Joint Open Genome and Omics Platform (JoGo)

Search by Variant

Regionname

e.g. ALDH2_chr12_111761933_111822532, HBB_chr11_5220464_5232071.

Chr

Chromosome name (e.g., chr11).

Snpeff genename

Exact SnpEff gene name.

Sampleids

Target sampleid (e.g. HG02615).

Snpeff haplotype class

Haplotype-annotation class (e.g., ahapid, ahapid+chapid).

Snpeff annotation impact

Exact impact level (e.g., HIGH, MODERATE, LOW).

Snpeff annotation impact detail

Keyword match in SnpEff annotation.

Hapid

One or more haplotype IDs (comma-separated; e.g., a0001, a01, a0001c0001, a01c02, a1c2, a0001c0001t0005, a0001c0001t0005g0018).

Samplehapid

Sample haplotype IDs to include (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

No_hapid

Haplotype IDs to exclude (comma-separated; e.g., a0001, a0002, a0001c0001, a0001c0001t0005, a1, a01).

No_samplehapid

Sample haplotype IDs to exclude (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

Start

Start position (GRCh38).

End

End position (GRCh38).

Minac

Minimum alternate allele count (≥).

Maxac

Maximum alternate allele count (≤).

Minlen

Minimum variant length (≥).

Maxlen

Maximum variant length (≤).

Sort By

Select column to sort.

Order by

Ascending or descending.

Show

Results per page.

regionname	pos	ref	alt	annotation	impact	samples	ahapids	achapids	acthapids	actghapids	ac	an	af	len	hgvs_c	hgvs_p	genename	geneid	featuretype	featureid	transcript_biotype	rank	cdna cdna pos length	cds cds pos length	aa aa pos length	status	chr	external
AQP5_chr12_49956872_49970682	49962252	GGCAACCA others(4): Show GGCAACCAGATC	G G	frameshift_variant frameshift_variant	HIGH	HG02896.hp1 HG02896.hp1	a0007 a0007	a0007c0009 a0007c0009	a0007c0009t0001 a0007c0009t0001	a0007c0009t0001g0116 a0007c0009t0001g0116	1	466	0.0022	-11	c.236 others(18): Show c.236_246delGCAACCAGATC	p.Gly others(4): Show p.Gly79fs	AQP5	ENSG00000161798.7	transcript	ENST00000293599.7	protein_coding	1/4	382/1449	236/798	79/265		chr12	TogoVar
AQP7B_chr2_94582311_94609628	94604251	TCAGCCCC others(55): Show TCAGCCCCCTCAGCAGGCCTCTGCCTCTTGCCTGCAGCGATGGGGAGAAC TGGTGGTGGGTGC	T T	frameshift_variant others(3): Show frameshift_variant splice_acceptor_variant splice_region_variant intron_variant	HIGH	HG00438.hp1 HG00438.hp1	a0009 a0009	a0009c0010 a0009c0010	a0009c0010t0001 a0009c0010t0001	a0009c0010t0001g0169 a0009c0010t0001g0169	1	384	0.0026	-62	c.756 others(72): Show c.756-33_784delCCCCCTCAGCAGGCCTCTGCCTCTTGCCTGCAGCG ATGGGGAGAACTGGTGGTGGGTGCCAG	p.Asp others(5): Show p.Asp253fs	AQP7B	ENSG00000259916.2	transcript	ENST00000561882.2	protein_coding	8/8		756/1041	252/346	INFO_REALIGN_3_PRIME	chr2	TogoVar
ARAF_chrX_47556205_47576908	47562984	G G	GC GC	frameshift_variant frameshift_variant	HIGH	HG02683.hp1 HG02683.hp1	a0007 a0007	a0007c0004 a0007c0004	a0007c0004t0001 a0007c0004t0001	a0007c0004t0001g0015 a0007c0004t0001g0015	1	318	0.0031	1	c.23d others(3): Show c.23dupC	p.Ala others(3): Show p.Ala9fs	ARAF	ENSG00000078061.14	transcript	ENST00000377045.9	protein_coding	2/16	130/2378	24/1821	8/606	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARAF_chrX_47556205_47576908	47566638	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19001.hp1 NA19001.hp1	a0003 a0003	a0003c0005 a0003c0005	a0003c0005t0001 a0003c0005t0001	a0003c0005t0001g0096 a0003c0005t0001g0096	1	318	0.0031	1	c.562 others(4): Show c.562dupC	p.Arg others(5): Show p.Arg188fs	ARAF	ENSG00000078061.14	transcript	ENST00000377045.9	protein_coding	7/16	669/2378	563/1821	188/606	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARAF_chrX_47556205_47576908	47566694	G G	GC GC	frameshift_variant frameshift_variant	HIGH	HG02738.hp1 HG02738.hp1	a0006 a0006	a0006c0006 a0006c0006	a0006c0006t0001 a0006c0006t0001	a0006c0006t0001g0104 a0006c0006t0001g0104	1	318	0.0031	1	c.619 others(4): Show c.619dupC	p.Leu others(5): Show p.Leu207fs	ARAF	ENSG00000078061.14	transcript	ENST00000377045.9	protein_coding	7/16	726/2378	620/1821	207/606	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARAF_chrX_47556205_47576908	47567237	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA18989.hp1 NA18989.hp1	a0004 a0004	a0004c0008 a0004c0008	a0004c0008t0001 a0004c0008t0001	a0004c0008t0001g0003 a0004c0008t0001g0003	1	318	0.0031	1	c.885 others(4): Show c.885dupG	p.Tyr others(5): Show p.Tyr296fs	ARAF	ENSG00000078061.14	transcript	ENST00000377045.9	protein_coding	10/16	992/2378	886/1821	296/606	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARAF_chrX_47556205_47576908	47567398	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19001.hp1 NA19001.hp1	a0003 a0003	a0003c0005 a0003c0005	a0003c0005t0001 a0003c0005t0001	a0003c0005t0001g0096 a0003c0005t0001g0096	1	318	0.0031	-1	c.104 others(5): Show c.1045delC	p.Gln others(5): Show p.Gln349fs	ARAF	ENSG00000078061.14	transcript	ENST00000377045.9	protein_coding	10/16	1151/2378	1045/1821	349/606	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARAF_chrX_47556205_47576908	47569958	CG CG	C C	frameshift_variant frameshift_variant	HIGH	NA19001.hp1 NA19001.hp1	a0003 a0003	a0003c0005 a0003c0005	a0003c0005t0001 a0003c0005t0001	a0003c0005t0001g0096 a0003c0005t0001g0096	1	318	0.0031	-1	c.148 others(5): Show c.1489delG	p.Val others(5): Show p.Val497fs	ARAF	ENSG00000078061.14	transcript	ENST00000377045.9	protein_coding	14/16	1595/2378	1489/1821	497/606	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARAP3_chr5_141648402_141687230	141658466	AGGGTTGG others(9): Show AGGGTTGGGGACACCTG	A A	frameshift_variant others(3): Show frameshift_variant splice_acceptor_variant splice_region_variant intron_variant	HIGH	NA18965.hp2 NA18965.hp2	a0021 a0021	a0021c0032 a0021c0032	a0021c0032t0001 a0021c0032t0001	a0021c0032t0001g0125 a0021c0032t0001g0125	1	416	0.0024	-16	c.341 others(27): Show c.3412-3_3424delCAGGTGTCCCCAACCC	p.Val others(6): Show p.Val1138fs	ARAP3	ENSG00000120318.16	transcript	ENST00000239440.9	protein_coding	25/33	3499/5258	3412/4635	1138/1544		chr5	TogoVar
ARC_chr8_142606049_142619479	142613744	C C	CG CG	frameshift_variant frameshift_variant	HIGH	HG00408.hp1 HG01099.hp2 HG01192.hp1 others(7): Show HG00408.hp1 HG01099.hp2 HG01192.hp1 NA18949.hp2 NA18956.hp1 NA18959.hp2 NA18981.hp1 NA19000.hp2 NA19054.hp2 NA19068.hp1	a0002 a0002	a0002c0003 a0002c0008 a0002c0003 a0002c0008	a0002c0003t0001 a0002c0003t0002 a0002c0008t0003 a0002c0003t0001 a0002c0003t0002 a0002c0008t0003	a0002c0003t0001g0010 a0002c0003t0002g0018 a0002c0008t0003g0020 a0002c0003t0001g0010 a0002c0003t0002g0018 a0002c0008t0003g0020	10	420	0.0238	1	c.527 others(4): Show c.527dupC	p.Pro others(5): Show p.Pro177fs	ARC	ENSG00000198576.4	transcript	ENST00000356613.4	protein_coding	1/3	735/2950	527/1191	176/396		chr8	TogoVar
ARFGAP1_chr20_63267813_63294790	63278938	A A	AC AC	frameshift_variant frameshift_variant	HIGH	HG00423.hp2 HG00621.hp1 HG00741.hp1 others(9): Show HG00423.hp2 HG00621.hp1 HG00741.hp1 HG01106.hp1 HG01258.hp1 HG01952.hp2 HG02300.hp2 HG02572.hp2 HG03209.hp2 HG04204.hp1 NA19067.hp1 NA20300.hp1	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0001 a0002c0002t0018 a0002c0002t0001 a0002c0002t0018	a0002c0002t0001g0001 a0002c0002t0001g0003 a0002c0002t0001g0004 others(8): Show a0002c0002t0001g0001 a0002c0002t0001g0003 a0002c0002t0001g0004 a0002c0002t0001g0010 a0002c0002t0001g0076 a0002c0002t0001g0086 a0002c0002t0001g0101 a0002c0002t0001g0107 a0002c0002t0001g0128 a0002c0002t0001g0209 a0002c0002t0018g0067	12	342	0.0351	1	c.572 others(4): Show c.572dupC	p.Pro others(5): Show p.Pro192fs	ARFGAP1	ENSG00000101199.13	transcript	ENST00000370283.9	protein_coding	7/13	685/3250	573/1221	191/406	INFO_REALIGN_3_PRIME	chr20	TogoVar
ARHGAP23_chr17_38423464_38517385	38466571	A A	AC AC	frameshift_variant frameshift_variant	HIGH	HG00741.hp2 HG01361.hp1 HG02738.hp2 others(5): Show HG00741.hp2 HG01361.hp1 HG02738.hp2 NA18985.hp1 NA19043.hp1 NA19062.hp1 NA19062.hp2 NA19090.hp1	a0002 a0002	a0002c0015 a0002c0022 a0002c0023 others(2): Show a0002c0015 a0002c0022 a0002c0023 a0002c0035 a0002c0036	a0002c0015t0001 a0002c0022t0001 a0002c0022t0010 others(3): Show a0002c0015t0001 a0002c0022t0001 a0002c0022t0010 a0002c0023t0001 a0002c0035t0001 a0002c0036t0003	a0002c0015t0001g0189 a0002c0015t0001g0243 a0002c0022t0001g0095 others(5): Show a0002c0015t0001g0189 a0002c0015t0001g0243 a0002c0022t0001g0095 a0002c0022t0010g0257 a0002c0023t0001g0180 a0002c0023t0001g0239 a0002c0035t0001g0237 a0002c0036t0003g0179	8	309	0.0259	1	c.892 others(4): Show c.892dupC	p.Arg others(5): Show p.Arg298fs	ARHGAP23	ENSG00000275832.5	transcript	ENST00000622683.5	protein_coding	7/24	915/5911	893/4476	298/1491	INFO_REALIGN_3_PRIME	chr17	TogoVar
ARHGAP26_chr5_142765377_143234007	142913196	T T	TAGGGAGA others(9): Show TAGGGAGAAGATGAATC	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA18948.hp1 NA18948.hp1	a0001 a0001	a0001c0002 a0001c0002	a0001c0002t0004 a0001c0002t0004	a0001c0002t0004g0061 a0001c0002t0004g0061	1	198	0.0051	16	c.934 others(23): Show c.934_949dupGGAGAAGATGAATCAG	p.Val others(5): Show p.Val317fs	ARHGAP26	ENSG00000145819.18	transcript	ENST00000645722.2	protein_coding	10/23	1335/9226	950/2280	317/759	INFO_REALIGN_3_PRIME	chr5	TogoVar
ARHGAP33_chr19_35770564_35793822	35787193	A A	AC AC	frameshift_variant frameshift_variant	HIGH	HG00621.hp2 HG03098.hp1 HG03927.hp2 others(6): Show HG00621.hp2 HG03098.hp1 HG03927.hp2 NA18949.hp1 NA18951.hp1 NA19000.hp1 NA19067.hp2 NA19086.hp1 NA19090.hp2	a0002 a0019 a0002 a0019	a0002c0011 a0002c0013 a0002c0014 others(2): Show a0002c0011 a0002c0013 a0002c0014 a0002c0037 a0019c0020	a0002c0011t0001 a0002c0013t0001 a0002c0014t0001 others(2): Show a0002c0011t0001 a0002c0013t0001 a0002c0014t0001 a0002c0037t0001 a0019c0020t0001	a0002c0011t0001g0003 a0002c0011t0001g0065 a0002c0013t0001g0005 others(4): Show a0002c0011t0001g0003 a0002c0011t0001g0065 a0002c0013t0001g0005 a0002c0014t0001g0002 a0002c0014t0001g0015 a0002c0037t0001g0012 a0019c0020t0001g0075	9	420	0.0214	1	c.263 others(5): Show c.2633dupC	p.Pro others(5): Show p.Pro879fs	ARHGAP33	ENSG00000004777.19	transcript	ENST00000007510.9	protein_coding	21/21	2729/4352	2634/3864	878/1287	INFO_REALIGN_3_PRIME	chr19	TogoVar
ARHGAP36_chrX_131053346_131094885	131088735	G G	GT GT	frameshift_variant frameshift_variant	HIGH	NA18985.hp1 NA18985.hp1	a0000 a0000	a0000c0003 a0000c0003	a0000c0003t0007 a0000c0003t0007	a0000c0003t0007g0096 a0000c0003t0007g0096	1	302	0.0033	1	c.159 others(5): Show c.1595dupT	p.Pro others(5): Show p.Pro533fs	ARHGAP36	ENSG00000147256.12	transcript	ENST00000276211.10	protein_coding	12/12	1837/2985	1596/1644	532/547	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARHGAP36_chrX_131053346_131094885	131088741	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA18985.hp1 NA18985.hp1	a0000 a0000	a0000c0003 a0000c0003	a0000c0003t0007 a0000c0003t0007	a0000c0003t0007g0096 a0000c0003t0007g0096	1	302	0.0033	1	c.160 others(5): Show c.1603dupG	p.Glu others(5): Show p.Glu535fs	ARHGAP36	ENSG00000147256.12	transcript	ENST00000276211.10	protein_coding	12/12	1845/2985	1604/1644	535/547	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARHGAP4_chrX_153902378_153931264	153907856	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0014 a0014	a0014c0022 a0014c0022	a0014c0022t0001 a0014c0022t0001	a0014c0022t0001g0108 a0014c0022t0001g0108	1	308	0.0033	1	c.271 others(5): Show c.2713dupC	p.Arg others(5): Show p.Arg905fs	ARHGAP4	ENSG00000089820.17	transcript	ENST00000350060.10	protein_coding	22/22	2775/3254	2713/2841	905/946		chrX	TogoVar
ARHGAP4_chrX_153902378_153931264	153907869	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19063.hp1 NA19063.hp1	a0008 a0008	a0008c0014 a0008c0014	a0008c0014t0001 a0008c0014t0001	a0008c0014t0001g0089 a0008c0014t0001g0089	1	308	0.0033	-1	c.270 others(5): Show c.2700delC	p.Ser others(5): Show p.Ser901fs	ARHGAP4	ENSG00000089820.17	transcript	ENST00000350060.10	protein_coding	22/22	2762/3254	2700/2841	900/946		chrX	TogoVar
ARHGAP4_chrX_153902378_153931264	153909483	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19078.hp1 NA19078.hp1	a0005 a0005	a0005c0024 a0005c0024	a0005c0024t0001 a0005c0024t0001	a0005c0024t0001g0181 a0005c0024t0001g0181	1	308	0.0033	1	c.246 others(5): Show c.2466dupG	p.Ser others(5): Show p.Ser823fs	ARHGAP4	ENSG00000089820.17	transcript	ENST00000350060.10	protein_coding	20/22	2528/3254	2466/2841	822/946		chrX	TogoVar
ARHGAP4_chrX_153902378_153931264	153909776	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19078.hp1 NA19078.hp1	a0005 a0005	a0005c0024 a0005c0024	a0005c0024t0001 a0005c0024t0001	a0005c0024t0001g0181 a0005c0024t0001g0181	1	308	0.0033	1	c.237 others(5): Show c.2378dupG	p.Leu others(5): Show p.Leu794fs	ARHGAP4	ENSG00000089820.17	transcript	ENST00000350060.10	protein_coding	19/22	2440/3254	2378/2841	793/946		chrX	TogoVar
ARHGAP4_chrX_153902378_153931264	153909843	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19078.hp2 NA19006.hp1 NA19078.hp2	a0009 a0010 a0009 a0010	a0009c0015 a0010c0017 a0009c0015 a0010c0017	a0009c0015t0001 a0010c0017t0001 a0009c0015t0001 a0010c0017t0001	a0009c0015t0001g0125 a0010c0017t0001g0124 a0009c0015t0001g0125 a0010c0017t0001g0124	2	308	0.0065	1	c.231 others(5): Show c.2311dupG	p.Asp others(5): Show p.Asp771fs	ARHGAP4	ENSG00000089820.17	transcript	ENST00000350060.10	protein_coding	19/22	2373/3254	2311/2841	771/946		chrX	TogoVar
ARHGAP4_chrX_153902378_153931264	153909912	A A	AC AC	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0009 a0009	a0009c0015 a0009c0015	a0009c0015t0001 a0009c0015t0001	a0009c0015t0001g0125 a0009c0015t0001g0125	1	308	0.0033	1	c.224 others(5): Show c.2242dupG	p.Val others(5): Show p.Val748fs	ARHGAP4	ENSG00000089820.17	transcript	ENST00000350060.10	protein_coding	19/22	2304/3254	2242/2841	748/946		chrX	TogoVar
ARHGAP4_chrX_153902378_153931264	153910039	C C	CT CT	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0014 a0014	a0014c0022 a0014c0022	a0014c0022t0001 a0014c0022t0001	a0014c0022t0001g0108 a0014c0022t0001g0108	1	308	0.0033	1	c.220 others(10): Show c.2202_2203insA	p.Glu others(5): Show p.Glu735fs	ARHGAP4	ENSG00000089820.17	transcript	ENST00000350060.10	protein_coding	18/22	2264/3254	2202/2841	734/946		chrX	TogoVar
ARHGAP4_chrX_153902378_153931264	153910288	A A	AC AC	frameshift_variant frameshift_variant	HIGH	NA19063.hp1 NA19063.hp1	a0008 a0008	a0008c0014 a0008c0014	a0008c0014t0001 a0008c0014t0001	a0008c0014t0001g0089 a0008c0014t0001g0089	1	308	0.0033	1	c.203 others(5): Show c.2038dupG	p.Val others(5): Show p.Val680fs	ARHGAP4	ENSG00000089820.17	transcript	ENST00000350060.10	protein_coding	17/22	2100/3254	2038/2841	680/946		chrX	TogoVar
ARHGAP4_chrX_153902378_153931264	153912721	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA18948.hp1 NA18948.hp1	a0007 a0007	a0007c0013 a0007c0013	a0007c0013t0001 a0007c0013t0001	a0007c0013t0001g0064 a0007c0013t0001g0064	1	308	0.0033	-1	c.152 others(5): Show c.1520delG	p.Gly others(5): Show p.Gly507fs	ARHGAP4	ENSG00000089820.17	transcript	ENST00000350060.10	protein_coding	12/22	1582/3254	1520/2841	507/946		chrX	TogoVar
ARHGAP4_chrX_153902378_153931264	153920703	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA18993.hp1 NA18993.hp1	a0006 a0006	a0006c0020 a0006c0020	a0006c0020t0001 a0006c0020t0001	a0006c0020t0001g0049 a0006c0020t0001g0049	1	308	0.0033	1	c.603 others(4): Show c.603dupC	p.Thr others(5): Show p.Thr202fs	ARHGAP4	ENSG00000089820.17	transcript	ENST00000350060.10	protein_coding	5/22	665/3254	603/2841	201/946		chrX	TogoVar
ARHGAP4_chrX_153902378_153931264	153921655	GA GA	G G	frameshift_variant frameshift_variant	HIGH	HG01928.hp1 HG01928.hp1	a0013 a0013	a0013c0011 a0013c0011	a0013c0011t0001 a0013c0011t0001	a0013c0011t0001g0063 a0013c0011t0001g0063	1	308	0.0033	-1	c.221 others(4): Show c.221delT	p.Phe others(4): Show p.Phe74fs	ARHGAP4	ENSG00000089820.17	transcript	ENST00000350060.10	protein_coding	2/22	283/3254	221/2841	74/946		chrX	TogoVar
ARHGAP4_chrX_153902378_153931264	153921674	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0014 a0014	a0014c0022 a0014c0022	a0014c0022t0001 a0014c0022t0001	a0014c0022t0001g0108 a0014c0022t0001g0108	1	308	0.0033	1	c.202 others(4): Show c.202dupG	p.Glu others(4): Show p.Glu68fs	ARHGAP4	ENSG00000089820.17	transcript	ENST00000350060.10	protein_coding	2/22	264/3254	202/2841	68/946		chrX	TogoVar
ARHGAP4_chrX_153902378_153931264	153926166	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19078.hp1 NA19078.hp1	a0005 a0005	a0005c0024 a0005c0024	a0005c0024t0001 a0005c0024t0001	a0005c0024t0001g0181 a0005c0024t0001g0181	1	308	0.0033	1	c.36d others(3): Show c.36dupG	p.Leu others(4): Show p.Leu13fs	ARHGAP4	ENSG00000089820.17	transcript	ENST00000350060.10	protein_coding	1/22	98/3254	36/2841	12/946		chrX	TogoVar
ARHGAP6_chrX_11132544_11670920	11178173	A A	AG AG	frameshift_variant frameshift_variant	HIGH	HG04115.hp1 HG04115.hp1	a0005 a0005	a0005c0006 a0005c0006	a0005c0006t0001 a0005c0006t0001	a0005c0006t0001g0048 a0005c0006t0001g0048	1	144	0.0069	1	c.155 others(5): Show c.1555dupC	p.Leu others(5): Show p.Leu519fs	ARHGAP6	ENSG00000047648.23	transcript	ENST00000337414.9	protein_coding	8/13	2647/5336	1555/2925	519/974		chrX	TogoVar
ARHGEF5_chr7_144350402_144385632	144362670	A A	ATGGAGGC others(15): Show ATGGAGGCTGAGGAGGCCCAGCG	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	HG01496.hp1 HG01884.hp2 NA18951.hp1 others(6): Show HG01496.hp1 HG01884.hp2 NA18951.hp1 NA18977.hp1 NA18985.hp1 NA18986.hp2 NA19012.hp2 NA19055.hp1 NA19084.hp1	a0009 a0009	a0009c0026 a0009c0070 a0009c0071 others(5): Show a0009c0026 a0009c0070 a0009c0071 a0009c0072 a0009c0073 a0009c0074 a0009c0075 a0009c0076	a0009c0026t0001 a0009c0070t0001 a0009c0071t0001 others(5): Show a0009c0026t0001 a0009c0070t0001 a0009c0071t0001 a0009c0072t0001 a0009c0073t0001 a0009c0074t0001 a0009c0075t0002 a0009c0076t0001	a0009c0026t0001g0046 a0009c0026t0001g0050 a0009c0070t0001g0184 others(6): Show a0009c0026t0001g0046 a0009c0026t0001g0050 a0009c0070t0001g0184 a0009c0071t0001g0182 a0009c0072t0001g0051 a0009c0073t0001g0049 a0009c0074t0001g0048 a0009c0075t0002g0183 a0009c0076t0001g0047	9	288	0.0313	22	c.7_2 others(26): Show c.7_28dupGCTGAGGAGGCCCAGCGTGGAG	p.Ala others(4): Show p.Ala10fs	ARHGEF5	ENSG00000050327.15	transcript	ENST00000056217.10	protein_coding	2/15	141/5482	29/4794	10/1597	INFO_REALIGN_3_PRIME	chr7	TogoVar
ARHGEF5_chr7_144350402_144385632	144365108	A A	AC AC	frameshift_variant frameshift_variant	HIGH	HG00423.hp2 HG00597.hp2 HG00673.hp1 others(14): Show HG00423.hp2 HG00597.hp2 HG00673.hp1 HG00741.hp2 HG01243.hp1 HG02027.hp1 HG02109.hp2 HG02738.hp1 HG03516.hp1 HG03927.hp2 NA18944.hp2 NA18977.hp2 NA18985.hp1 NA19012.hp1 NA19083.hp1 NA19083.hp2 NA19240.hp2	a0009 a0015 a0016 others(11): Show a0009 a0015 a0016 a0019 a0024 a0026 a0027 a0030 a0033 a0036 a0037 a0038 a0043 a0044	a0009c0073 a0015c0024 a0016c0054 others(12): Show a0009c0073 a0015c0024 a0016c0054 a0016c0065 a0019c0019 a0024c0057 a0026c0060 a0027c0056 a0030c0050 a0033c0068 a0036c0029 a0037c0028 a0038c0040 a0043c0031 a0044c0046	a0009c0073t0001 a0015c0024t0001 a0016c0054t0001 others(12): Show a0009c0073t0001 a0015c0024t0001 a0016c0054t0001 a0016c0065t0001 a0019c0019t0002 a0024c0057t0001 a0026c0060t0001 a0027c0056t0001 a0030c0050t0001 a0033c0068t0001 a0036c0029t0001 a0037c0028t0001 a0038c0040t0002 a0043c0031t0003 a0044c0046t0002	a0009c0073t0001g0049 a0015c0024t0001g0089 a0015c0024t0001g0092 others(14): Show a0009c0073t0001g0049 a0015c0024t0001g0089 a0015c0024t0001g0092 a0016c0054t0001g0030 a0016c0065t0001g0157 a0019c0019t0002g0003 a0019c0019t0002g0005 a0024c0057t0001g0028 a0026c0060t0001g0177 a0027c0056t0001g0079 a0030c0050t0001g0027 a0033c0068t0001g0152 a0036c0029t0001g0001 a0037c0028t0001g0053 a0038c0040t0002g0003 a0043c0031t0003g0034 a0044c0046t0002g0015	17	288	0.0590	1	c.244 others(5): Show c.2444dupC	p.Thr others(5): Show p.Thr816fs	ARHGEF5	ENSG00000050327.15	transcript	ENST00000056217.10	protein_coding	2/15	2557/5482	2445/4794	815/1597	INFO_REALIGN_3_PRIME	chr7	TogoVar
ARHGEF6_chrX_136660550_136785932	136668089	CA CA	C C	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0007 a0007	a0007c0007 a0007c0007	a0007c0007t0010 a0007c0007t0010	a0007c0007t0010g0021 a0007c0007t0010g0021	1	247	0.0041	-1	c.227 others(5): Show c.2270delT	p.Leu others(5): Show p.Leu757fs	ARHGEF6	ENSG00000129675.16	transcript	ENST00000250617.7	protein_coding	22/22	2320/4860	2270/2331	757/776		chrX	TogoVar
ARHGEF6_chrX_136660550_136785932	136682831	C C	CCGCCT CCGCCT	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0006 a0006	a0006c0008 a0006c0008	a0006c0008t0001 a0006c0008t0001	a0006c0008t0001g0124 a0006c0008t0001g0124	1	247	0.0041	5	c.140 others(14): Show c.1405_1406insAGGCG	p.Arg others(5): Show p.Arg469fs	ARHGEF6	ENSG00000129675.16	transcript	ENST00000250617.7	protein_coding	13/22	1455/4860	1405/2331	469/776		chrX	TogoVar
ARHGEF9_chrX_63629967_63790214	63638202	G G	GT GT	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0015 a0002c0002t0015	a0002c0002t0015g0011 a0002c0002t0015g0011	1	168	0.0060	1	c.139 others(5): Show c.1397dupA	p.Asn others(5): Show p.Asn466fs	ARHGEF9	ENSG00000131089.17	transcript	ENST00000671741.2	protein_coding	10/10	1466/4702	1397/1572	466/523		chrX	TogoVar
ARL13B_chr3_93975155_94060678	94043038	G G	GA GA	frameshift_variant frameshift_variant	HIGH	HG00438.hp2 HG00733.hp2 HG01175.hp1 others(14): Show HG00438.hp2 HG00733.hp2 HG01175.hp1 HG01175.hp2 HG01433.hp1 HG01433.hp2 HG01928.hp1 HG01952.hp2 HG02622.hp1 HG02717.hp2 HG03209.hp1 HG03239.hp2 HG03831.hp1 HG03927.hp2 NA18906.hp1 NA19030.hp2 NA19240.hp2	a0003 a0003	a0003c0003 a0003c0006 a0003c0003 a0003c0006	a0003c0003t0001 a0003c0003t0006 a0003c0006t0001 a0003c0003t0001 a0003c0003t0006 a0003c0006t0001	a0003c0003t0001g0037 a0003c0003t0001g0043 a0003c0003t0001g0089 others(14): Show a0003c0003t0001g0037 a0003c0003t0001g0043 a0003c0003t0001g0089 a0003c0003t0001g0099 a0003c0003t0001g0145 a0003c0003t0001g0162 a0003c0003t0001g0171 a0003c0003t0001g0175 a0003c0003t0001g0186 a0003c0003t0001g0189 a0003c0003t0001g0193 a0003c0003t0001g0207 a0003c0003t0001g0222 a0003c0003t0001g0228 a0003c0003t0001g0238 a0003c0003t0006g0073 a0003c0006t0001g0006	17	264	0.0644	1	c.830 others(4): Show c.830dupA	p.Asn others(5): Show p.Asn277fs	ARL13B	ENSG00000169379.17	transcript	ENST00000394222.8	protein_coding	7/10	1100/3971	831/1287	277/428	INFO_REALIGN_3_PRIME	chr3	TogoVar
ARL5C_chr17_39151894_39171161	39160713	A A	AAATATCA others(6): Show AAATATCAGGACTG	frameshift_variant frameshift_variant	HIGH	NA19067.hp2 NA19067.hp2	a0010 a0010	a0010c0010 a0010c0010	a0010c0010t0001 a0010c0010t0001	a0010c0010t0001g0045 a0010c0010t0001g0045	1	410	0.0024	13	c.356 others(20): Show c.356_368dupCAGTCCTGATATT	p.Ala others(5): Show p.Ala124fs	ARL5C	ENSG00000141748.13	transcript	ENST00000269586.12	protein_coding	5/6	769/941	368/540	123/179		chr17	TogoVar
ARL6IP4_chr12_122975681_122987909	122981819	C C	CTGCCGGG others(16): Show CTGCCGGGCCCCTCGCTGGACCAG	frameshift_variant frameshift_variant	HIGH	NA18974.hp2 NA18974.hp2	a0005 a0005	a0005c0006 a0005c0006	a0005c0006t0001 a0005c0006t0001	a0005c0006t0001g0001 a0005c0006t0001g0001	1	356	0.0028	23	c.412 others(30): Show c.412_434dupCCGGGCCCCTCGCTGGACCAGTG	p.Trp others(5): Show p.Trp145fs	ARL6IP4	ENSG00000182196.14	transcript	ENST00000315580.10	protein_coding	3/6	511/1023	435/714	145/237	INFO_REALIGN_3_PRIME	chr12	TogoVar
ARL9_chr4_56500791_56529453	56505976	TAAAC TAAAC	T T	frameshift_variant frameshift_variant	HIGH	HG00408.hp1 HG00423.hp1 HG00438.hp2 others(58): Show HG00408.hp1 HG00423.hp1 HG00438.hp2 HG00558.hp1 HG00558.hp2 HG01261.hp2 HG02015.hp2 HG02080.hp2 HG02109.hp2 HG02523.hp2 HG02559.hp2 HG03486.hp1 HG03490.hp1 HG03492.hp1 HG03654.hp2 HG03831.hp1 HG03942.hp1 HG04199.hp1 HG04204.hp2 HG06807.hp1 NA18612.hp2 NA18939.hp1 NA18940.hp2 NA18941.hp1 NA18942.hp1 NA18942.hp2 NA18946.hp2 NA18948.hp1 NA18955.hp2 NA18957.hp2 NA18960.hp2 NA18962.hp2 NA18963.hp1 NA18968.hp1 NA18969.hp1 NA18972.hp2 NA18977.hp1 NA18982.hp2 NA18983.hp1 NA18985.hp2 NA18986.hp2 NA18994.hp1 NA19002.hp2 NA19003.hp1 NA19005.hp2 NA19006.hp1 NA19007.hp1 NA19011.hp1 NA19055.hp2 NA19057.hp2 NA19062.hp1 NA19062.hp2 NA19063.hp2 NA19064.hp2 NA19066.hp1 NA19080.hp2 NA19084.hp1 NA19085.hp2 NA19089.hp2 NA19091.hp2 NA20905.hp2	a0003 a0003	a0003c0003 a0003c0007 a0003c0003 a0003c0007	a0003c0003t0001 a0003c0003t0004 a0003c0007t0001 a0003c0003t0001 a0003c0003t0004 a0003c0007t0001	a0003c0003t0001g0008 a0003c0003t0001g0010 a0003c0003t0001g0015 others(41): Show a0003c0003t0001g0008 a0003c0003t0001g0010 a0003c0003t0001g0015 a0003c0003t0001g0022 a0003c0003t0001g0051 a0003c0003t0001g0052 a0003c0003t0001g0053 a0003c0003t0001g0054 a0003c0003t0001g0246 a0003c0003t0001g0247 a0003c0003t0001g0248 a0003c0003t0001g0249 a0003c0003t0001g0250 a0003c0003t0001g0251 a0003c0003t0001g0252 a0003c0003t0001g0253 a0003c0003t0001g0254 a0003c0003t0001g0255 a0003c0003t0001g0256 a0003c0003t0001g0259 a0003c0003t0001g0260 a0003c0003t0001g0261 a0003c0003t0001g0263 a0003c0003t0001g0264 a0003c0003t0001g0265 a0003c0003t0001g0266 a0003c0003t0001g0267 a0003c0003t0001g0268 a0003c0003t0001g0269 a0003c0003t0001g0270 a0003c0003t0001g0271 a0003c0003t0001g0272 a0003c0003t0001g0273 a0003c0003t0001g0274 a0003c0003t0001g0275 a0003c0003t0001g0276 a0003c0003t0004g0257 a0003c0003t0004g0258 a0003c0007t0001g0022 a0003c0007t0001g0160 a0003c0007t0001g0192 a0003c0007t0001g0198 a0003c0007t0001g0225 a0003c0007t0001g0262	61	416	0.1466	-4	c.118 others(11): Show c.118_121delCAAA	p.Gln others(4): Show p.Gln40fs	ARL9	ENSG00000196503.5	transcript	ENST00000640821.3	protein_coding	1/4	190/1447	118/798	40/265	INFO_REALIGN_3_PRIME	chr4	TogoVar
ARL9_chr4_56500791_56529453	56506057	CAA CAA	C C	frameshift_variant frameshift_variant	HIGH	HG00323.hp1 HG00735.hp1 HG00741.hp1 others(6): Show HG00323.hp1 HG00735.hp1 HG00741.hp1 HG01175.hp1 HG01346.hp2 HG01433.hp2 HG02148.hp2 NA18951.hp1 NA19055.hp1	a0006 a0006	a0006c0006 a0006c0012 a0006c0006 a0006c0012	a0006c0006t0001 a0006c0012t0001 a0006c0006t0001 a0006c0012t0001	a0006c0006t0001g0013 a0006c0006t0001g0153 a0006c0006t0001g0188 others(4): Show a0006c0006t0001g0013 a0006c0006t0001g0153 a0006c0006t0001g0188 a0006c0006t0001g0189 a0006c0006t0001g0204 a0006c0012t0001g0104 a0006c0012t0001g0105	9	416	0.0216	-2	c.197 others(9): Show c.197_198delAA	p.Lys others(4): Show p.Lys66fs	ARL9	ENSG00000196503.5	transcript	ENST00000640821.3	protein_coding	1/4	269/1447	197/798	66/265	INFO_REALIGN_3_PRIME	chr4	TogoVar
ARMCX1_chrX_101545547_101559700	101552943	CG CG	C C	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0005 a0005	a0005c0004 a0005c0004	a0005c0004t0008 a0005c0004t0008	a0005c0004t0008g0002 a0005c0004t0008g0002	1	302	0.0033	-1	c.16d others(3): Show c.16delG	p.Glu others(3): Show p.Glu6fs	ARMCX1	ENSG00000126947.13	transcript	ENST00000372829.8	protein_coding	4/4	371/2125	16/1362	6/453	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARMCX1_chrX_101545547_101559700	101553015	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0005 a0005	a0005c0004 a0005c0004	a0005c0004t0008 a0005c0004t0008	a0005c0004t0008g0002 a0005c0004t0008g0002	1	302	0.0033	-1	c.89d others(3): Show c.89delG	p.Gly others(4): Show p.Gly30fs	ARMCX1	ENSG00000126947.13	transcript	ENST00000372829.8	protein_coding	4/4	444/2125	89/1362	30/453	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARMCX1_chrX_101545547_101559700	101553246	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19063.hp1 NA19063.hp1	a0003 a0003	a0003c0005 a0003c0005	a0003c0005t0001 a0003c0005t0001	a0003c0005t0001g0001 a0003c0005t0001g0001	1	302	0.0033	-1	c.318 others(4): Show c.318delC	p.Lys others(5): Show p.Lys107fs	ARMCX1	ENSG00000126947.13	transcript	ENST00000372829.8	protein_coding	4/4	673/2125	318/1362	106/453	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARMCX1_chrX_101545547_101559700	101553336	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19063.hp1 NA19063.hp1	a0003 a0003	a0003c0005 a0003c0005	a0003c0005t0001 a0003c0005t0001	a0003c0005t0001g0001 a0003c0005t0001g0001	1	302	0.0033	1	c.408 others(4): Show c.408dupG	p.Thr others(5): Show p.Thr137fs	ARMCX1	ENSG00000126947.13	transcript	ENST00000372829.8	protein_coding	4/4	764/2125	409/1362	137/453	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARMCX1_chrX_101545547_101559700	101553439	AG AG	A A	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0005 a0005	a0005c0004 a0005c0004	a0005c0004t0008 a0005c0004t0008	a0005c0004t0008g0002 a0005c0004t0008g0002	1	302	0.0033	-1	c.512 others(4): Show c.512delG	p.Gly others(5): Show p.Gly171fs	ARMCX1	ENSG00000126947.13	transcript	ENST00000372829.8	protein_coding	4/4	867/2125	512/1362	171/453	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARMCX1_chrX_101545547_101559700	101553923	C C	CT CT	frameshift_variant frameshift_variant	HIGH	NA19063.hp1 NA19063.hp1	a0003 a0003	a0003c0005 a0003c0005	a0003c0005t0001 a0003c0005t0001	a0003c0005t0001g0001 a0003c0005t0001g0001	1	302	0.0033	1	c.999 others(4): Show c.999dupT	p.Ala others(5): Show p.Ala334fs	ARMCX1	ENSG00000126947.13	transcript	ENST00000372829.8	protein_coding	4/4	1355/2125	1000/1362	334/453	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARMCX4_chrX_101480456_101500807	101489145	AC AC	A A	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0061 a0061	a0061c0022 a0061c0022	a0061c0022t0002 a0061c0022t0002	a0061c0022t0002g0001 a0061c0022t0002g0001	1	326	0.0031	-1	c.559 others(4): Show c.559delC	p.Gln others(5): Show p.Gln187fs	ARMCX4	ENSG00000196440.12	transcript	ENST00000423738.5	protein_coding	6/6	1070/7729	559/6873	187/2290	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARMCX4_chrX_101480456_101500807	101489254	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA18972.hp2 NA18972.hp2	a0038 a0038	a0038c0065 a0038c0065	a0038c0065t0001 a0038c0065t0001	a0038c0065t0001g0008 a0038c0065t0001g0008	1	326	0.0031	1	c.670 others(4): Show c.670dupG	p.Ala others(5): Show p.Ala224fs	ARMCX4	ENSG00000196440.12	transcript	ENST00000423738.5	protein_coding	6/6	1182/7729	671/6873	224/2290	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARMCX4_chrX_101480456_101500807	101489609	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA18972.hp2 NA18972.hp2	a0038 a0038	a0038c0065 a0038c0065	a0038c0065t0001 a0038c0065t0001	a0038c0065t0001g0008 a0038c0065t0001g0008	1	326	0.0031	1	c.102 others(5): Show c.1025dupG	p.Asn others(5): Show p.Asn343fs	ARMCX4	ENSG00000196440.12	transcript	ENST00000423738.5	protein_coding	6/6	1537/7729	1026/6873	342/2290	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARMCX4_chrX_101480456_101500807	101489792	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA18972.hp1 NA18972.hp1	a0040 a0040	a0040c0043 a0040c0043	a0040c0043t0002 a0040c0043t0002	a0040c0043t0002g0036 a0040c0043t0002g0036	1	326	0.0031	-1	c.120 others(5): Show c.1205delC	p.Pro others(5): Show p.Pro402fs	ARMCX4	ENSG00000196440.12	transcript	ENST00000423738.5	protein_coding	6/6	1716/7729	1205/6873	402/2290	INFO_REALIGN_3_PRIME	chrX	TogoVar

Search by Variant

Search

Search Results (Total: 5828 hits)