Joint Open Genome and Omics Platform (JoGo)

Search by Variant

Regionname

e.g. ALDH2_chr12_111761933_111822532, HBB_chr11_5220464_5232071.

Chr

Chromosome name (e.g., chr11).

Snpeff genename

Exact SnpEff gene name.

Sampleids

Target sampleid (e.g. HG02615).

Snpeff haplotype class

Haplotype-annotation class (e.g., ahapid, ahapid+chapid).

Snpeff annotation impact

Exact impact level (e.g., HIGH, MODERATE, LOW).

Snpeff annotation impact detail

Keyword match in SnpEff annotation.

Hapid

One or more haplotype IDs (comma-separated; e.g., a0001, a01, a0001c0001, a01c02, a1c2, a0001c0001t0005, a0001c0001t0005g0018).

Samplehapid

Sample haplotype IDs to include (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

No_hapid

Haplotype IDs to exclude (comma-separated; e.g., a0001, a0002, a0001c0001, a0001c0001t0005, a1, a01).

No_samplehapid

Sample haplotype IDs to exclude (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

Start

Start position (GRCh38).

End

End position (GRCh38).

Minac

Minimum alternate allele count (≥).

Maxac

Maximum alternate allele count (≤).

Minlen

Minimum variant length (≥).

Maxlen

Maximum variant length (≤).

Sort By

Select column to sort.

Order by

Ascending or descending.

Show

Results per page.

regionname	pos	ref	alt	annotation	impact	samples	ahapids	achapids	acthapids	actghapids	ac	an	af	len	hgvs_c	hgvs_p	genename	geneid	featuretype	featureid	transcript_biotype	rank	cdna cdna pos length	cds cds pos length	aa aa pos length	status	chr	external
L1CAM_chrX_153856516_153891173	153864910	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0016 a0016	a0016c0010 a0016c0010	a0016c0010t0007 a0016c0010t0007	a0016c0010t0007g0175 a0016c0010t0007g0175	1	283	0.0035	-1	c.295 others(5): Show c.2956delC	p.His others(5): Show p.His986fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	23/29	3173/5138	2956/3774	986/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153864933	G G	GT GT	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0016 a0016	a0016c0010 a0016c0010	a0016c0010t0007 a0016c0010t0007	a0016c0010t0007g0175 a0016c0010t0007g0175	1	283	0.0035	1	c.293 others(5): Show c.2933dupA	p.His others(5): Show p.His978fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	23/29	3150/5138	2933/3774	978/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153865306	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0016 a0016	a0016c0010 a0016c0010	a0016c0010t0007 a0016c0010t0007	a0016c0010t0007g0175 a0016c0010t0007g0175	1	283	0.0035	1	c.274 others(5): Show c.2741dupC	p.Glu others(5): Show p.Glu915fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	21/29	2958/5138	2741/3774	914/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153865325	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA18956.hp1 NA18956.hp1	a0015 a0015	a0015c0024 a0015c0024	a0015c0024t0017 a0015c0024t0017	a0015c0024t0017g0123 a0015c0024t0017g0123	1	283	0.0035	1	c.272 others(5): Show c.2722dupG	p.Glu others(5): Show p.Glu908fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	21/29	2939/5138	2722/3774	908/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153865370	AG AG	A A	frameshift_variant frameshift_variant	HIGH	NA18985.hp1 NA18985.hp1	a0013 a0013	a0013c0023 a0013c0023	a0013c0023t0006 a0013c0023t0006	a0013c0023t0006g0082 a0013c0023t0006g0082	1	283	0.0035	-1	c.267 others(5): Show c.2677delC	p.Leu others(5): Show p.Leu893fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	21/29	2894/5138	2677/3774	893/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153865746	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA19077.hp2 NA19077.hp2	a0006 a0006	a0006c0011 a0006c0011	a0006c0011t0001 a0006c0011t0001	a0006c0011t0001g0156 a0006c0011t0001g0156	1	283	0.0035	1	c.250 others(5): Show c.2504dupC	p.Val others(5): Show p.Val836fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	20/29	2721/5138	2504/3774	835/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153866651	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0016 a0016	a0016c0010 a0016c0010	a0016c0010t0007 a0016c0010t0007	a0016c0010t0007g0175 a0016c0010t0007g0175	1	283	0.0035	1	c.242 others(5): Show c.2428dupG	p.Asp others(5): Show p.Asp810fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	19/29	2645/5138	2428/3774	810/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153866709	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA19077.hp1 NA19077.hp1	a0008 a0008	a0008c0015 a0008c0015	a0008c0015t0001 a0008c0015t0001	a0008c0015t0001g0117 a0008c0015t0001g0117	1	283	0.0035	1	c.237 others(5): Show c.2370dupC	p.Val others(5): Show p.Val791fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	19/29	2587/5138	2370/3774	790/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153866762	AG AG	A A	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0016 a0016	a0016c0010 a0016c0010	a0016c0010t0007 a0016c0010t0007	a0016c0010t0007g0175 a0016c0010t0007g0175	1	283	0.0035	-1	c.231 others(5): Show c.2317delC	p.Leu others(5): Show p.Leu773fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	19/29	2534/5138	2317/3774	773/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153866790	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19077.hp1 NA19077.hp1	a0008 a0008	a0008c0015 a0008c0015	a0008c0015t0001 a0008c0015t0001	a0008c0015t0001g0117 a0008c0015t0001g0117	1	283	0.0035	-1	c.228 others(5): Show c.2289delG	p.Trp others(5): Show p.Trp763fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	19/29	2506/5138	2289/3774	763/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153866855	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0016 a0016	a0016c0010 a0016c0010	a0016c0010t0007 a0016c0010t0007	a0016c0010t0007g0175 a0016c0010t0007g0175	1	283	0.0035	-1	c.222 others(5): Show c.2224delG	p.Asp others(5): Show p.Asp742fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	19/29	2441/5138	2224/3774	742/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153867077	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0016 a0016	a0016c0010 a0016c0010	a0016c0010t0007 a0016c0010t0007	a0016c0010t0007g0175 a0016c0010t0007g0175	1	283	0.0035	-1	c.218 others(5): Show c.2184delC	p.Thr others(5): Show p.Thr729fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	18/29	2401/5138	2184/3774	728/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153867084	A A	AT AT	frameshift_variant frameshift_variant	HIGH	NA19077.hp2 NA19077.hp2	a0006 a0006	a0006c0011 a0006c0011	a0006c0011t0001 a0006c0011t0001	a0006c0011t0001g0156 a0006c0011t0001g0156	1	283	0.0035	1	c.217 others(5): Show c.2177dupA	p.Asn others(5): Show p.Asn726fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	18/29	2394/5138	2177/3774	726/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153867363	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19077.hp2 NA19077.hp2	a0006 a0006	a0006c0011 a0006c0011	a0006c0011t0001 a0006c0011t0001	a0006c0011t0001g0156 a0006c0011t0001g0156	1	283	0.0035	1	c.212 others(5): Show c.2129dupC	p.Glu others(5): Show p.Glu711fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	17/29	2346/5138	2129/3774	710/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153867885	C C	CA CA	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0016 a0016	a0016c0010 a0016c0010	a0016c0010t0007 a0016c0010t0007	a0016c0010t0007g0175 a0016c0010t0007g0175	1	283	0.0035	1	c.185 others(5): Show c.1853dupT	p.Val others(5): Show p.Val619fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	16/29	2070/5138	1853/3774	618/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153868663	G G	GA GA	frameshift_variant frameshift_variant	HIGH	NA18956.hp1 NA18956.hp1	a0015 a0015	a0015c0024 a0015c0024	a0015c0024t0017 a0015c0024t0017	a0015c0024t0017g0123 a0015c0024t0017g0123	1	283	0.0035	1	c.144 others(10): Show c.1443_1444insT	p.Leu others(5): Show p.Leu482fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	13/29	1660/5138	1443/3774	481/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153869844	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0016 a0016	a0016c0010 a0016c0010	a0016c0010t0007 a0016c0010t0007	a0016c0010t0007g0175 a0016c0010t0007g0175	1	283	0.0035	1	c.108 others(5): Show c.1081dupC	p.Gln others(5): Show p.Gln361fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	10/29	1298/5138	1081/3774	361/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153869859	A A	AC AC	frameshift_variant frameshift_variant	HIGH	NA19077.hp2 NA19077.hp2	a0006 a0006	a0006c0011 a0006c0011	a0006c0011t0001 a0006c0011t0001	a0006c0011t0001g0156 a0006c0011t0001g0156	1	283	0.0035	1	c.106 others(5): Show c.1066dupG	p.Val others(5): Show p.Val356fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	10/29	1283/5138	1066/3774	356/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153870191	CG CG	C C	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0016 a0016	a0016c0010 a0016c0010	a0016c0010t0007 a0016c0010t0007	a0016c0010t0007g0175 a0016c0010t0007g0175	1	283	0.0035	-1	c.855 others(4): Show c.855delC	p.Asp others(5): Show p.Asp286fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	9/29	1072/5138	855/3774	285/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153870200	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0016 a0016	a0016c0010 a0016c0010	a0016c0010t0007 a0016c0010t0007	a0016c0010t0007g0175 a0016c0010t0007g0175	1	283	0.0035	-1	c.846 others(4): Show c.846delC	p.Met others(5): Show p.Met283fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	9/29	1063/5138	846/3774	282/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153870404	A A	AC AC	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0016 a0016	a0016c0010 a0016c0010	a0016c0010t0007 a0016c0010t0007	a0016c0010t0007g0175 a0016c0010t0007g0175	1	283	0.0035	1	c.789 others(4): Show c.789dupG	p.Cys others(5): Show p.Cys264fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	8/29	1006/5138	789/3774	263/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153870422	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0016 a0016	a0016c0010 a0016c0010	a0016c0010t0007 a0016c0010t0007	a0016c0010t0007g0175 a0016c0010t0007g0175	1	283	0.0035	1	c.771 others(4): Show c.771dupG	p.Gln others(5): Show p.Gln258fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	8/29	988/5138	771/3774	257/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153870444	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0016 a0016	a0016c0010 a0016c0010	a0016c0010t0007 a0016c0010t0007	a0016c0010t0007g0175 a0016c0010t0007g0175	1	283	0.0035	1	c.749 others(4): Show c.749dupG	p.Ser others(5): Show p.Ser250fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	8/29	966/5138	749/3774	250/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153870476	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0016 a0016	a0016c0010 a0016c0010	a0016c0010t0007 a0016c0010t0007	a0016c0010t0007g0175 a0016c0010t0007g0175	1	283	0.0035	1	c.717 others(4): Show c.717dupG	p.Pro others(5): Show p.Pro240fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	8/29	934/5138	717/3774	239/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153870883	AG AG	A A	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0016 a0016	a0016c0010 a0016c0010	a0016c0010t0007 a0016c0010t0007	a0016c0010t0007g0175 a0016c0010t0007g0175	1	283	0.0035	-1	c.600 others(4): Show c.600delC	p.Ser others(5): Show p.Ser201fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	7/29	817/5138	600/3774	200/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153870888	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0016 a0016	a0016c0010 a0016c0010	a0016c0010t0007 a0016c0010t0007	a0016c0010t0007g0175 a0016c0010t0007g0175	1	283	0.0035	1	c.595 others(4): Show c.595dupC	p.Leu others(5): Show p.Leu199fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	7/29	812/5138	595/3774	199/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153870930	A A	AC AC	frameshift_variant frameshift_variant	HIGH	NA18956.hp2 NA18956.hp2	a0005 a0005	a0005c0009 a0005c0009	a0005c0009t0013 a0005c0009t0013	a0005c0009t0013g0076 a0005c0009t0013g0076	1	283	0.0035	1	c.553 others(4): Show c.553dupG	p.Val others(5): Show p.Val185fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	7/29	770/5138	553/3774	185/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153872269	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19002.hp1 NA19002.hp1	a0018 a0018	a0018c0026 a0018c0026	a0018c0026t0001 a0018c0026t0001	a0018c0026t0001g0058 a0018c0026t0001g0058	1	283	0.0035	1	c.282 others(4): Show c.282dupC	p.Phe others(4): Show p.Phe95fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	5/29	499/5138	282/3774	94/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153872280	T T	TG TG	frameshift_variant frameshift_variant	HIGH	HG01981.hp2 HG01981.hp2	a0017 a0017	a0017c0025 a0017c0025	a0017c0025t0001 a0017c0025t0001	a0017c0025t0001g0124 a0017c0025t0001g0124	1	283	0.0035	1	c.271 others(4): Show c.271dupC	p.His others(4): Show p.His91fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	5/29	488/5138	271/3774	91/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153872328	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19002.hp1 NA19002.hp1	a0018 a0018	a0018c0026 a0018c0026	a0018c0026t0001 a0018c0026t0001	a0018c0026t0001g0058 a0018c0026t0001g0058	1	283	0.0035	1	c.223 others(4): Show c.223dupC	p.His others(4): Show p.His75fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	5/29	440/5138	223/3774	75/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153872353	A A	AC AC	frameshift_variant others(1): Show frameshift_variant splice_region_variant	HIGH	NA19076.hp1 NA19076.hp1	a0004 a0004	a0004c0027 a0004c0027	a0004c0027t0018 a0004c0027t0018	a0004c0027t0018g0176 a0004c0027t0018g0176	1	283	0.0035	1	c.198 others(4): Show c.198dupG	p.Phe others(4): Show p.Phe67fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	5/29	415/5138	198/3774	66/1257		chrX	TogoVar
L1CAM_chrX_153856516_153891173	153872641	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0004 a0004	a0004c0027 a0004c0027	a0004c0027t0018 a0004c0027t0018	a0004c0027t0018g0176 a0004c0027t0018g0176	1	283	0.0035	1	c.147 others(4): Show c.147dupC	p.Thr others(4): Show p.Thr50fs	L1CAM	ENSG00000198910.14	transcript	ENST00000370060.7	protein_coding	4/29	364/5138	147/3774	49/1257		chrX	TogoVar
L3HYPDH_chr14_59467606_59489408	59483914	TATTGACG others(15): Show TATTGACGCGGGCCTCGCGGGTG	T T	frameshift_variant frameshift_variant	HIGH	HG02897.hp1 HG02897.hp1	a0007 a0007	a0007c0012 a0007c0012	a0007c0012t0003 a0007c0012t0003	a0007c0012t0003g0038 a0007c0012t0003g0038	1	354	0.0028	-22	c.381 others(29): Show c.381_402delCACCCGCGAGGCCCGCGTCAAT	p.Thr others(5): Show p.Thr128fs	L3HYPDH	ENSG00000126790.12	transcript	ENST00000247194.9	protein_coding	1/5	494/1516	381/1065	127/354		chr14	TogoVar
L3MBTL1_chr20_43502697_43546895	43535904	CACTAGGA others(3): Show CACTAGGACCT	C C	frameshift_variant frameshift_variant	HIGH	NA19076.hp2 NA19076.hp2	a0006 a0006	a0006c0010 a0006c0010	a0006c0010t0001 a0006c0010t0001	a0006c0010t0001g0278 a0006c0010t0001g0278	1	422	0.0024	-10	c.189 others(19): Show c.1894_1903delACTAGGACCT	p.Thr others(5): Show p.Thr632fs	L3MBTL1	ENSG00000185513.18	transcript	ENST00000418998.7	protein_coding	17/22	1970/3432	1894/2589	632/862		chr20	TogoVar
LAG3_chr12_6767520_6783455	6773944	C C	CACCTCAG others(18): Show CACCTCAGGGTATACATAGTGATGTT	frameshift_variant frameshift_variant	HIGH	NA18940.hp2 NA18940.hp2	a0012 a0012	a0012c0013 a0012c0013	a0012c0013t0001 a0012c0013t0001	a0012c0013t0001g0088 a0012c0013t0001g0088	1	472	0.0021	25	c.463 others(32): Show c.463_464insTATACATAGTGATGTTACCTCAGGG	p.Asp others(5): Show p.Asp155fs	LAG3	ENSG00000089692.9	transcript	ENST00000203629.3	protein_coding	3/8	797/1976	464/1578	155/525	INFO_REALIGN_3_PRIME	chr12	TogoVar
LAMA5_chr20_62304065_62372312	62309401	C C	CG CG	frameshift_variant frameshift_variant	HIGH	HG00733.hp2 HG01175.hp2 HG01243.hp1 others(9): Show HG00733.hp2 HG01175.hp2 HG01243.hp1 HG02027.hp1 HG02027.hp2 HG02258.hp1 HG03688.hp1 HG03927.hp1 HG04115.hp2 NA18612.hp2 NA19010.hp1 NA19012.hp1	a0000 a0000	a0000c0034 a0000c0050 a0000c0065 others(9): Show a0000c0034 a0000c0050 a0000c0065 a0000c0068 a0000c0075 a0000c0094 a0000c0096 a0000c0098 a0000c0103 a0000c0109 a0000c0113 a0000c0120	a0000c0034t0001 a0000c0050t0001 a0000c0065t0001 others(9): Show a0000c0034t0001 a0000c0050t0001 a0000c0065t0001 a0000c0068t0001 a0000c0075t0001 a0000c0094t0001 a0000c0096t0002 a0000c0098t0001 a0000c0103t0001 a0000c0109t0001 a0000c0113t0001 a0000c0120t0001	a0000c0034t0001g0175 a0000c0050t0001g0060 a0000c0065t0001g0041 others(9): Show a0000c0034t0001g0175 a0000c0050t0001g0060 a0000c0065t0001g0041 a0000c0068t0001g0031 a0000c0075t0001g0120 a0000c0094t0001g0098 a0000c0096t0002g0089 a0000c0098t0001g0124 a0000c0103t0001g0100 a0000c0109t0001g0113 a0000c0113t0001g0078 a0000c0120t0001g0077	12	186	0.0645	1	c.110 others(6): Show c.11022dupC	p.Val others(6): Show p.Val3675fs	LAMA5	ENSG00000130702.15	transcript	ENST00000252999.7	protein_coding	80/80	11089/11426	11022/11088	3674/3695		chr20	TogoVar
LAMA5_chr20_62304065_62372312	62312019	C C	CCCTGCTG others(15): Show CCCTGCTGCAGGGACACCTGGCA	frameshift_variant frameshift_variant	HIGH	HG02572.hp2 HG02572.hp2	a0055 a0055	a0055c0133 a0055c0133	a0055c0133t0001 a0055c0133t0001	a0055c0133t0001g0057 a0055c0133t0001g0057	1	186	0.0054	22	c.951 others(31): Show c.9514_9535dupTGCCAGGTGTCCCTGCAGCAGG	p.Gly others(6): Show p.Gly3179fs	LAMA5	ENSG00000130702.15	transcript	ENST00000252999.7	protein_coding	70/80	9602/11426	9535/11088	3179/3695		chr20	TogoVar
LAMA5_chr20_62304065_62372312	62314926	AGCGTCTT others(9): Show AGCGTCTTCTCCAGGGT	A A	frameshift_variant frameshift_variant	HIGH	HG02055.hp1 HG02055.hp1	a0090 a0090	a0090c0066 a0090c0066	a0090c0066t0001 a0090c0066t0001	a0090c0066t0001g0019 a0090c0066t0001g0019	1	186	0.0054	-16	c.805 others(25): Show c.8053_8068delACCCTGGAGAAGACGC	p.Thr others(6): Show p.Thr2685fs	LAMA5	ENSG00000130702.15	transcript	ENST00000252999.7	protein_coding	60/80	8135/11426	8053/11088	2685/3695		chr20	TogoVar
LAMA5_chr20_62304065_62372312	62315165	G G	GCAGCCAC others(3): Show GCAGCCACAGC	frameshift_variant frameshift_variant	HIGH	HG00597.hp1 HG00597.hp1	a0033 a0033	a0033c0107 a0033c0107	a0033c0107t0001 a0033c0107t0001	a0033c0107t0001g0111 a0033c0107t0001g0111	1	186	0.0054	10	c.790 others(19): Show c.7900_7909dupGCTGTGGCTG	p.Ala others(6): Show p.Ala2637fs	LAMA5	ENSG00000130702.15	transcript	ENST00000252999.7	protein_coding	59/80	7976/11426	7909/11088	2637/3695		chr20	TogoVar
LAMA5_chr20_62304065_62372312	62316035	TGGCACCC others(26): Show TGGCACCCTGGAGGGCAGCCCACACTGCGGGGGA	T T	frameshift_variant others(3): Show frameshift_variant splice_acceptor_variant splice_region_variant intron_variant	HIGH	HG01515.hp1 HG01515.hp1	a0051 a0051	a0051c0117 a0051c0117	a0051c0117t0001 a0051c0117t0001	a0051c0117t0001g0072 a0051c0117t0001g0072	1	186	0.0054	-33	c.775 others(45): Show c.7757-10_7779delTCCCCCGCAGTGTGGGCTGCCCTCCAGGGTGCC	p.Val others(6): Show p.Val2586fs	LAMA5	ENSG00000130702.15	transcript	ENST00000252999.7	protein_coding	58/80	7846/11426	7757/11088	2586/3695		chr20	TogoVar
LAMA5_chr20_62304065_62372312	62316997	C C	CG CG	frameshift_variant frameshift_variant	HIGH	HG00423.hp1 HG00673.hp2 HG00733.hp1 others(16): Show HG00423.hp1 HG00673.hp2 HG00733.hp1 HG00741.hp1 HG01071.hp2 HG01175.hp1 HG01192.hp1 HG01243.hp2 HG02109.hp1 HG02615.hp1 HG02647.hp1 HG02717.hp2 HG02886.hp2 HG03239.hp1 HG03239.hp2 HG03453.hp2 HG03486.hp1 HG04228.hp2 NA18966.hp1	a0013 a0014 a0016 others(10): Show a0013 a0014 a0016 a0018 a0022 a0026 a0042 a0057 a0062 a0066 a0070 a0073 a0086	a0013c0126 a0013c0135 a0014c0019 others(15): Show a0013c0126 a0013c0135 a0014c0019 a0016c0047 a0016c0093 a0018c0115 a0018c0116 a0022c0035 a0022c0074 a0026c0060 a0026c0061 a0042c0099 a0057c0052 a0062c0037 a0066c0033 a0070c0079 a0073c0039 a0086c0030	a0013c0126t0001 a0013c0135t0001 a0014c0019t0001 others(15): Show a0013c0126t0001 a0013c0135t0001 a0014c0019t0001 a0016c0047t0001 a0016c0093t0001 a0018c0115t0001 a0018c0116t0001 a0022c0035t0001 a0022c0074t0001 a0026c0060t0001 a0026c0061t0001 a0042c0099t0001 a0057c0052t0001 a0062c0037t0001 a0066c0033t0003 a0070c0079t0001 a0073c0039t0001 a0086c0030t0001	a0013c0126t0001g0065 a0013c0135t0001g0064 a0014c0019t0001g0150 others(16): Show a0013c0126t0001g0065 a0013c0135t0001g0064 a0014c0019t0001g0150 a0014c0019t0001g0152 a0016c0047t0001g0086 a0016c0093t0001g0123 a0018c0115t0001g0081 a0018c0116t0001g0070 a0022c0035t0001g0174 a0022c0074t0001g0134 a0026c0060t0001g0051 a0026c0061t0001g0047 a0042c0099t0001g0094 a0057c0052t0001g0017 a0062c0037t0001g0172 a0066c0033t0003g0182 a0070c0079t0001g0053 a0073c0039t0001g0022 a0086c0030t0001g0177	19	186	0.1022	1	c.753 others(5): Show c.7537dupC	p.Arg others(6): Show p.Arg2513fs	LAMA5	ENSG00000130702.15	transcript	ENST00000252999.7	protein_coding	56/80	7604/11426	7537/11088	2513/3695		chr20	TogoVar
LAMA5_chr20_62304065_62372312	62317390	TCGGCGGC others(97): Show TCGGCGGCCTCCACTAGACGCAGCTTGCTGCCCGCCGGGGAGAAGGTCTG CATCCTCTGCAGCAGTGGGGTCCGAGCCCCATCCAGGCTGGCGGCGAGGC GCTCC	T T	frameshift_variant frameshift_variant	HIGH	HG02647.hp2 HG02647.hp2	a0065 a0065	a0065c0073 a0065c0073	a0065c0073t0001 a0065c0073t0001	a0065c0073t0001g0016 a0065c0073t0001g0016	1	186	0.0054	-104	c.736 others(9): Show c.7362_7465del	p.Glu others(6): Show p.Glu2455fs	LAMA5	ENSG00000130702.15	transcript	ENST00000252999.7	protein_coding	55/80	7532/11426	7362/11088	2454/3695		chr20	TogoVar
LAMA5_chr20_62304065_62372312	62317430	A A	AGAAGGTC others(18): Show AGAAGGTCTGCATCCTCTGCAGCAGT	frameshift_variant frameshift_variant	HIGH	NA18522.hp1 NA18522.hp1	a0091 a0091	a0091c0029 a0091c0029	a0091c0029t0001 a0091c0029t0001	a0091c0029t0001g0180 a0091c0029t0001g0180	1	186	0.0054	25	c.740 others(34): Show c.7401_7425dupACTGCTGCAGAGGATGCAGACCTTC	p.Ser others(6): Show p.Ser2476fs	LAMA5	ENSG00000130702.15	transcript	ENST00000252999.7	protein_coding	55/80	7492/11426	7425/11088	2475/3695		chr20	TogoVar
LAMP2_chrX_120421148_120474296	120456749	A A	AT AT	frameshift_variant frameshift_variant	HIGH	NA19072.hp1 NA19072.hp1	a0002 a0002	a0002c0003 a0002c0003	a0002c0003t0001 a0002c0003t0001	a0002c0003t0001g0117 a0002c0003t0001g0117	1	297	0.0034	1	c.84d others(3): Show c.84dupA	p.Leu others(4): Show p.Leu29fs	LAMP2	ENSG00000005893.17	transcript	ENST00000200639.9	protein_coding	2/9	211/6535	84/1233	28/410		chrX	TogoVar
LANCL3_chrX_37566661_37689463	37659479	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0004 a0004	a0004c0008 a0004c0008	a0004c0008t0011 a0004c0008t0011	a0004c0008t0011g0130 a0004c0008t0011g0130	1	201	0.0050	1	c.716 others(4): Show c.716dupC	p.Ser others(5): Show p.Ser240fs	LANCL3	ENSG00000147036.12	transcript	ENST00000378619.4	protein_coding	3/5	927/10123	717/1263	239/420	INFO_REALIGN_3_PRIME	chrX	TogoVar
LAS1L_chrX_65507582_65539787	65512813	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19067.hp1 NA19067.hp1	a0000 a0000	a0000c0005 a0000c0005	a0000c0005t0003 a0000c0005t0003	a0000c0005t0003g0099 a0000c0005t0003g0099	1	203	0.0049	1	c.216 others(5): Show c.2166dupG	p.Gln others(5): Show p.Gln723fs	LAS1L	ENSG00000001497.18	transcript	ENST00000374811.8	protein_coding	14/14	2238/2470	2166/2205	722/734		chrX	TogoVar
LAS1L_chrX_65507582_65539787	65518291	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19055.hp1 NA19055.hp1	a0003 a0003	a0003c0003 a0003c0003	a0003c0003t0001 a0003c0003t0001	a0003c0003t0001g0075 a0003c0003t0001g0075	1	203	0.0049	-1	c.162 others(5): Show c.1622delC	p.Pro others(5): Show p.Pro541fs	LAS1L	ENSG00000001497.18	transcript	ENST00000374811.8	protein_coding	12/14	1694/2470	1622/2205	541/734		chrX	TogoVar
LCE4A_chr1_152703160_152714434	152709204	C C	CAGCTCTG others(7): Show CAGCTCTGCTGCTGT	frameshift_variant frameshift_variant	HIGH	NA19004.hp1 NA19004.hp1	a0007 a0007	a0007c0010 a0007c0010	a0007c0010t0001 a0007c0010t0001	a0007c0010t0001g0001 a0007c0010t0001g0001	1	416	0.0024	14	c.136 others(21): Show c.136_137insCTGCTGTAGCTCTG	p.Gly others(4): Show p.Gly46fs	LCE4A	ENSG00000187170.6	transcript	ENST00000368777.2	protein_coding	2/2	393/615	137/300	46/99	INFO_REALIGN_3_PRIME	chr1	TogoVar
LCE4A_chr1_152703160_152714434	152709204	C C	CAGCTCTG others(10): Show CAGCTCTGGGGCTGCTGT	frameshift_variant frameshift_variant	HIGH	HG00438.hp2 NA18975.hp2 HG00438.hp2 NA18975.hp2	a0006 a0006	a0006c0008 a0006c0008	a0006c0008t0001 a0006c0008t0001	a0006c0008t0001g0001 a0006c0008t0001g0001	2	416	0.0048	17	c.139 others(24): Show c.139_140insCTGCTGTAGCTCTGGGG	p.Gly others(4): Show p.Gly47fs	LCE4A	ENSG00000187170.6	transcript	ENST00000368777.2	protein_coding	2/2	396/615	140/300	47/99	INFO_REALIGN_3_PRIME	chr1	TogoVar
LCNL1_chr9_136977993_136990758	136984956	C C	CGGCCCCT others(12): Show CGGCCCCTCCCTGCCCCTCT	frameshift_variant frameshift_variant	HIGH	HG01074.hp2 HG01109.hp2 HG02559.hp2 others(7): Show HG01074.hp2 HG01109.hp2 HG02559.hp2 HG02572.hp2 HG02886.hp1 HG02976.hp2 HG03139.hp1 HG03225.hp2 HG03453.hp1 HG03486.hp1	a0000 a0000	a0000c0003 a0000c0004 a0000c0003 a0000c0004	a0000c0003t0001 a0000c0004t0001 a0000c0004t0015 a0000c0003t0001 a0000c0004t0001 a0000c0004t0015	a0000c0003t0001g0003 a0000c0003t0001g0008 a0000c0004t0001g0003 others(2): Show a0000c0003t0001g0003 a0000c0003t0001g0008 a0000c0004t0001g0003 a0000c0004t0001g0014 a0000c0004t0015g0003	10	382	0.0262	19	c.441 others(26): Show c.441_459dupGGCCCCTCCCTGCCCCTCT	p.Leu others(5): Show p.Leu154fs	LCNL1	ENSG00000214402.7	transcript	ENST00000408973.3	protein_coding	3/3	1054/1836	460/495	154/164	INFO_REALIGN_3_PRIME	chr9	TogoVar

Search by Variant

Search

Search Results (Total: 5828 hits)