Joint Open Genome and Omics Platform (JoGo)

Search by Variant

Regionname

e.g. ALDH2_chr12_111761933_111822532, HBB_chr11_5220464_5232071.

Chr

Chromosome name (e.g., chr11).

Snpeff genename

Exact SnpEff gene name.

Sampleids

Target sampleid (e.g. HG02615).

Snpeff haplotype class

Haplotype-annotation class (e.g., ahapid, ahapid+chapid).

Snpeff annotation impact

Exact impact level (e.g., HIGH, MODERATE, LOW).

Snpeff annotation impact detail

Keyword match in SnpEff annotation.

Hapid

One or more haplotype IDs (comma-separated; e.g., a0001, a01, a0001c0001, a01c02, a1c2, a0001c0001t0005, a0001c0001t0005g0018).

Samplehapid

Sample haplotype IDs to include (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

No_hapid

Haplotype IDs to exclude (comma-separated; e.g., a0001, a0002, a0001c0001, a0001c0001t0005, a1, a01).

No_samplehapid

Sample haplotype IDs to exclude (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

Start

Start position (GRCh38).

End

End position (GRCh38).

Minac

Minimum alternate allele count (≥).

Maxac

Maximum alternate allele count (≤).

Minlen

Minimum variant length (≥).

Maxlen

Maximum variant length (≤).

Sort By

Select column to sort.

Order by

Ascending or descending.

Show

Results per page.

regionname	pos	ref	alt	annotation	impact	samples	ahapids	achapids	acthapids	actghapids	ac	an	af	len	hgvs_c	hgvs_p	genename	geneid	featuretype	featureid	transcript_biotype	rank	cdna cdna pos length	cds cds pos length	aa aa pos length	status	chr	external
MAGEC2_chrX_142197342_142210290	142202867	C C	CTACAGAT CTACAGAT	frameshift_variant frameshift_variant	HIGH	HG02523.hp2 HG02523.hp2	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0012 a0005c0005t0012	a0005c0005t0012g0024 a0005c0005t0012g0024	1	331	0.0030	7	c.112 others(16): Show c.1120_1121insATCTGTA	p.Ter others(5): Show p.Ter374fs	MAGEC2	ENSG00000046774.10	transcript	ENST00000247452.4	protein_coding	3/3	1468/1994	1120/1122	374/373		chrX	TogoVar
MAGEC2_chrX_142197342_142210290	142202869	C C	CCAATT CCAATT	frameshift_variant frameshift_variant	HIGH	HG02523.hp2 HG02523.hp2	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0012 a0005c0005t0012	a0005c0005t0012g0024 a0005c0005t0012g0024	1	331	0.0030	5	c.111 others(14): Show c.1118_1119insAATTG	p.Ter others(5): Show p.Ter374fs	MAGEC2	ENSG00000046774.10	transcript	ENST00000247452.4	protein_coding	3/3	1466/1994	1118/1122	373/373		chrX	TogoVar
MAGEC2_chrX_142197342_142210290	142202877	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19080.hp2 NA19080.hp2	a0004 a0004	a0004c0006 a0004c0006	a0004c0006t0001 a0004c0006t0001	a0004c0006t0001g0025 a0004c0006t0001g0025	1	331	0.0030	1	c.111 others(5): Show c.1110dupC	p.Phe others(5): Show p.Phe371fs	MAGEC2	ENSG00000046774.10	transcript	ENST00000247452.4	protein_coding	3/3	1458/1994	1110/1122	370/373		chrX	TogoVar
MAGEC2_chrX_142197342_142210290	142202877	A A	ATATT ATATT	frameshift_variant frameshift_variant	HIGH	HG02523.hp2 HG02523.hp2	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0012 a0005c0005t0012	a0005c0005t0012g0024 a0005c0005t0012g0024	1	331	0.0030	4	c.111 others(13): Show c.1110_1111insAATA	p.Phe others(5): Show p.Phe371fs	MAGEC2	ENSG00000046774.10	transcript	ENST00000247452.4	protein_coding	3/3	1458/1994	1110/1122	370/373		chrX	TogoVar
MAGEC2_chrX_142197342_142210290	142202887	GC GC	G G	frameshift_variant frameshift_variant	HIGH	HG02523.hp2 HG02523.hp2	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0012 a0005c0005t0012	a0005c0005t0012g0024 a0005c0005t0012g0024	1	331	0.0030	-1	c.110 others(5): Show c.1100delG	p.Ser others(5): Show p.Ser367fs	MAGEC2	ENSG00000046774.10	transcript	ENST00000247452.4	protein_coding	3/3	1448/1994	1100/1122	367/373		chrX	TogoVar
MAGEC2_chrX_142197342_142210290	142202918	AT AT	A A	frameshift_variant frameshift_variant	HIGH	HG02523.hp2 HG02523.hp2	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0012 a0005c0005t0012	a0005c0005t0012g0024 a0005c0005t0012g0024	1	331	0.0030	-1	c.106 others(5): Show c.1069delA	p.Met others(5): Show p.Met357fs	MAGEC2	ENSG00000046774.10	transcript	ENST00000247452.4	protein_coding	3/3	1417/1994	1069/1122	357/373		chrX	TogoVar
MAGEC2_chrX_142197342_142210290	142202942	TC TC	T T	frameshift_variant frameshift_variant	HIGH	HG02523.hp2 HG02523.hp2	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0012 a0005c0005t0012	a0005c0005t0012g0024 a0005c0005t0012g0024	1	331	0.0030	-1	c.104 others(5): Show c.1045delG	p.Asp others(5): Show p.Asp349fs	MAGEC2	ENSG00000046774.10	transcript	ENST00000247452.4	protein_coding	3/3	1393/1994	1045/1122	349/373		chrX	TogoVar
MAGEC2_chrX_142197342_142210290	142202949	TGGCC TGGCC	T T	frameshift_variant frameshift_variant	HIGH	HG02523.hp2 HG02523.hp2	a0005 a0005	a0005c0005 a0005c0005	a0005c0005t0012 a0005c0005t0012	a0005c0005t0012g0024 a0005c0005t0012g0024	1	331	0.0030	-4	c.103 others(13): Show c.1035_1038delGGCC	p.Ala others(5): Show p.Ala346fs	MAGEC2	ENSG00000046774.10	transcript	ENST00000247452.4	protein_coding	3/3	1386/1994	1035/1122	345/373		chrX	TogoVar
MAGEC2_chrX_142197342_142210290	142203747	C C	CT CT	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0006 a0006	a0006c0003 a0006c0003	a0006c0003t0011 a0006c0003t0011	a0006c0003t0011g0020 a0006c0003t0011g0020	1	331	0.0030	1	c.240 others(8): Show c.240_241insA	p.Glu others(4): Show p.Glu81fs	MAGEC2	ENSG00000046774.10	transcript	ENST00000247452.4	protein_coding	3/3	588/1994	240/1122	80/373		chrX	TogoVar
MAGEC3_chrX_141833316_141902832	141838381	G G	GA GA	frameshift_variant frameshift_variant	HIGH	NA19054.hp1 NA19054.hp1	a0020 a0020	a0020c0029 a0020c0029	a0020c0029t0000 a0020c0029t0000	a0020c0029t0000g0271 a0020c0029t0000g0271	1	298	0.0034	1	c.71d others(3): Show c.71dupA	p.Asn others(4): Show p.Asn24fs	MAGEC3	ENSG00000165509.13	transcript	ENST00000298296.1	protein_coding	1/8	72/1932	72/1932	24/643	INFO_REALIGN_3_PRIME	chrX	TogoVar
MAGEC3_chrX_141833316_141902832	141879368	GCTACACC others(10): Show GCTACACCCTTTCCCTTC	G G	frameshift_variant frameshift_variant	HIGH	HG00639.hp1 HG01175.hp2 HG01934.hp1 others(15): Show HG00639.hp1 HG01175.hp2 HG01934.hp1 HG02615.hp1 HG02630.hp1 HG02630.hp2 HG02886.hp1 HG02895.hp1 HG02897.hp1 HG02976.hp1 HG03130.hp1 HG03139.hp1 HG03540.hp2 HG03834.hp1 HG06807.hp1 NA18906.hp1 NA18906.hp2 NA20300.hp2	a0006 a0006	a0006c0006 a0006c0017 a0006c0026 others(2): Show a0006c0006 a0006c0017 a0006c0026 a0006c0027 a0006c0028	a0006c0006t0000 a0006c0017t0000 a0006c0026t0000 others(2): Show a0006c0006t0000 a0006c0017t0000 a0006c0026t0000 a0006c0027t0000 a0006c0028t0000	a0006c0006t0000g0022 a0006c0006t0000g0069 a0006c0006t0000g0216 others(15): Show a0006c0006t0000g0022 a0006c0006t0000g0069 a0006c0006t0000g0216 a0006c0006t0000g0218 a0006c0006t0000g0219 a0006c0006t0000g0233 a0006c0006t0000g0252 a0006c0006t0000g0256 a0006c0006t0000g0263 a0006c0006t0000g0264 a0006c0006t0000g0265 a0006c0017t0000g0058 a0006c0017t0000g0211 a0006c0017t0000g0212 a0006c0026t0000g0232 a0006c0026t0000g0235 a0006c0027t0000g0204 a0006c0028t0000g0203	18	298	0.0604	-17	c.455 others(24): Show c.455_471delACACCCTTTCCCTTCCT	p.Tyr others(5): Show p.Tyr152fs	MAGEC3	ENSG00000165509.13	transcript	ENST00000298296.1	protein_coding	3/8	455/1932	455/1932	152/643	INFO_REALIGN_3_PRIME	chrX	TogoVar
MAGEC3_chrX_141833316_141902832	141896955	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA18956.hp1 NA18956.hp1	a0024 a0024	a0024c0030 a0024c0030	a0024c0030t0000 a0024c0030t0000	a0024c0030t0000g0105 a0024c0030t0000g0105	1	298	0.0034	-1	c.120 others(5): Show c.1200delC	p.Lys others(5): Show p.Lys401fs	MAGEC3	ENSG00000165509.13	transcript	ENST00000298296.1	protein_coding	7/8	1200/1932	1200/1932	400/643	INFO_REALIGN_3_PRIME	chrX	TogoVar
MAGEC3_chrX_141833316_141902832	141896967	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA18956.hp1 NA18956.hp1	a0024 a0024	a0024c0030 a0024c0030	a0024c0030t0000 a0024c0030t0000	a0024c0030t0000g0105 a0024c0030t0000g0105	1	298	0.0034	-1	c.121 others(5): Show c.1213delC	p.Gln others(5): Show p.Gln405fs	MAGEC3	ENSG00000165509.13	transcript	ENST00000298296.1	protein_coding	7/8	1213/1932	1213/1932	405/643	INFO_REALIGN_3_PRIME	chrX	TogoVar
MAGEC3_chrX_141833316_141902832	141896995	C C	CA CA	frameshift_variant frameshift_variant	HIGH	NA19082.hp1 NA19082.hp1	a0030 a0030	a0030c0045 a0030c0045	a0030c0045t0000 a0030c0045t0000	a0030c0045t0000g0244 a0030c0045t0000g0244	1	298	0.0034	1	c.123 others(5): Show c.1238dupA	p.Ser others(5): Show p.Ser414fs	MAGEC3	ENSG00000165509.13	transcript	ENST00000298296.1	protein_coding	7/8	1239/1932	1239/1932	413/643	INFO_REALIGN_3_PRIME	chrX	TogoVar
MAGEC3_chrX_141833316_141902832	141897025	CT CT	C C	frameshift_variant frameshift_variant	HIGH	NA18956.hp1 NA18956.hp1	a0024 a0024	a0024c0030 a0024c0030	a0024c0030t0000 a0024c0030t0000	a0024c0030t0000g0105 a0024c0030t0000g0105	1	298	0.0034	-1	c.127 others(5): Show c.1271delT	p.Leu others(5): Show p.Leu424fs	MAGEC3	ENSG00000165509.13	transcript	ENST00000298296.1	protein_coding	7/8	1271/1932	1271/1932	424/643	INFO_REALIGN_3_PRIME	chrX	TogoVar
MAGEC3_chrX_141833316_141902832	141897124	CT CT	C C	frameshift_variant frameshift_variant	HIGH	NA18965.hp1 NA18965.hp1	a0027 a0027	a0027c0040 a0027c0040	a0027c0040t0000 a0027c0040t0000	a0027c0040t0000g0138 a0027c0040t0000g0138	1	298	0.0034	-1	c.136 others(5): Show c.1367delT	p.Leu others(5): Show p.Leu456fs	MAGEC3	ENSG00000165509.13	transcript	ENST00000298296.1	protein_coding	7/8	1367/1932	1367/1932	456/643		chrX	TogoVar
MAGEC3_chrX_141833316_141902832	141897252	CG CG	C C	frameshift_variant frameshift_variant	HIGH	NA18956.hp1 NA18956.hp1	a0024 a0024	a0024c0030 a0024c0030	a0024c0030t0000 a0024c0030t0000	a0024c0030t0000g0105 a0024c0030t0000g0105	1	298	0.0034	-1	c.149 others(5): Show c.1497delG	p.Ala others(5): Show p.Ala501fs	MAGEC3	ENSG00000165509.13	transcript	ENST00000298296.1	protein_coding	7/8	1497/1932	1497/1932	499/643	INFO_REALIGN_3_PRIME	chrX	TogoVar
MAGEC3_chrX_141833316_141902832	141897292	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA18956.hp2 NA18956.hp2	a0022 a0022	a0022c0033 a0022c0033	a0022c0033t0000 a0022c0033t0000	a0022c0033t0000g0190 a0022c0033t0000g0190	1	298	0.0034	1	c.153 others(5): Show c.1537dupC	p.Leu others(5): Show p.Leu513fs	MAGEC3	ENSG00000165509.13	transcript	ENST00000298296.1	protein_coding	7/8	1538/1932	1538/1932	513/643	INFO_REALIGN_3_PRIME	chrX	TogoVar
MAGEC3_chrX_141833316_141902832	141897446	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA18956.hp1 NA18956.hp1	a0024 a0024	a0024c0030 a0024c0030	a0024c0030t0000 a0024c0030t0000	a0024c0030t0000g0105 a0024c0030t0000g0105	1	298	0.0034	-1	c.169 others(5): Show c.1692delC	p.Glu others(5): Show p.Glu565fs	MAGEC3	ENSG00000165509.13	transcript	ENST00000298296.1	protein_coding	7/8	1692/1932	1692/1932	564/643	INFO_REALIGN_3_PRIME	chrX	TogoVar
MAGEC3_chrX_141833316_141902832	141897645	CA CA	C C	frameshift_variant frameshift_variant	HIGH	NA19082.hp1 NA19082.hp1	a0030 a0030	a0030c0045 a0030c0045	a0030c0045t0000 a0030c0045t0000	a0030c0045t0000g0244 a0030c0045t0000g0244	1	298	0.0034	-1	c.174 others(5): Show c.1747delA	p.Arg others(5): Show p.Arg583fs	MAGEC3	ENSG00000165509.13	transcript	ENST00000298296.1	protein_coding	8/8	1747/1932	1747/1932	583/643	INFO_REALIGN_3_PRIME	chrX	TogoVar
MAGEC3_chrX_141833316_141902832	141897795	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA18956.hp1 NA18956.hp1	a0024 a0024	a0024c0030 a0024c0030	a0024c0030t0000 a0024c0030t0000	a0024c0030t0000g0105 a0024c0030t0000g0105	1	298	0.0034	-1	c.189 others(5): Show c.1899delC	p.Ser others(5): Show p.Ser634fs	MAGEC3	ENSG00000165509.13	transcript	ENST00000298296.1	protein_coding	8/8	1899/1932	1899/1932	633/643	INFO_REALIGN_3_PRIME	chrX	TogoVar
MAGED1_chrX_51888623_51907354	51895565	TA TA	T T	frameshift_variant frameshift_variant	HIGH	NA19065.hp1 NA19065.hp1	a0002 a0002	a0002c0006 a0002c0006	a0002c0006t0001 a0002c0006t0001	a0002c0006t0001g0001 a0002c0006t0001g0001	1	265	0.0038	-1	c.559 others(4): Show c.559delA	p.Thr others(5): Show p.Thr187fs	MAGED1	ENSG00000179222.18	transcript	ENST00000326587.12	protein_coding	3/13	728/2723	559/2337	187/778		chrX	TogoVar
MAGED1_chrX_51888623_51907354	51895628	TTC TTC	T T	frameshift_variant frameshift_variant	HIGH	NA19065.hp1 NA19065.hp1	a0002 a0002	a0002c0006 a0002c0006	a0002c0006t0001 a0002c0006t0001	a0002c0006t0001g0001 a0002c0006t0001g0001	1	265	0.0038	-2	c.622 others(9): Show c.622_623delTC	p.Ser others(5): Show p.Ser208fs	MAGED1	ENSG00000179222.18	transcript	ENST00000326587.12	protein_coding	3/13	791/2723	622/2337	208/778		chrX	TogoVar
MAGED1_chrX_51888623_51907354	51895637	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19065.hp1 NA19065.hp1	a0002 a0002	a0002c0006 a0002c0006	a0002c0006t0001 a0002c0006t0001	a0002c0006t0001g0001 a0002c0006t0001g0001	1	265	0.0038	1	c.630 others(8): Show c.630_631insC	p.Asp others(5): Show p.Asp211fs	MAGED1	ENSG00000179222.18	transcript	ENST00000326587.12	protein_coding	3/13	800/2723	631/2337	211/778		chrX	TogoVar
MAGED1_chrX_51888623_51907354	51895641	A A	ACTAGC ACTAGC	frameshift_variant frameshift_variant	HIGH	NA19065.hp1 NA19065.hp1	a0002 a0002	a0002c0006 a0002c0006	a0002c0006t0001 a0002c0006t0001	a0002c0006t0001g0001 a0002c0006t0001g0001	1	265	0.0038	5	c.634 others(12): Show c.634_635insCTAGC	p.Ile others(5): Show p.Ile212fs	MAGED1	ENSG00000179222.18	transcript	ENST00000326587.12	protein_coding	3/13	804/2723	635/2337	212/778		chrX	TogoVar
MAGED1_chrX_51888623_51907354	51895646	G G	GT GT	frameshift_variant frameshift_variant	HIGH	NA19065.hp1 NA19065.hp1	a0002 a0002	a0002c0006 a0002c0006	a0002c0006t0001 a0002c0006t0001	a0002c0006t0001g0001 a0002c0006t0001g0001	1	265	0.0038	1	c.639 others(8): Show c.639_640insT	p.Thr others(5): Show p.Thr214fs	MAGED1	ENSG00000179222.18	transcript	ENST00000326587.12	protein_coding	3/13	809/2723	640/2337	214/778		chrX	TogoVar
MAGED1_chrX_51888623_51907354	51895649	C C	CAGGAATA others(24): Show CAGGAATAGACAAATGAGGAACTGGCACTCAG	frameshift_variant frameshift_variant	HIGH	NA19065.hp1 NA19065.hp1	a0002 a0002	a0002c0006 a0002c0006	a0002c0006t0001 a0002c0006t0001	a0002c0006t0001g0001 a0002c0006t0001g0001	1	265	0.0038	31	c.642 others(38): Show c.642_643insAGGAATAGACAAATGAGGAACTGGCACTCAG	p.Asp others(5): Show p.Asp215fs	MAGED1	ENSG00000179222.18	transcript	ENST00000326587.12	protein_coding	3/13	812/2723	643/2337	215/778		chrX	TogoVar
MAGED1_chrX_51888623_51907354	51895653	C C	CTG CTG	frameshift_variant frameshift_variant	HIGH	NA19065.hp1 NA19065.hp1	a0002 a0002	a0002c0006 a0002c0006	a0002c0006t0001 a0002c0006t0001	a0002c0006t0001g0001 a0002c0006t0001g0001	1	265	0.0038	2	c.646 others(9): Show c.646_647insTG	p.Pro others(5): Show p.Pro216fs	MAGED1	ENSG00000179222.18	transcript	ENST00000326587.12	protein_coding	3/13	816/2723	647/2337	216/778		chrX	TogoVar
MAGED1_chrX_51888623_51907354	51895656	G G	GCA GCA	frameshift_variant frameshift_variant	HIGH	NA19065.hp1 NA19065.hp1	a0002 a0002	a0002c0006 a0002c0006	a0002c0006t0001 a0002c0006t0001	a0002c0006t0001g0001 a0002c0006t0001g0001	1	265	0.0038	2	c.649 others(9): Show c.649_650insCA	p.Gly others(5): Show p.Gly217fs	MAGED1	ENSG00000179222.18	transcript	ENST00000326587.12	protein_coding	3/13	819/2723	650/2337	217/778		chrX	TogoVar
MAGED2_chrX_54802745_54821015	54814694	TC TC	T T	frameshift_variant frameshift_variant	HIGH	HG01168.hp1 HG01168.hp1	a0004 a0004	a0004c0013 a0004c0013	a0004c0013t0001 a0004c0013t0001	a0004c0013t0001g0001 a0004c0013t0001g0001	1	319	0.0031	-1	c.131 others(5): Show c.1310delC	p.Pro others(5): Show p.Pro437fs	MAGED2	ENSG00000102316.17	transcript	ENST00000375068.6	protein_coding	11/13	1397/2051	1310/1821	437/606	INFO_REALIGN_3_PRIME	chrX	TogoVar
MAGED2_chrX_54802745_54821015	54815296	A A	AT AT	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0005 a0005	a0005c0012 a0005c0012	a0005c0012t0001 a0005c0012t0001	a0005c0012t0001g0034 a0005c0012t0001g0034	1	319	0.0031	1	c.143 others(5): Show c.1436dupT	p.Met others(5): Show p.Met479fs	MAGED2	ENSG00000102316.17	transcript	ENST00000375068.6	protein_coding	12/13	1524/2051	1437/1821	479/606	INFO_REALIGN_3_PRIME	chrX	TogoVar
MAGED2_chrX_54802745_54821015	54815403	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA18992.hp1 NA18992.hp1	a0006 a0006	a0006c0011 a0006c0011	a0006c0011t0001 a0006c0011t0001	a0006c0011t0001g0001 a0006c0011t0001g0001	1	319	0.0031	-1	c.154 others(5): Show c.1545delC	p.Cys others(5): Show p.Cys516fs	MAGED2	ENSG00000102316.17	transcript	ENST00000375068.6	protein_coding	12/13	1632/2051	1545/1821	515/606	INFO_REALIGN_3_PRIME	chrX	TogoVar
MAGED2_chrX_54802745_54821015	54815432	G G	GA GA	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0005 a0005	a0005c0012 a0005c0012	a0005c0012t0001 a0005c0012t0001	a0005c0012t0001g0034 a0005c0012t0001g0034	1	319	0.0031	1	c.157 others(5): Show c.1572dupA	p.Pro others(5): Show p.Pro525fs	MAGED2	ENSG00000102316.17	transcript	ENST00000375068.6	protein_coding	12/13	1660/2051	1573/1821	525/606	INFO_REALIGN_3_PRIME	chrX	TogoVar
MAGED2_chrX_54802745_54821015	54815440	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0005 a0005	a0005c0012 a0005c0012	a0005c0012t0001 a0005c0012t0001	a0005c0012t0001g0034 a0005c0012t0001g0034	1	319	0.0031	-1	c.158 others(5): Show c.1581delC	p.Ala others(5): Show p.Ala529fs	MAGED2	ENSG00000102316.17	transcript	ENST00000375068.6	protein_coding	12/13	1668/2051	1581/1821	527/606	INFO_REALIGN_3_PRIME	chrX	TogoVar
MAGED2_chrX_54802745_54821015	54815590	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0005 a0005	a0005c0012 a0005c0012	a0005c0012t0001 a0005c0012t0001	a0005c0012t0001g0034 a0005c0012t0001g0034	1	319	0.0031	-1	c.173 others(5): Show c.1731delC	p.Thr others(5): Show p.Thr578fs	MAGED2	ENSG00000102316.17	transcript	ENST00000375068.6	protein_coding	12/13	1818/2051	1731/1821	577/606	INFO_REALIGN_3_PRIME	chrX	TogoVar
MAGED2_chrX_54802745_54821015	54815646	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0005 a0005	a0005c0012 a0005c0012	a0005c0012t0001 a0005c0012t0001	a0005c0012t0001g0034 a0005c0012t0001g0034	1	319	0.0031	1	c.178 others(5): Show c.1787dupG	p.Ser others(5): Show p.Ser597fs	MAGED2	ENSG00000102316.17	transcript	ENST00000375068.6	protein_coding	12/13	1875/2051	1788/1821	596/606	INFO_REALIGN_3_PRIME	chrX	TogoVar
MAGED4B_chrX_52056827_52074183	52062445	AG AG	A A	frameshift_variant frameshift_variant	HIGH	NA19083.hp1 NA19083.hp1	a0008 a0008	a0008c0011 a0008c0011	a0008c0011t0001 a0008c0011t0001	a0008c0011t0001g0052 a0008c0011t0001g0052	1	216	0.0046	-1	c.200 others(5): Show c.2004delC	p.Trp others(5): Show p.Trp669fs	MAGED4B	ENSG00000187243.17	transcript	ENST00000335504.10	protein_coding	12/13	2089/2513	2004/2226	668/741		chrX	TogoVar
MAGED4B_chrX_52056827_52074183	52063041	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0006 a0006	a0006c0010 a0006c0010	a0006c0010t0001 a0006c0010t0001	a0006c0010t0001g0037 a0006c0010t0001g0037	1	216	0.0046	1	c.173 others(5): Show c.1730dupG	p.Leu others(5): Show p.Leu578fs	MAGED4B	ENSG00000187243.17	transcript	ENST00000335504.10	protein_coding	11/13	1815/2513	1730/2226	577/741		chrX	TogoVar
MAGED4B_chrX_52056827_52074183	52066275	C C	CG CG	frameshift_variant frameshift_variant	HIGH	HG00741.hp2 NA19063.hp1 NA19067.hp1 HG00741.hp2 NA19063.hp1 NA19067.hp1	a0002 a0010 a0002 a0010	a0002c0003 a0010c0004 a0002c0003 a0010c0004	a0002c0003t0001 a0010c0004t0001 a0002c0003t0001 a0010c0004t0001	a0002c0003t0001g0026 a0002c0003t0001g0045 a0010c0004t0001g0013 a0002c0003t0001g0026 a0002c0003t0001g0045 a0010c0004t0001g0013	3	216	0.0139	1	c.122 others(5): Show c.1222dupC	p.Arg others(5): Show p.Arg408fs	MAGED4B	ENSG00000187243.17	transcript	ENST00000335504.10	protein_coding	4/13	1307/2513	1222/2226	408/741		chrX	TogoVar
MAGED4B_chrX_52056827_52074183	52067015	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19062.hp1 NA19062.hp1	a0009 a0009	a0009c0005 a0009c0005	a0009c0005t0001 a0009c0005t0001	a0009c0005t0001g0057 a0009c0005t0001g0057	1	216	0.0046	1	c.893 others(4): Show c.893dupC	p.Arg others(5): Show p.Arg299fs	MAGED4B	ENSG00000187243.17	transcript	ENST00000335504.10	protein_coding	3/13	978/2513	893/2226	298/741		chrX	TogoVar
MAGED4B_chrX_52056827_52074183	52067159	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA19083.hp1 NA19083.hp1	a0008 a0008	a0008c0011 a0008c0011	a0008c0011t0001 a0008c0011t0001	a0008c0011t0001g0052 a0008c0011t0001g0052	1	216	0.0046	1	c.749 others(4): Show c.749dupC	p.Arg others(5): Show p.Arg251fs	MAGED4B	ENSG00000187243.17	transcript	ENST00000335504.10	protein_coding	3/13	834/2513	749/2226	250/741		chrX	TogoVar
MAGED4B_chrX_52056827_52074183	52067572	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19062.hp1 NA19062.hp1	a0009 a0009	a0009c0005 a0009c0005	a0009c0005t0001 a0009c0005t0001	a0009c0005t0001g0057 a0009c0005t0001g0057	1	216	0.0046	1	c.336 others(4): Show c.336dupC	p.Ser others(5): Show p.Ser113fs	MAGED4B	ENSG00000187243.17	transcript	ENST00000335504.10	protein_coding	3/13	421/2513	336/2226	112/741		chrX	TogoVar
MAGED4B_chrX_52056827_52074183	52067679	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA19062.hp1 NA19062.hp1	a0009 a0009	a0009c0005 a0009c0005	a0009c0005t0001 a0009c0005t0001	a0009c0005t0001g0057 a0009c0005t0001g0057	1	216	0.0046	-1	c.229 others(4): Show c.229delG	p.Glu others(4): Show p.Glu77fs	MAGED4B	ENSG00000187243.17	transcript	ENST00000335504.10	protein_coding	3/13	314/2513	229/2226	77/741		chrX	TogoVar
MAGED4B_chrX_52056827_52074183	52068093	TC TC	T T	frameshift_variant frameshift_variant	HIGH	HG00741.hp2 HG00741.hp2	a0010 a0010	a0010c0004 a0010c0004	a0010c0004t0001 a0010c0004t0001	a0010c0004t0001g0013 a0010c0004t0001g0013	1	216	0.0046	-1	c.79d others(3): Show c.79delG	p.Glu others(4): Show p.Glu27fs	MAGED4B	ENSG00000187243.17	transcript	ENST00000335504.10	protein_coding	2/13	164/2513	79/2226	27/741		chrX	TogoVar
MAGED4_chrX_52179888_52197268	52185947	C C	CA CA	frameshift_variant frameshift_variant	HIGH	NA18965.hp1 NA18965.hp1	a0005 a0005	a0005c0006 a0005c0006	a0005c0006t0008 a0005c0006t0008	a0005c0006t0008g0014 a0005c0006t0008g0014	1	220	0.0046	1	c.27d others(3): Show c.27dupA	p.Ser others(4): Show p.Ser10fs	MAGED4	ENSG00000154545.17	transcript	ENST00000471932.6	protein_coding	2/13	137/2537	28/2226	10/741	INFO_REALIGN_3_PRIME	chrX	TogoVar
MAGED4_chrX_52179888_52197268	52185953	GA GA	G G	frameshift_variant frameshift_variant	HIGH	NA18982.hp1 NA18982.hp1	a0006 a0006	a0006c0018 a0006c0018	a0006c0018t0002 a0006c0018t0002	a0006c0018t0002g0016 a0006c0018t0002g0016	1	220	0.0046	-1	c.34d others(3): Show c.34delA	p.Ser others(4): Show p.Ser12fs	MAGED4	ENSG00000154545.17	transcript	ENST00000471932.6	protein_coding	2/13	143/2537	34/2226	12/741	INFO_REALIGN_3_PRIME	chrX	TogoVar
MAGED4_chrX_52179888_52197268	52185997	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA18965.hp1 NA18965.hp1	a0005 a0005	a0005c0006 a0005c0006	a0005c0006t0008 a0005c0006t0008	a0005c0006t0008g0014 a0005c0006t0008g0014	1	220	0.0046	1	c.79d others(3): Show c.79dupG	p.Glu others(4): Show p.Glu27fs	MAGED4	ENSG00000154545.17	transcript	ENST00000471932.6	protein_coding	2/13	189/2537	80/2226	27/741	INFO_REALIGN_3_PRIME	chrX	TogoVar
MAGED4_chrX_52179888_52197268	52185997	C C	CT CT	frameshift_variant frameshift_variant	HIGH	NA18982.hp1 NA18982.hp1	a0006 a0006	a0006c0018 a0006c0018	a0006c0018t0002 a0006c0018t0002	a0006c0018t0002g0016 a0006c0018t0002g0016	1	220	0.0046	1	c.75_ others(6): Show c.75_76insT	p.Gly others(4): Show p.Gly26fs	MAGED4	ENSG00000154545.17	transcript	ENST00000471932.6	protein_coding	2/13	185/2537	76/2226	26/741		chrX	TogoVar
MAGED4_chrX_52179888_52197268	52186525	CA CA	C C	frameshift_variant frameshift_variant	HIGH	NA18965.hp1 NA18965.hp1	a0005 a0005	a0005c0006 a0005c0006	a0005c0006t0008 a0005c0006t0008	a0005c0006t0008g0014 a0005c0006t0008g0014	1	220	0.0046	-1	c.341 others(4): Show c.341delA	p.Asn others(5): Show p.Asn114fs	MAGED4	ENSG00000154545.17	transcript	ENST00000471932.6	protein_coding	3/13	450/2537	341/2226	114/741	INFO_REALIGN_3_PRIME	chrX	TogoVar
MAGED4_chrX_52179888_52197268	52186547	G G	GC GC	frameshift_variant frameshift_variant	HIGH	HG03654.hp1 HG03654.hp1	a0011 a0011	a0011c0007 a0011c0007	a0011c0007t0001 a0011c0007t0001	a0011c0007t0001g0052 a0011c0007t0001g0052	1	220	0.0046	1	c.363 others(4): Show c.363dupC	p.Ala others(5): Show p.Ala122fs	MAGED4	ENSG00000154545.17	transcript	ENST00000471932.6	protein_coding	3/13	473/2537	364/2226	122/741	INFO_REALIGN_3_PRIME	chrX	TogoVar

Search by Variant

Search

Search Results (Total: 5828 hits)