Joint Open Genome and Omics Platform (JoGo)

Search by Variant

Regionname

e.g. ALDH2_chr12_111761933_111822532, HBB_chr11_5220464_5232071.

Chr

Chromosome name (e.g., chr11).

Snpeff genename

Exact SnpEff gene name.

Sampleids

Target sampleid (e.g. HG02615).

Snpeff haplotype class

Haplotype-annotation class (e.g., ahapid, ahapid+chapid).

Snpeff annotation impact

Exact impact level (e.g., HIGH, MODERATE, LOW).

Snpeff annotation impact detail

Keyword match in SnpEff annotation.

Hapid

One or more haplotype IDs (comma-separated; e.g., a0001, a01, a0001c0001, a01c02, a1c2, a0001c0001t0005, a0001c0001t0005g0018).

Samplehapid

Sample haplotype IDs to include (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

No_hapid

Haplotype IDs to exclude (comma-separated; e.g., a0001, a0002, a0001c0001, a0001c0001t0005, a1, a01).

No_samplehapid

Sample haplotype IDs to exclude (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

Start

Start position (GRCh38).

End

End position (GRCh38).

Minac

Minimum alternate allele count (≥).

Maxac

Maximum alternate allele count (≤).

Minlen

Minimum variant length (≥).

Maxlen

Maximum variant length (≤).

Sort By

Select column to sort.

Order by

Ascending or descending.

Show

Results per page.

regionname	pos	ref	alt	annotation	impact	samples	ahapids	achapids	acthapids	actghapids	ac	an	af	len	hgvs_c	hgvs_p	genename	geneid	featuretype	featureid	transcript_biotype	rank	cdna cdna pos length	cds cds pos length	aa aa pos length	status	chr	external
MBTPS2_chrX_21834617_21890423	21878125	A A	AAC AAC	frameshift_variant frameshift_variant	HIGH	NA19078.hp1 NA19078.hp1	a0003 a0003	a0003c0006 a0003c0006	a0003c0006t0001 a0003c0006t0001	a0003c0006t0001g0193 a0003c0006t0001g0193	1	308	0.0033	2	c.105 others(11): Show c.1055_1056insCA	p.Lys others(5): Show p.Lys353fs	MBTPS2	ENSG00000012174.12	transcript	ENST00000379484.10	protein_coding	8/11	1174/4446	1056/1560	352/519	INFO_REALIGN_3_PRIME	chrX	TogoVar
MBTPS2_chrX_21834617_21890423	21878130	G G	GT GT	frameshift_variant frameshift_variant	HIGH	NA19078.hp1 NA19078.hp1	a0003 a0003	a0003c0006 a0003c0006	a0003c0006t0001 a0003c0006t0001	a0003c0006t0001g0193 a0003c0006t0001g0193	1	308	0.0033	1	c.105 others(10): Show c.1059_1060insT	p.Arg others(5): Show p.Arg354fs	MBTPS2	ENSG00000012174.12	transcript	ENST00000379484.10	protein_coding	8/11	1178/4446	1060/1560	354/519		chrX	TogoVar
MBTPS2_chrX_21834617_21890423	21880915	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA18978.hp1 NA18978.hp1	a0002 a0002	a0002c0004 a0002c0004	a0002c0004t0002 a0002c0004t0002	a0002c0004t0002g0043 a0002c0004t0002g0043	1	308	0.0033	-1	c.128 others(5): Show c.1283delC	p.Pro others(5): Show p.Pro428fs	MBTPS2	ENSG00000012174.12	transcript	ENST00000379484.10	protein_coding	10/11	1401/4446	1283/1560	428/519	INFO_REALIGN_3_PRIME	chrX	TogoVar
MCF2_chrX_139576770_139713167	139587771	G G	GGT GGT	frameshift_variant frameshift_variant	HIGH	NA18985.hp1 NA18985.hp1	a0003 a0003	a0003c0007 a0003c0007	a0003c0007t0001 a0003c0007t0001	a0003c0007t0001g0026 a0003c0007t0001g0026	1	249	0.0040	2	c.269 others(11): Show c.2694_2695insAC	p.Gln others(5): Show p.Gln899fs	MCF2	ENSG00000101977.22	transcript	ENST00000519895.6	protein_coding	26/29	2800/3813	2694/3006	898/1001		chrX	TogoVar
MCF2_chrX_139576770_139713167	139587779	C C	CT CT	frameshift_variant frameshift_variant	HIGH	NA18985.hp1 NA18985.hp1	a0003 a0003	a0003c0007 a0003c0007	a0003c0007t0001 a0003c0007t0001	a0003c0007t0001g0026 a0003c0007t0001g0026	1	249	0.0040	1	c.268 others(5): Show c.2686dupA	p.Arg others(5): Show p.Arg896fs	MCF2	ENSG00000101977.22	transcript	ENST00000519895.6	protein_coding	26/29	2792/3813	2686/3006	896/1001		chrX	TogoVar
MCTS1_chrX_120599101_120626159	120608280	C C	CA CA	frameshift_variant frameshift_variant	HIGH	NA18985.hp1 NA18985.hp1	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0062 a0002c0002t0062	a0002c0002t0062g0027 a0002c0002t0062g0027	1	316	0.0032	1	c.319 others(4): Show c.319dupA	p.Ser others(5): Show p.Ser107fs	MCTS1	ENSG00000232119.8	transcript	ENST00000371317.10	protein_coding	4/6	456/9577	320/546	107/181	INFO_REALIGN_3_PRIME	chrX	TogoVar
MCTS1_chrX_120599101_120626159	120612204	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA18985.hp1 NA18985.hp1	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0062 a0002c0002t0062	a0002c0002t0062g0027 a0002c0002t0062g0027	1	316	0.0032	1	c.488 others(4): Show c.488dupG	p.Ile others(5): Show p.Ile164fs	MCTS1	ENSG00000232119.8	transcript	ENST00000371317.10	protein_coding	6/6	625/9577	489/546	163/181	INFO_REALIGN_3_PRIME	chrX	TogoVar
MCTS2_chr20_31542379_31553081	31547569	TAAGGGCA others(7): Show TAAGGGCATTAAGAG	T T	frameshift_variant frameshift_variant	HIGH	NA19055.hp1 NA19055.hp1	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0001 a0002c0002t0001	a0002c0002t0001g0000 a0002c0002t0001g0000	1	350	0.0029	-14	c.67_ others(19): Show c.67_80delAAGGGCATTAAGAG	p.Lys others(4): Show p.Lys23fs	MCTS2	ENSG00000101898.7	transcript	ENST00000394552.4	protein_coding	1/1	192/703	67/546	23/181		chr20	TogoVar
MDP1_chr14_24208943_24221066	24214060	CA CA	C C	frameshift_variant frameshift_variant	HIGH	HG00140.hp1 HG00280.hp1 HG00423.hp1 others(92): Show HG00140.hp1 HG00280.hp1 HG00423.hp1 HG00438.hp1 HG00597.hp1 HG00621.hp2 HG00733.hp1 HG01069.hp1 HG01071.hp2 HG01081.hp2 HG01109.hp2 HG01346.hp2 HG01361.hp1 HG01884.hp1 HG01891.hp1 HG02027.hp2 HG02055.hp1 HG02055.hp2 HG02071.hp2 HG02129.hp2 HG02135.hp2 HG02155.hp1 HG02165.hp2 HG02258.hp2 HG02280.hp1 HG02300.hp1 HG02486.hp2 HG02572.hp2 HG02615.hp1 HG02615.hp2 HG02622.hp2 HG02647.hp1 HG02647.hp2 HG02683.hp1 HG02723.hp1 HG02809.hp1 HG02809.hp2 HG02818.hp1 HG02818.hp2 HG02886.hp2 HG02895.hp2 HG02897.hp1 HG02922.hp2 HG03041.hp1 HG03130.hp1 HG03130.hp2 HG03139.hp1 HG03195.hp1 HG03209.hp1 HG03209.hp2 HG03225.hp2 HG03239.hp2 HG03453.hp1 HG03579.hp1 HG03927.hp1 HG03942.hp1 HG04199.hp1 HG06807.hp1 NA18747.hp1 NA18906.hp1 NA18941.hp1 NA18942.hp1 NA18943.hp1 NA18946.hp2 NA18947.hp2 NA18954.hp1 NA18957.hp1 NA18959.hp1 NA18965.hp2 NA18967.hp2 NA18968.hp1 NA18974.hp1 NA18975.hp1 NA18977.hp1 NA18979.hp2 NA18989.hp1 NA18994.hp1 NA19000.hp2 NA19001.hp2 NA19002.hp2 NA19003.hp2 NA19006.hp2 NA19030.hp1 NA19043.hp1 NA19056.hp1 NA19058.hp1 NA19072.hp1 NA19077.hp1 NA19082.hp1 NA19086.hp1 NA19088.hp1 NA19240.hp1 NA20129.hp1 NA20752.hp1 homoSapiens_chm13v2.hp1	a0002 a0004 a0002 a0004	a0002c0002 a0002c0004 a0004c0005 a0002c0002 a0002c0004 a0004c0005	a0002c0002t0001 a0002c0002t0002 a0002c0004t0001 others(1): Show a0002c0002t0001 a0002c0002t0002 a0002c0004t0001 a0004c0005t0004	a0002c0002t0001g0004 a0002c0002t0001g0006 a0002c0002t0001g0009 others(11): Show a0002c0002t0001g0004 a0002c0002t0001g0006 a0002c0002t0001g0009 a0002c0002t0001g0012 a0002c0002t0001g0014 a0002c0002t0001g0016 a0002c0002t0001g0018 a0002c0002t0001g0020 a0002c0002t0001g0022 a0002c0002t0001g0024 a0002c0002t0001g0028 a0002c0002t0002g0011 a0002c0004t0001g0030 a0004c0005t0004g0023	95	404	0.2352	-1	c.494 others(4): Show c.494delT	p.Leu others(5): Show p.Leu165fs	MDP1	ENSG00000213920.9	transcript	ENST00000288087.12	protein_coding	6/6	605/723	494/531	165/176		chr14	TogoVar
ME3_chr11_86436108_86677616	86671820	C C	CCCCTGAA others(3): Show CCCCTGAAGAA	frameshift_variant frameshift_variant	HIGH	NA19002.hp2 NA19002.hp2	a0004 a0004	a0004c0016 a0004c0016	a0004c0016t0002 a0004c0016t0002	a0004c0016t0002g0211 a0004c0016t0002g0211	1	320	0.0031	10	c.124 others(17): Show c.124_125insTTCTTCAGGG	p.Arg others(4): Show p.Arg42fs	ME3	ENSG00000151376.19	transcript	ENST00000543262.6	protein_coding	2/15	431/2293	124/1815	42/604		chr11	TogoVar
ME3_chr11_86436108_86677616	86671875	GCGGGAGG others(4): Show GCGGGAGGGCGC	G G	frameshift_variant frameshift_variant	HIGH	NA19002.hp2 NA19002.hp2	a0004 a0004	a0004c0016 a0004c0016	a0004c0016t0002 a0004c0016t0002	a0004c0016t0002g0211 a0004c0016t0002g0211	1	320	0.0031	-11	c.59_ others(16): Show c.59_69delGCGCCCTCCCG	p.Gly others(4): Show p.Gly20fs	ME3	ENSG00000151376.19	transcript	ENST00000543262.6	protein_coding	2/15	376/2293	59/1815	20/604		chr11	TogoVar
MECP2_chrX_154016573_154102717	154030664	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19090.hp1 NA19090.hp1	a0005 a0005	a0005c0007 a0005c0007	a0005c0007t0002 a0005c0007t0002	a0005c0007t0002g0110 a0005c0007t0002g0110	1	230	0.0044	1	c.116 others(5): Show c.1163dupC	p.Pro others(5): Show p.Pro389fs	MECP2	ENSG00000169057.25	transcript	ENST00000303391.11	protein_coding	4/4	1375/10467	1163/1461	388/486		chrX	TogoVar
MED12L_chr3_151080664_151441653	151365952	TCACGTGT others(22): Show TCACGTGTGGGGGTTTAATGATGTACTTTG	T T	frameshift_variant frameshift_variant	HIGH	NA19077.hp2 NA19077.hp2	a0005 a0005	a0005c0034 a0005c0034	a0005c0034t0001 a0005c0034t0001	a0005c0034t0001g0198 a0005c0034t0001g0198	1	280	0.0036	-29	c.329 others(38): Show c.3292_3320delGTGTGGGGGTTTAATGATGTACTTTGCAC	p.Val others(6): Show p.Val1098fs	MED12L	ENSG00000144893.13	transcript	ENST00000687756.1	protein_coding	23/45	3694/10794	3292/6543	1098/2180	INFO_REALIGN_3_PRIME	chr3	TogoVar
MED12_chrX_71113596_71147450	71119710	A A	AT AT	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0013 a0013	a0013c0025 a0013c0025	a0013c0025t0001 a0013c0025t0001	a0013c0025t0001g0036 a0013c0025t0001g0036	1	273	0.0037	1	c.231 others(4): Show c.231dupT	p.Ala others(4): Show p.Ala78fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	3/45	391/6925	232/6534	78/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71121023	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0013 a0013	a0013c0025 a0013c0025	a0013c0025t0001 a0013c0025t0001	a0013c0025t0001g0036 a0013c0025t0001g0036	1	273	0.0037	1	c.607 others(4): Show c.607dupG	p.Glu others(5): Show p.Glu203fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	5/45	767/6925	608/6534	203/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71121062	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0013 a0013	a0013c0025 a0013c0025	a0013c0025t0001 a0013c0025t0001	a0013c0025t0001g0036 a0013c0025t0001g0036	1	273	0.0037	-1	c.647 others(4): Show c.647delG	p.Gly others(5): Show p.Gly216fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	5/45	806/6925	647/6534	216/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71121123	AC AC	A A	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0013 a0013	a0013c0025 a0013c0025	a0013c0025t0001 a0013c0025t0001	a0013c0025t0001g0036 a0013c0025t0001g0036	1	273	0.0037	-1	c.708 others(4): Show c.708delC	p.Glu others(5): Show p.Glu237fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	5/45	867/6925	708/6534	236/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71121577	G G	GT GT	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0013 a0013	a0013c0025 a0013c0025	a0013c0025t0001 a0013c0025t0001	a0013c0025t0001g0036 a0013c0025t0001g0036	1	273	0.0037	1	c.864 others(4): Show c.864dupT	p.Gln others(5): Show p.Gln289fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	7/45	1024/6925	865/6534	289/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71121631	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19056.hp1 NA19056.hp1	a0012 a0012	a0012c0010 a0012c0010	a0012c0010t0001 a0012c0010t0001	a0012c0010t0001g0127 a0012c0010t0001g0127	1	273	0.0037	1	c.919 others(4): Show c.919dupC	p.Leu others(5): Show p.Leu307fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	7/45	1079/6925	920/6534	307/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71122200	A A	AC AC	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0013 a0013	a0013c0025 a0013c0025	a0013c0025t0001 a0013c0025t0001	a0013c0025t0001g0036 a0013c0025t0001g0036	1	273	0.0037	1	c.110 others(5): Show c.1104dupC	p.Ile others(5): Show p.Ile369fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	8/45	1264/6925	1105/6534	369/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71122209	CT CT	C C	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0013 a0013	a0013c0025 a0013c0025	a0013c0025t0001 a0013c0025t0001	a0013c0025t0001g0036 a0013c0025t0001g0036	1	273	0.0037	-1	c.111 others(5): Show c.1112delT	p.Leu others(5): Show p.Leu371fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	8/45	1271/6925	1112/6534	371/2177		chrX	TogoVar
MED12_chrX_71113596_71147450	71122245	C C	CT CT	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0013 a0013	a0013c0025 a0013c0025	a0013c0025t0001 a0013c0025t0001	a0013c0025t0001g0036 a0013c0025t0001g0036	1	273	0.0037	1	c.114 others(5): Show c.1148dupT	p.Thr others(5): Show p.Thr384fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	8/45	1308/6925	1149/6534	383/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71122250	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0013 a0013	a0013c0025 a0013c0025	a0013c0025t0001 a0013c0025t0001	a0013c0025t0001g0036 a0013c0025t0001g0036	1	273	0.0037	1	c.115 others(5): Show c.1153dupG	p.Asp others(5): Show p.Asp385fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	8/45	1313/6925	1154/6534	385/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71122296	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0013 a0013	a0013c0025 a0013c0025	a0013c0025t0001 a0013c0025t0001	a0013c0025t0001g0036 a0013c0025t0001g0036	1	273	0.0037	-1	c.120 others(5): Show c.1202delC	p.Pro others(5): Show p.Pro401fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	8/45	1361/6925	1202/6534	401/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71122306	AC AC	A A	frameshift_variant frameshift_variant	HIGH	NA19059.hp2 NA19059.hp2	a0004 a0004	a0004c0023 a0004c0023	a0004c0023t0001 a0004c0023t0001	a0004c0023t0001g0047 a0004c0023t0001g0047	1	273	0.0037	-1	c.121 others(5): Show c.1210delC	p.Leu others(5): Show p.Leu404fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	8/45	1369/6925	1210/6534	404/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71123656	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA19086.hp1 NA19086.hp1	a0011 a0011	a0011c0011 a0011c0011	a0011c0011t0001 a0011c0011t0001	a0011c0011t0001g0031 a0011c0011t0001g0031	1	273	0.0037	-1	c.168 others(5): Show c.1683delC	p.Ser others(5): Show p.Ser562fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	12/45	1842/6925	1683/6534	561/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71123710	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA19059.hp2 NA19059.hp2	a0004 a0004	a0004c0023 a0004c0023	a0004c0023t0001 a0004c0023t0001	a0004c0023t0001g0047 a0004c0023t0001g0047	1	273	0.0037	-1	c.173 others(5): Show c.1737delC	p.Met others(5): Show p.Met580fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	12/45	1896/6925	1737/6534	579/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71124214	C C	CAT CAT	frameshift_variant frameshift_variant	HIGH	NA18940.hp1 NA18940.hp1	a0010 a0010	a0010c0012 a0010c0012	a0010c0012t0001 a0010c0012t0001	a0010c0012t0001g0051 a0010c0012t0001g0051	1	273	0.0037	2	c.180 others(11): Show c.1800_1801insAT	p.Cys others(5): Show p.Cys601fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	13/45	1960/6925	1801/6534	601/2177		chrX	TogoVar
MED12_chrX_71113596_71147450	71124219	AAC AAC	A A	frameshift_variant frameshift_variant	HIGH	NA18940.hp1 NA18940.hp1	a0010 a0010	a0010c0012 a0010c0012	a0010c0012t0001 a0010c0012t0001	a0010c0012t0001g0051 a0010c0012t0001g0051	1	273	0.0037	-2	c.180 others(11): Show c.1806_1807delAC	p.Glu others(5): Show p.Glu602fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	13/45	1965/6925	1806/6534	602/2177		chrX	TogoVar
MED12_chrX_71113596_71147450	71125058	C C	CT CT	frameshift_variant frameshift_variant	HIGH	NA18940.hp1 NA18940.hp1	a0010 a0010	a0010c0012 a0010c0012	a0010c0012t0001 a0010c0012t0001	a0010c0012t0001g0051 a0010c0012t0001g0051	1	273	0.0037	1	c.213 others(10): Show c.2138_2139insT	p.Pro others(5): Show p.Pro714fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	15/45	2298/6925	2139/6534	713/2177		chrX	TogoVar
MED12_chrX_71113596_71147450	71125071	GA GA	G G	frameshift_variant frameshift_variant	HIGH	NA18940.hp1 NA18940.hp1	a0010 a0010	a0010c0012 a0010c0012	a0010c0012t0001 a0010c0012t0001	a0010c0012t0001g0051 a0010c0012t0001g0051	1	273	0.0037	-1	c.215 others(5): Show c.2152delA	p.Ile others(5): Show p.Ile718fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	15/45	2311/6925	2152/6534	718/2177		chrX	TogoVar
MED12_chrX_71113596_71147450	71126347	CG CG	C C	frameshift_variant frameshift_variant	HIGH	NA18940.hp1 NA18940.hp1	a0010 a0010	a0010c0012 a0010c0012	a0010c0012t0001 a0010c0012t0001	a0010c0012t0001g0051 a0010c0012t0001g0051	1	273	0.0037	-1	c.255 others(5): Show c.2550delG	p.Asn others(5): Show p.Asn851fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	19/45	2709/6925	2550/6534	850/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71126380	CT CT	C C	frameshift_variant frameshift_variant	HIGH	NA18940.hp1 NA18940.hp1	a0010 a0010	a0010c0012 a0010c0012	a0010c0012t0001 a0010c0012t0001	a0010c0012t0001g0051 a0010c0012t0001g0051	1	273	0.0037	-1	c.258 others(5): Show c.2583delT	p.Gly others(5): Show p.Gly862fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	19/45	2742/6925	2583/6534	861/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71127903	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA18940.hp1 NA18940.hp1	a0010 a0010	a0010c0012 a0010c0012	a0010c0012t0001 a0010c0012t0001	a0010c0012t0001g0051 a0010c0012t0001g0051	1	273	0.0037	1	c.299 others(5): Show c.2993dupC	p.Val others(6): Show p.Val1000fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	22/45	3153/6925	2994/6534	998/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71133169	CA CA	C C	frameshift_variant frameshift_variant	HIGH	NA19059.hp2 NA19059.hp2	a0004 a0004	a0004c0023 a0004c0023	a0004c0023t0001 a0004c0023t0001	a0004c0023t0001g0047 a0004c0023t0001g0047	1	273	0.0037	-1	c.457 others(5): Show c.4577delA	p.Lys others(6): Show p.Lys1526fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	33/45	4736/6925	4577/6534	1526/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71133203	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19059.hp2 NA19059.hp2	a0004 a0004	a0004c0023 a0004c0023	a0004c0023t0001 a0004c0023t0001	a0004c0023t0001g0047 a0004c0023t0001g0047	1	273	0.0037	1	c.460 others(5): Show c.4609dupC	p.Leu others(6): Show p.Leu1537fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	33/45	4769/6925	4610/6534	1537/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71134358	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0006 a0006	a0006c0019 a0006c0019	a0006c0019t0001 a0006c0019t0001	a0006c0019t0001g0087 a0006c0019t0001g0087	1	273	0.0037	1	c.462 others(5): Show c.4625dupG	p.Met others(6): Show p.Met1543fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	34/45	4785/6925	4626/6534	1542/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71134764	AT AT	A A	frameshift_variant frameshift_variant	HIGH	NA19059.hp2 NA19059.hp2	a0004 a0004	a0004c0023 a0004c0023	a0004c0023t0001 a0004c0023t0001	a0004c0023t0001g0047 a0004c0023t0001g0047	1	273	0.0037	-1	c.478 others(5): Show c.4781delT	p.Leu others(6): Show p.Leu1594fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	35/45	4940/6925	4781/6534	1594/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71136330	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19001.hp2 NA19001.hp2	a0008 a0008	a0008c0016 a0008c0016	a0008c0016t0001 a0008c0016t0001	a0008c0016t0001g0122 a0008c0016t0001g0122	1	273	0.0037	1	c.507 others(5): Show c.5079dupG	p.Leu others(6): Show p.Leu1694fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	37/45	5239/6925	5080/6534	1694/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71136624	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19059.hp2 NA19059.hp2	a0004 a0004	a0004c0023 a0004c0023	a0004c0023t0001 a0004c0023t0001	a0004c0023t0001g0047 a0004c0023t0001g0047	1	273	0.0037	1	c.537 others(5): Show c.5370dupG	p.Lys others(6): Show p.Lys1791fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	37/45	5530/6925	5371/6534	1791/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71136633	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19059.hp2 NA19059.hp2	a0004 a0004	a0004c0023 a0004c0023	a0004c0023t0001 a0004c0023t0001	a0004c0023t0001g0047 a0004c0023t0001g0047	1	273	0.0037	1	c.538 others(5): Show c.5380dupC	p.Gln others(6): Show p.Gln1794fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	37/45	5540/6925	5381/6534	1794/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71136905	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA19059.hp2 NA19059.hp2	a0004 a0004	a0004c0023 a0004c0023	a0004c0023t0001 a0004c0023t0001	a0004c0023t0001g0047 a0004c0023t0001g0047	1	273	0.0037	1	c.542 others(5): Show c.5429dupG	p.Tyr others(6): Show p.Tyr1812fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	38/45	5589/6925	5430/6534	1810/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71137269	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19059.hp2 NA19059.hp2	a0004 a0004	a0004c0023 a0004c0023	a0004c0023t0001 a0004c0023t0001	a0004c0023t0001g0047 a0004c0023t0001g0047	1	273	0.0037	-1	c.563 others(5): Show c.5637delC	p.Thr others(6): Show p.Thr1880fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	39/45	5796/6925	5637/6534	1879/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71137314	TA TA	T T	frameshift_variant frameshift_variant	HIGH	NA19059.hp2 NA19059.hp2	a0004 a0004	a0004c0023 a0004c0023	a0004c0023t0001 a0004c0023t0001	a0004c0023t0001g0047 a0004c0023t0001g0047	1	273	0.0037	-1	c.568 others(5): Show c.5681delA	p.Lys others(6): Show p.Lys1894fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	39/45	5840/6925	5681/6534	1894/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71137323	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19059.hp2 NA19059.hp2	a0004 a0004	a0004c0023 a0004c0023	a0004c0023t0001 a0004c0023t0001	a0004c0023t0001g0047 a0004c0023t0001g0047	1	273	0.0037	1	c.568 others(5): Show c.5689dupG	p.Val others(6): Show p.Val1897fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	39/45	5849/6925	5690/6534	1897/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71137324	G G	GT GT	frameshift_variant frameshift_variant	HIGH	NA19001.hp2 NA19001.hp2	a0008 a0008	a0008c0016 a0008c0016	a0008c0016t0001 a0008c0016t0001	a0008c0016t0001g0122 a0008c0016t0001g0122	1	273	0.0037	1	c.569 others(5): Show c.5690dupT	p.Tyr others(6): Show p.Tyr1898fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	39/45	5850/6925	5691/6534	1897/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71137350	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19059.hp2 NA19059.hp2	a0004 a0004	a0004c0023 a0004c0023	a0004c0023t0001 a0004c0023t0001	a0004c0023t0001g0047 a0004c0023t0001g0047	1	273	0.0037	-1	c.571 others(5): Show c.5719delC	p.Gln others(6): Show p.Gln1907fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	39/45	5878/6925	5719/6534	1907/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71137906	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19059.hp1 NA19059.hp1	a0007 a0007	a0007c0018 a0007c0018	a0007c0018t0001 a0007c0018t0001	a0007c0018t0001g0150 a0007c0018t0001g0150	1	273	0.0037	1	c.601 others(5): Show c.6012dupC	p.Thr others(6): Show p.Thr2005fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	41/45	6172/6925	6013/6534	2005/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar
MED12_chrX_71113596_71147450	71140651	C C	CA CA	frameshift_variant frameshift_variant	HIGH	NA19001.hp2 NA19001.hp2	a0008 a0008	a0008c0016 a0008c0016	a0008c0016t0001 a0008c0016t0001	a0008c0016t0001g0122 a0008c0016t0001g0122	1	273	0.0037	1	c.606 others(10): Show c.6061_6062insA	p.Leu others(6): Show p.Leu2021fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	42/45	6221/6925	6062/6534	2021/2177		chrX	TogoVar
MED12_chrX_71113596_71147450	71140717	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA19001.hp2 NA19001.hp2	a0008 a0008	a0008c0016 a0008c0016	a0008c0016t0001 a0008c0016t0001	a0008c0016t0001g0122 a0008c0016t0001g0122	1	273	0.0037	1	c.612 others(5): Show c.6128dupG	p.Ser others(6): Show p.Ser2044fs	MED12	ENSG00000184634.17	transcript	ENST00000374080.8	protein_coding	42/45	6288/6925	6129/6534	2043/2177	INFO_REALIGN_3_PRIME	chrX	TogoVar

Search by Variant

Search

Search Results (Total: 5828 hits)