	a0002c0004 a0002c0004	a0002c0004t0002 a0002c0004t0002	a0002c0004t0002g0044 a0002c0004t0002g0044	1	135	0.0074	-1	c.887 others(4): Show c.887delA	p.Asn others(5): Show p.Asn296fs	IL1RAPL1	ENSG00000169306.11	transcript	ENST00000378993.6	protein_coding	7/11	1513/3615	887/2091	296/696	INFO_REALIGN_3_PRIME	chrX	TogoVar
IL1RAPL2_chrX_104561199_105772829	105767329	CT CT	C C	frameshift_variant frameshift_variant	HIGH	HG01256.hp1 HG01256.hp1	a0002 a0002	a0002c0003 a0002c0003	a0002c0003t0007 a0002c0003t0007	a0002c0003t0007g0094 a0002c0003t0007g0094	1	141	0.0071	-1	c.173 others(5): Show c.1734delT	p.Phe others(5): Show p.Phe578fs	IL1RAPL2	ENSG00000189108.14	transcript	ENST00000372582.6	protein_coding	11/11	2606/3101	1734/2061	578/686	INFO_REALIGN_3_PRIME	chrX	TogoVar
IL2RG_chrX_71102404_71116577	71107763	T T	TG TG	frameshift_variant frameshift_variant	HIGH	HG02602.hp1 NA18999.hp2 NA19067.hp1 HG02602.hp1 NA18999.hp2 NA19067.hp1	a0002 a0005 a0002 a0005	a0002c0002 a0005c0003 a0002c0002 a0005c0003	a0002c0002t0001 a0005c0003t0003 a0002c0002t0001 a0005c0003t0003	a0002c0002t0001g0012 a0005c0003t0003g0015 a0002c0002t0001g0012 a0005c0003t0003g0015	3	283	0.0106	1	c.108 others(5): Show c.1082dupC	p.Cys others(5): Show p.Cys362fs	IL2RG	ENSG00000147168.14	transcript	ENST00000374202.7	protein_coding	8/8	1120/1480	1082/1110	361/369		chrX	TogoVar
IL2RG_chrX_71102404_71116577	71107815	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA18999.hp2 NA18999.hp2	a0005 a0005	a0005c0003 a0005c0003	a0005c0003t0003 a0005c0003t0003	a0005c0003t0003g0015 a0005c0003t0003g0015	1	283	0.0035	-1	c.103 others(5): Show c.1030delG	p.Glu others(5): Show p.Glu344fs	IL2RG	ENSG00000147168.14	transcript	ENST00000374202.7	protein_coding	8/8	1068/1480	1030/1110	344/369		chrX	TogoVar
IL2RG_chrX_71102404_71116577	71108660	TA TA	T T	frameshift_variant frameshift_variant	HIGH	NA19056.hp1 NA19056.hp1	a0003 a0003	a0003c0004 a0003c0004	a0003c0004t0001 a0003c0004t0001	a0003c0004t0001g0027 a0003c0004t0001g0027	1	283	0.0035	-1	c.792 others(4): Show c.792delT	p.Ile others(5): Show p.Ile265fs	IL2RG	ENSG00000147168.14	transcript	ENST00000374202.7	protein_coding	6/8	830/1480	792/1110	264/369		chrX	TogoVar
IL2RG_chrX_71102404_71116577	71109342	C C	CA CA	frameshift_variant frameshift_variant	HIGH	NA18999.hp2 NA18999.hp2	a0005 a0005	a0005c0003 a0005c0003	a0005c0003t0003 a0005c0003t0003	a0005c0003t0003g0015 a0005c0003t0003g0015	1	283	0.0035	1	c.642 others(4): Show c.642dupT	p.Gly others(5): Show p.Gly215fs	IL2RG	ENSG00000147168.14	transcript	ENST00000374202.7	protein_coding	5/8	680/1480	642/1110	214/369		chrX	TogoVar
IL2RG_chrX_71102404_71116577	71110637	GA GA	G G	frameshift_variant frameshift_variant	HIGH	NA18999.hp2 NA18999.hp2	a0005 a0005	a0005c0003 a0005c0003	a0005c0003t0003 a0005c0003t0003	a0005c0003t0003g0015 a0005c0003t0003g0015	1	283	0.0035	-1	c.320 others(4): Show c.320delT	p.Phe others(5): Show p.Phe107fs	IL2RG	ENSG00000147168.14	transcript	ENST00000374202.7	protein_coding	3/8	358/1480	320/1110	107/369		chrX	TogoVar
IL3RA_chrX_1331785_1387689	1345322	AC AC	A A	frameshift_variant frameshift_variant	HIGH	NA18985.hp1 NA18985.hp1	a0003 a0003	a0003c0005 a0003c0005	a0003c0005t0002 a0003c0005t0002	a0003c0005t0002g0050 a0003c0005t0002g0050	1	115	0.0087	-1	c.74d others(3): Show c.74delC	p.Pro others(4): Show p.Pro25fs	IL3RA	ENSG00000185291.12	transcript	ENST00000331035.10	protein_coding	3/12	254/1541	74/1137	25/378	INFO_REALIGN_3_PRIME	chrX	TogoVar
IL3RA_chrX_1331785_1387689	1348534	TC TC	T T	frameshift_variant frameshift_variant	HIGH	HG03195.hp1 HG03195.hp1	a0004 a0004	a0004c0018 a0004c0018	a0004c0018t0003 a0004c0018t0003	a0004c0018t0003g0112 a0004c0018t0003g0112	1	115	0.0087	-1	c.290 others(4): Show c.290delC	p.Pro others(4): Show p.Pro97fs	IL3RA	ENSG00000185291.12	transcript	ENST00000331035.10	protein_coding	4/12	470/1541	290/1137	97/378	INFO_REALIGN_3_PRIME	chrX	TogoVar
IL3RA_chrX_1331785_1387689	1352184	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA19058.hp1 NA19058.hp1	a0015 a0015	a0015c0017 a0015c0017	a0015c0017t0001 a0015c0017t0001	a0015c0017t0001g0004 a0015c0017t0001g0004	1	115	0.0087	1	c.388 others(4): Show c.388dupG	p.Ala others(5): Show p.Ala130fs	IL3RA	ENSG00000185291.12	transcript	ENST00000331035.10	protein_coding	5/12	569/1541	389/1137	130/378	INFO_REALIGN_3_PRIME	chrX	TogoVar
IL3RA_chrX_1331785_1387689	1352189	G G	GC GC	frameshift_variant frameshift_variant	HIGH	HG00673.hp1 HG00673.hp1	a0014 a0014	a0014c0006 a0014c0006	a0014c0006t0002 a0014c0006t0002	a0014c0006t0002g0043 a0014c0006t0002g0043	1	115	0.0087	1	c.393 others(4): Show c.393dupC	p.Ala others(5): Show p.Ala132fs	IL3RA	ENSG00000185291.12	transcript	ENST00000331035.10	protein_coding	5/12	574/1541	394/1137	132/378	INFO_REALIGN_3_PRIME	chrX	TogoVar
IL3RA_chrX_1331785_1387689	1352194	C C	CG CG	frameshift_variant frameshift_variant	HIGH	HG03927.hp1 HG03927.hp1	a0013 a0013	a0013c0016 a0013c0016	a0013c0016t0004 a0013c0016t0004	a0013c0016t0004g0054 a0013c0016t0004g0054	1	115	0.0087	1	c.394 others(4): Show c.394dupG	p.Ala others(5): Show p.Ala132fs	IL3RA	ENSG00000185291.12	transcript	ENST00000331035.10	protein_coding	5/12	575/1541	395/1137	132/378	INFO_REALIGN_3_PRIME	chrX	TogoVar
IL3RA_chrX_1331785_1387689	1352428	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA18961.hp1 NA18961.hp1	a0012 a0012	a0012c0007 a0012c0007	a0012c0007t0002 a0012c0007t0002	a0012c0007t0002g0045 a0012c0007t0002g0045	1	115	0.0087	-1	c.541 others(4): Show c.541delC	p.His others(5): Show p.His181fs	IL3RA	ENSG00000185291.12	transcript	ENST00000331035.10	protein_coding	6/12	721/1541	541/1137	181/378	INFO_REALIGN_3_PRIME	chrX	TogoVar
IL3RA_chrX_1331785_1387689	1352468	TC TC	T T	frameshift_variant frameshift_variant	HIGH	HG02280.hp2 HG02280.hp2	a0016 a0016	a0016c0004 a0016c0004	a0016c0004t0007 a0016c0004t0007	a0016c0004t0007g0093 a0016c0004t0007g0093	1	115	0.0087	-1	c.582 others(4): Show c.582delC	p.Cys others(5): Show p.Cys195fs	IL3RA	ENSG00000185291.12	transcript	ENST00000331035.10	protein_coding	6/12	762/1541	582/1137	194/378	INFO_REALIGN_3_PRIME	chrX	TogoVar
IL3RA_chrX_1331785_1387689	1352484	G G	GT GT	frameshift_variant frameshift_variant	HIGH	NA19058.hp1 NA19058.hp1	a0015 a0015	a0015c0017 a0015c0017	a0015c0017t0001 a0015c0017t0001	a0015c0017t0001g0004 a0015c0017t0001g0004	1	115	0.0087	1	c.597 others(4): Show c.597dupT	p.Val others(5): Show p.Val200fs	IL3RA	ENSG00000185291.12	transcript	ENST00000331035.10	protein_coding	6/12	778/1541	598/1137	200/378	INFO_REALIGN_3_PRIME	chrX	TogoVar
IL3RA_chrX_1331785_1387689	1356306	CA CA	C C	frameshift_variant frameshift_variant	HIGH	NA19086.hp1 NA19086.hp1	a0010 a0010	a0010c0013 a0010c0013	a0010c0013t0001 a0010c0013t0001	a0010c0013t0001g0011 a0010c0013t0001g0011	1	115	0.0087	-1	c.705 others(4): Show c.705delA	p.Lys others(5): Show p.Lys235fs	IL3RA	ENSG00000185291.12	transcript	ENST00000331035.10	protein_coding	7/12	885/1541	705/1137	235/378	INFO_REALIGN_3_PRIME	chrX	TogoVar
IL3RA_chrX_1331785_1387689	1356331	CA CA	C C	frameshift_variant others(1): Show frameshift_variant splice_region_variant	HIGH	HG02280.hp2 HG02280.hp2	a0016 a0016	a0016c0004 a0016c0004	a0016c0004t0007 a0016c0004t0007	a0016c0004t0007g0093 a0016c0004t0007g0093	1	115	0.0087	-1	c.731 others(4): Show c.731delA	p.Lys others(5): Show p.Lys244fs	IL3RA	ENSG00000185291.12	transcript	ENST00000331035.10	protein_coding	7/12	911/1541	731/1137	244/378	INFO_REALIGN_3_PRIME	chrX	TogoVar
IL3RA_chrX_1331785_1387689	1365198	GC GC	G G	frameshift_variant frameshift_variant	HIGH	HG01192.hp2 HG01192.hp2	a0006 a0006	a0006c0011 a0006c0011	a0006c0011t0004 a0006c0011t0004	a0006c0011t0004g0059 a0006c0011t0004g0059	1	115	0.0087	-1	c.823 others(4): Show c.823delC	p.Arg others(5): Show p.Arg275fs	IL3RA	ENSG00000185291.12	transcript	ENST00000331035.10	protein_coding	9/12	1003/1541	823/1137	275/378	INFO_REALIGN_3_PRIME	chrX	TogoVar
IL3RA_chrX_1331785_1387689	1365201	CG CG	C C	frameshift_variant frameshift_variant	HIGH	HG02148.hp1 HG02148.hp1	a0009 a0009	a0009c0008 a0009c0008	a0009c0008t0004 a0009c0008t0004	a0009c0008t0004g0068 a0009c0008t0004g0068	1	115	0.0087	-1	c.826 others(4): Show c.826delG	p.Glu others(5): Show p.Glu276fs	IL3RA	ENSG00000185291.12	transcript	ENST00000331035.10	protein_coding	9/12	1006/1541	826/1137	276/378	INFO_REALIGN_3_PRIME	chrX	TogoVar
IL3RA_chrX_1331785_1387689	1365244	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19056.hp2 NA19056.hp2	a0007 a0007	a0007c0010 a0007c0010	a0007c0010t0001 a0007c0010t0001	a0007c0010t0001g0007 a0007c0010t0001g0007	1	115	0.0087	1	c.867 others(4): Show c.867dupG	p.Arg others(5): Show p.Arg290fs	IL3RA	ENSG00000185291.12	transcript	ENST00000331035.10	protein_coding	9/12	1048/1541	868/1137	290/378	INFO_REALIGN_3_PRIME	chrX	TogoVar
IL9R_chrX_155992696_156015817	156003006	AG AG	A A	frameshift_variant frameshift_variant	HIGH	NA18981.hp2 NA18981.hp2	a0022 a0022	a0022c0013 a0022c0013	a0022c0013t0001 a0022c0013t0001	a0022c0013t0001g0072 a0022c0013t0001g0072	1	220	0.0046	-1	c.133 others(4): Show c.133delG	p.Glu others(4): Show p.Glu45fs	IL9R	ENSG00000124334.18	transcript	ENST00000244174.11	protein_coding	2/9	197/2038	133/1566	45/521	INFO_REALIGN_3_PRIME	chrX	TogoVar

Search by Variant

Search

Search Results (Total: 5828 hits)