Joint Open Genome and Omics Platform (JoGo)

Search by Variant

Regionname

e.g. ALDH2_chr12_111761933_111822532, HBB_chr11_5220464_5232071.

Chr

Chromosome name (e.g., chr11).

Snpeff genename

Exact SnpEff gene name.

Sampleids

Target sampleid (e.g. HG02615).

Snpeff haplotype class

Haplotype-annotation class (e.g., ahapid, ahapid+chapid).

Snpeff annotation impact

Exact impact level (e.g., HIGH, MODERATE, LOW).

Snpeff annotation impact detail

Keyword match in SnpEff annotation.

Hapid

One or more haplotype IDs (comma-separated; e.g., a0001, a01, a0001c0001, a01c02, a1c2, a0001c0001t0005, a0001c0001t0005g0018).

Samplehapid

Sample haplotype IDs to include (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

No_hapid

Haplotype IDs to exclude (comma-separated; e.g., a0001, a0002, a0001c0001, a0001c0001t0005, a1, a01).

No_samplehapid

Sample haplotype IDs to exclude (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

Start

Start position (GRCh38).

End

End position (GRCh38).

Minac

Minimum alternate allele count (≥).

Maxac

Maximum alternate allele count (≤).

Minlen

Minimum variant length (≥).

Maxlen

Maximum variant length (≤).

Sort By

Select column to sort.

Order by

Ascending or descending.

Show

Results per page.

regionname	pos	ref	alt	annotation	impact	samples	ahapids	achapids	acthapids	actghapids	ac	an	af	len	hgvs_c	hgvs_p	genename	geneid	featuretype	featureid	transcript_biotype	rank	cdna cdna pos length	cds cds pos length	aa aa pos length	status	chr	external
NDUFA13_chr19_19511225_19533198	19527707	G G	GGCGGGCG others(22): Show GGCGGGCGGGAGGGAGGGCCGATCGGGTCC	frameshift_variant frameshift_variant	HIGH	HG01496.hp1 HG01496.hp1	a0002 a0002	a0002c0003 a0002c0003	a0002c0003t0001 a0002c0003t0001	a0002c0003t0001g0165 a0002c0003t0001g0165	1	380	0.0026	29	c.252 others(36): Show c.252_253insGCGGGCGGGAGGGAGGGCCGATCGGGTCC	p.Gln others(4): Show p.Gln85fs	NDUFA13	ENSG00000186010.19	transcript	ENST00000507754.9	protein_coding	4/5	267/521	253/435	85/144		chr19	TogoVar
NDUFB11_chrX_47137216_47149702	47142373	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19086.hp1 NA19086.hp1	a0004 a0004	a0004c0002 a0004c0002	a0004c0002t0001 a0004c0002t0001	a0004c0002t0001g0038 a0004c0002t0001g0038	1	274	0.0037	-1	c.405 others(4): Show c.405delC	p.Ile others(5): Show p.Ile136fs	NDUFB11	ENSG00000147123.12	transcript	ENST00000377811.4	protein_coding	3/3	428/586	405/462	135/153		chrX	TogoVar
NDUFB11_chrX_47137216_47149702	47142380	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19086.hp1 NA19086.hp1	a0004 a0004	a0004c0002 a0004c0002	a0004c0002t0001 a0004c0002t0001	a0004c0002t0001g0038 a0004c0002t0001g0038	1	274	0.0037	-1	c.398 others(4): Show c.398delG	p.Gly others(5): Show p.Gly133fs	NDUFB11	ENSG00000147123.12	transcript	ENST00000377811.4	protein_coding	3/3	421/586	398/462	133/153		chrX	TogoVar
NDUFB11_chrX_47137216_47149702	47142432	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19086.hp1 NA19086.hp1	a0004 a0004	a0004c0002 a0004c0002	a0004c0002t0001 a0004c0002t0001	a0004c0002t0001g0038 a0004c0002t0001g0038	1	274	0.0037	1	c.346 others(4): Show c.346dupG	p.Glu others(5): Show p.Glu116fs	NDUFB11	ENSG00000147123.12	transcript	ENST00000377811.4	protein_coding	3/3	369/586	346/462	116/153		chrX	TogoVar
NDUFB11_chrX_47137216_47149702	47142711	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA19086.hp1 NA19086.hp1	a0004 a0004	a0004c0002 a0004c0002	a0004c0002t0001 a0004c0002t0001	a0004c0002t0001g0038 a0004c0002t0001g0038	1	274	0.0037	1	c.240 others(4): Show c.240dupC	p.Val others(4): Show p.Val81fs	NDUFB11	ENSG00000147123.12	transcript	ENST00000377811.4	protein_coding	2/3	263/586	240/462	80/153		chrX	TogoVar
NDUFB11_chrX_47137216_47149702	47144545	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19056.hp1 NA19056.hp1	a0003 a0003	a0003c0005 a0003c0005	a0003c0005t0001 a0003c0005t0001	a0003c0005t0001g0067 a0003c0005t0001g0067	1	274	0.0037	1	c.134 others(4): Show c.134dupG	p.Arg others(4): Show p.Arg47fs	NDUFB11	ENSG00000147123.12	transcript	ENST00000377811.4	protein_coding	1/3	157/586	134/462	45/153		chrX	TogoVar
NDUFB11_chrX_47137216_47149702	47144667	G G	GCC GCC	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0002 a0002	a0002c0006 a0002c0006	a0002c0006t0001 a0002c0006t0001	a0002c0006t0001g0068 a0002c0006t0001g0068	1	274	0.0037	2	c.11_ others(7): Show c.11_12dupGG	p.Leu others(3): Show p.Leu5fs	NDUFB11	ENSG00000147123.12	transcript	ENST00000377811.4	protein_coding	1/3	35/586	12/462	4/153		chrX	TogoVar
NDUFS3_chr11_47574074_47589562	47580556	C C	CTGACAGA others(4): Show CTGACAGACACG	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA18991.hp2 NA18991.hp2	a0004 a0004	a0004c0005 a0004c0005	a0004c0005t0001 a0004c0005t0001	a0004c0005t0001g0057 a0004c0005t0001g0057	1	422	0.0024	11	c.165 others(18): Show c.165_166insTGACAGACACG	p.Lys others(4): Show p.Lys56fs	NDUFS3	ENSG00000213619.11	transcript	ENST00000263774.9	protein_coding	3/7	184/894	166/795	56/264		chr11	TogoVar
NEFH_chr22_29475218_29496390	29489267	G G	GAAGTCAA others(39): Show GAAGTCAAGTCCCCTGAGAAGGCCAAGTCTCCAGCAAAGGAAGAGGC	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	NA19089.hp2 NA19089.hp2	a0017 a0017	a0017c0023 a0017c0023	a0017c0023t0001 a0017c0023t0001	a0017c0023t0001g0104 a0017c0023t0001g0104	1	448	0.0022	46	c.163 others(55): Show c.1630_1675dupGTCAAGTCCCCTGAGAAGGCCAAGTCTCCAGCAAAG GAAGAGGCAA	p.Lys others(5): Show p.Lys559fs	NEFH	ENSG00000100285.10	transcript	ENST00000310624.7	protein_coding	4/4	1721/3795	1676/3063	559/1020	INFO_REALIGN_3_PRIME	chr22	TogoVar
NEK3_chr13_52127647_52164597	52143914	CT CT	C C	frameshift_variant others(1): Show frameshift_variant splice_region_variant	HIGH	HG00099.hp2 HG00408.hp1 HG00438.hp2 others(211): Show HG00099.hp2 HG00408.hp1 HG00438.hp2 HG00544.hp1 HG00544.hp2 HG00558.hp2 HG00597.hp1 HG00609.hp2 HG00642.hp2 HG00673.hp2 HG00738.hp2 HG01069.hp2 HG01070.hp2 HG01071.hp2 HG01074.hp2 HG01081.hp1 HG01099.hp1 HG01099.hp2 HG01109.hp1 HG01123.hp1 HG01167.hp1 HG01167.hp2 HG01168.hp2 HG01243.hp2 HG01255.hp1 HG01346.hp1 HG01496.hp1 HG01496.hp2 HG01516.hp1 HG01516.hp2 HG01517.hp2 HG01884.hp2 HG01891.hp1 HG01943.hp2 HG01975.hp1 HG01975.hp2 HG01981.hp1 HG01993.hp1 HG02004.hp2 HG02015.hp1 HG02040.hp1 HG02040.hp2 HG02055.hp1 HG02071.hp1 HG02074.hp1 HG02083.hp2 HG02109.hp1 HG02109.hp2 HG02129.hp2 HG02155.hp2 HG02165.hp2 HG02257.hp2 HG02258.hp2 HG02293.hp1 HG02300.hp2 HG02451.hp1 HG02451.hp2 HG02523.hp1 HG02523.hp2 HG02559.hp1 HG02559.hp2 HG02572.hp2 HG02602.hp1 HG02615.hp1 HG02615.hp2 HG02622.hp1 HG02622.hp2 HG02630.hp1 HG02630.hp2 HG02647.hp1 HG02698.hp1 HG02717.hp1 HG02717.hp2 HG02735.hp2 HG02738.hp2 HG02809.hp1 HG02809.hp2 HG02886.hp1 HG02886.hp2 HG02895.hp1 HG02896.hp1 HG02896.hp2 HG02897.hp2 HG02922.hp1 HG02922.hp2 HG02965.hp2 HG02970.hp1 HG02970.hp2 HG02976.hp1 HG02976.hp2 HG03017.hp1 HG03017.hp2 HG03041.hp1 HG03041.hp2 HG03098.hp1 HG03098.hp2 HG03139.hp1 HG03195.hp1 HG03195.hp2 HG03209.hp1 HG03209.hp2 HG03225.hp1 HG03225.hp2 HG03239.hp1 HG03239.hp2 HG03453.hp1 HG03453.hp2 HG03471.hp1 HG03471.hp2 HG03490.hp1 HG03490.hp2 HG03491.hp2 HG03492.hp1 HG03516.hp1 HG03516.hp2 HG03579.hp1 HG03579.hp2 HG03654.hp2 HG03669.hp1 HG03669.hp2 HG03688.hp1 HG03688.hp2 HG03704.hp1 HG03710.hp1 HG03831.hp2 HG04115.hp1 HG04199.hp1 HG04199.hp2 HG04228.hp1 HG06807.hp2 NA18522.hp1 NA18522.hp2 NA18612.hp1 NA18747.hp1 NA18747.hp2 NA18906.hp1 NA18941.hp2 NA18942.hp1 NA18944.hp2 NA18945.hp1 NA18947.hp2 NA18948.hp1 NA18950.hp1 NA18951.hp2 NA18953.hp1 NA18954.hp2 NA18955.hp2 NA18956.hp2 NA18959.hp2 NA18960.hp2 NA18963.hp1 NA18964.hp2 NA18965.hp1 NA18966.hp1 NA18968.hp1 NA18969.hp2 NA18971.hp1 NA18972.hp2 NA18973.hp1 NA18974.hp1 NA18975.hp1 NA18975.hp2 NA18978.hp1 NA18979.hp2 NA18981.hp2 NA18982.hp1 NA18982.hp2 NA18983.hp2 NA18984.hp1 NA18985.hp1 NA18986.hp1 NA18986.hp2 NA18989.hp1 NA18993.hp2 NA18994.hp1 NA18994.hp2 NA18995.hp1 NA19002.hp1 NA19007.hp2 NA19009.hp2 NA19011.hp2 NA19012.hp2 NA19030.hp1 NA19030.hp2 NA19043.hp1 NA19043.hp2 NA19056.hp1 NA19056.hp2 NA19060.hp2 NA19063.hp1 NA19064.hp2 NA19065.hp2 NA19066.hp1 NA19066.hp2 NA19067.hp2 NA19068.hp2 NA19074.hp1 NA19074.hp2 NA19075.hp1 NA19077.hp1 NA19079.hp2 NA19080.hp1 NA19080.hp2 NA19082.hp2 NA19085.hp1 NA19085.hp2 NA19087.hp1 NA19089.hp2 NA19091.hp1 NA19240.hp1 NA20129.hp1 NA20300.hp1 NA20752.hp1 homoSapiens_chm13v2.hp1	a0001 a0006 a0010 a0001 a0006 a0010	a0001c0001 a0006c0012 a0010c0010 a0001c0001 a0006c0012 a0010c0010	a0001c0001t0001 a0001c0001t0006 a0006c0012t0001 others(1): Show a0001c0001t0001 a0001c0001t0006 a0006c0012t0001 a0010c0010t0001	a0001c0001t0001g0001 a0001c0001t0001g0006 a0001c0001t0001g0007 others(99): Show a0001c0001t0001g0001 a0001c0001t0001g0006 a0001c0001t0001g0007 a0001c0001t0001g0009 a0001c0001t0001g0010 a0001c0001t0001g0012 a0001c0001t0001g0013 a0001c0001t0001g0016 a0001c0001t0001g0017 a0001c0001t0001g0018 a0001c0001t0001g0020 a0001c0001t0001g0022 a0001c0001t0001g0023 a0001c0001t0001g0024 a0001c0001t0001g0025 a0001c0001t0001g0026 a0001c0001t0001g0027 a0001c0001t0001g0028 a0001c0001t0001g0029 a0001c0001t0001g0040 a0001c0001t0001g0041 a0001c0001t0001g0042 a0001c0001t0001g0043 a0001c0001t0001g0044 a0001c0001t0001g0045 a0001c0001t0001g0046 a0001c0001t0001g0047 a0001c0001t0001g0048 a0001c0001t0001g0049 a0001c0001t0001g0052 a0001c0001t0001g0053 a0001c0001t0001g0108 a0001c0001t0001g0109 a0001c0001t0001g0111 a0001c0001t0001g0115 a0001c0001t0001g0116 a0001c0001t0001g0117 a0001c0001t0001g0118 a0001c0001t0001g0119 a0001c0001t0001g0120 a0001c0001t0001g0121 a0001c0001t0001g0122 a0001c0001t0001g0123 a0001c0001t0001g0124 a0001c0001t0001g0125 a0001c0001t0001g0126 a0001c0001t0001g0127 a0001c0001t0001g0128 a0001c0001t0001g0129 a0001c0001t0001g0130 a0001c0001t0001g0131 a0001c0001t0001g0132 a0001c0001t0001g0133 a0001c0001t0001g0134 a0001c0001t0001g0135 a0001c0001t0001g0136 a0001c0001t0001g0137 a0001c0001t0001g0138 a0001c0001t0001g0139 a0001c0001t0001g0140 a0001c0001t0001g0141 a0001c0001t0001g0142 a0001c0001t0001g0143 a0001c0001t0001g0144 a0001c0001t0001g0145 a0001c0001t0001g0146 a0001c0001t0001g0147 a0001c0001t0001g0149 a0001c0001t0001g0150 a0001c0001t0001g0152 a0001c0001t0001g0153 a0001c0001t0001g0154 a0001c0001t0001g0155 a0001c0001t0001g0156 a0001c0001t0001g0157 a0001c0001t0001g0158 a0001c0001t0001g0159 a0001c0001t0001g0160 a0001c0001t0001g0161 a0001c0001t0001g0162 a0001c0001t0001g0163 a0001c0001t0001g0164 a0001c0001t0001g0165 a0001c0001t0001g0166 a0001c0001t0001g0167 a0001c0001t0001g0168 a0001c0001t0001g0169 a0001c0001t0001g0170 a0001c0001t0001g0171 a0001c0001t0001g0172 a0001c0001t0001g0173 a0001c0001t0001g0175 a0001c0001t0001g0176 a0001c0001t0001g0177 a0001c0001t0001g0178 a0001c0001t0001g0181 a0001c0001t0001g0182 a0001c0001t0001g0183 a0001c0001t0006g0051 a0001c0001t0006g0180 a0006c0012t0001g0174 a0010c0010t0001g0148	214	398	0.5377	-1	c.877 others(4): Show c.877delA	p.Thr others(5): Show p.Thr293fs	NEK3	ENSG00000136098.18	transcript	ENST00000610828.5	protein_coding	10/16	989/2128	877/1521	293/506		chr13	TogoVar
NEXMIF_chrX_74727856_74930452	74741098	G G	GT GT	frameshift_variant frameshift_variant	HIGH	HG02056.hp1 HG02056.hp1	a0005 a0005	a0005c0007 a0005c0007	a0005c0007t0003 a0005c0007t0003	a0005c0007t0003g0016 a0005c0007t0003g0016	1	224	0.0045	1	c.345 others(5): Show c.3458dupA	p.Asn others(6): Show p.Asn1153fs	NEXMIF	ENSG00000050030.16	transcript	ENST00000055682.12	protein_coding	3/4	4075/11717	3458/4551	1153/1516		chrX	TogoVar
NFILZ_chr19_8625633_8686151	8677070	G G	GTGGGCCC others(39): Show GTGGGCCCCGGGCCTTGCCCCTGCAGGCTCTGCTATTGGAAGCCCCC	frameshift_variant frameshift_variant	HIGH	NA20805.hp2 NA20805.hp2	a0011 a0011	a0011c0014 a0011c0014	a0011c0014t0165 a0011c0014t0165	a0011c0014t0165g0109 a0011c0014t0165g0109	1	366	0.0027	46	c.309 others(53): Show c.309_354dupGCCCCGGGCCTTGCCCCTGCAGGCTCTGCTATTGGAAG CCCCCTGG	p.Thr others(5): Show p.Thr119fs	NFILZ	ENSG00000268480.4	transcript	ENST00000691075.1	protein_coding	6/6	877/4908	355/870	119/289	INFO_REALIGN_3_PRIME	chr19	TogoVar
NFKB2_chr10_102390705_102407524	102398784	T T	TCTCCCAG others(13): Show TCTCCCAGCCCTTCGGGGGTG	frameshift_variant frameshift_variant	HIGH	NA19078.hp2 NA19078.hp2	a0004 a0004	a0004c0011 a0004c0011	a0004c0011t0001 a0004c0011t0001	a0004c0011t0001g0012 a0004c0011t0001g0012	1	424	0.0024	20	c.103 others(29): Show c.1038_1057dupCTCCCAGCCCTTCGGGGGTG	p.Gly others(5): Show p.Gly353fs	NFKB2	ENSG00000077150.21	transcript	ENST00000661543.1	protein_coding	12/23	1222/3015	1058/2703	353/900	INFO_REALIGN_3_PRIME	chr10	TogoVar
NFKBIL1_chr6_31542608_31563829	31558520	GCCAGATT others(19): Show GCCAGATTGAGACCTGGGAGCTGGGCC	G G	frameshift_variant frameshift_variant	HIGH	NA18978.hp2 NA18978.hp2	a0000 a0000	a0000c0006 a0000c0006	a0000c0006t0001 a0000c0006t0001	a0000c0006t0001g0021 a0000c0006t0001g0021	1	449	0.0022	-26	c.105 others(35): Show c.1056_1081delCCAGATTGAGACCTGGGAGCTGGGCC	p.Ser others(5): Show p.Ser352fs	NFKBIL1	ENSG00000204498.11	transcript	ENST00000376148.9	protein_coding	4/4	1143/1451	1056/1146	352/381		chr6	TogoVar
NFRKB_chr11_129858636_129900578	129881473	TGAATTCA others(4): Show TGAATTCAACAA	T T	frameshift_variant frameshift_variant	HIGH	NA18960.hp1 NA18960.hp1	a0006 a0006	a0006c0013 a0006c0013	a0006c0013t0001 a0006c0013t0001	a0006c0013t0001g0117 a0006c0013t0001g0117	1	410	0.0024	-11	c.134 others(20): Show c.1343_1353delTTGTTGAATTC	p.Phe others(5): Show p.Phe448fs	NFRKB	ENSG00000170322.15	transcript	ENST00000682444.1	protein_coding	13/27	1537/5173	1343/3900	448/1299		chr11	TogoVar
NHSL2_chrX_71905845_72158286	72142338	T T	TGAAGA TGAAGA	frameshift_variant frameshift_variant	HIGH	NA18977.hp1 NA18977.hp1	a0011 a0011	a0011c0009 a0011c0009	a0011c0009t0001 a0011c0009t0001	a0011c0009t0001g0176 a0011c0009t0001g0176	1	187	0.0054	5	c.333 others(14): Show c.3331_3335dupGAAGA	p.Asp others(6): Show p.Asp1112fs	NHSL2	ENSG00000204131.11	transcript	ENST00000633930.2	protein_coding	7/8	3579/13633	3336/3678	1112/1225	INFO_REALIGN_3_PRIME	chrX	TogoVar
NHSL2_chrX_71905845_72158286	72143256	CA CA	C C	frameshift_variant frameshift_variant	HIGH	NA18977.hp1 NA18977.hp1	a0011 a0011	a0011c0009 a0011c0009	a0011c0009t0001 a0011c0009t0001	a0011c0009t0001g0176 a0011c0009t0001g0176	1	187	0.0054	-1	c.336 others(5): Show c.3364delA	p.Arg others(6): Show p.Arg1122fs	NHSL2	ENSG00000204131.11	transcript	ENST00000633930.2	protein_coding	8/8	3607/13633	3364/3678	1122/1225	INFO_REALIGN_3_PRIME	chrX	TogoVar
NHSL2_chrX_71905845_72158286	72143300	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA18977.hp1 NA18977.hp1	a0011 a0011	a0011c0009 a0011c0009	a0011c0009t0001 a0011c0009t0001	a0011c0009t0001g0176 a0011c0009t0001g0176	1	187	0.0054	-1	c.340 others(5): Show c.3407delG	p.Gly others(6): Show p.Gly1136fs	NHSL2	ENSG00000204131.11	transcript	ENST00000633930.2	protein_coding	8/8	3650/13633	3407/3678	1136/1225	INFO_REALIGN_3_PRIME	chrX	TogoVar
NIBAN3_chr19_17522267_17558640	17542226	CTGGCAGC others(6): Show CTGGCAGCACCGTT	C C	frameshift_variant frameshift_variant	HIGH	HG00408.hp1 HG01978.hp1 NA18941.hp2 others(1): Show HG00408.hp1 HG01978.hp1 NA18941.hp2 NA19088.hp1	a0007 a0007	a0007c0010 a0007c0010	a0007c0010t0004 a0007c0010t0031 a0007c0010t0004 a0007c0010t0031	a0007c0010t0004g0096 a0007c0010t0004g0234 a0007c0010t0031g0039 others(1): Show a0007c0010t0004g0096 a0007c0010t0004g0234 a0007c0010t0031g0039 a0007c0010t0031g0060	4	404	0.0099	-13	c.126 others(22): Show c.1266_1278delAGCACCGTTTGGC	p.Ala others(5): Show p.Ala423fs	NIBAN3	ENSG00000167483.19	transcript	ENST00000599164.6	protein_coding	10/15	1340/3679	1266/1863	422/620	INFO_REALIGN_3_PRIME	chr19	TogoVar
NIM1K_chr5_43187225_43285850	43280050	A A	ATACTTGT others(9): Show ATACTTGTGTGAAGGGG	frameshift_variant frameshift_variant	HIGH	HG02165.hp2 HG02165.hp2	a0008 a0008	a0008c0013 a0008c0013	a0008c0013t0001 a0008c0013t0001	a0008c0013t0001g0161 a0008c0013t0001g0161	1	292	0.0034	16	c.632 others(23): Show c.632_633insTACTTGTGTGAAGGGG	p.Lys others(5): Show p.Lys211fs	NIM1K	ENSG00000177453.7	transcript	ENST00000326035.6	protein_coding	4/4	1514/2313	633/1311	211/436		chr5	TogoVar
NIT2_chr3_100329757_100366635	100334767	GCAGGTGG others(16): Show GCAGGTGGTGCTTGTCTGCAGAGT	G G	frameshift_variant others(1): Show frameshift_variant start_lost	HIGH	HG02683.hp2 HG04204.hp2 HG02683.hp2 HG04204.hp2	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0030 a0001c0001t0030	a0001c0001t0030g0001 a0001c0001t0030g0082 a0001c0001t0030g0001 a0001c0001t0030g0082	2	396	0.0051	-23	c.-22 others(28): Show c.-22_1delGGTGGTGCTTGTCTGCAGAGTCA	p.Met others(3): Show p.Met1fs	NIT2	ENSG00000114021.12	transcript	ENST00000394140.9	protein_coding	1/10	14/7233	1/831	1/276	INFO_REALIGN_3_PRIME	chr3	TogoVar
NKAP_chrX_119915672_119948751	119932126	A A	AT AT	frameshift_variant frameshift_variant	HIGH	NA18963.hp2 NA18963.hp2	a0008 a0008	a0008c0009 a0008c0009	a0008c0009t0001 a0008c0009t0001	a0008c0009t0001g0072 a0008c0009t0001g0072	1	320	0.0031	1	c.827 others(4): Show c.827dupA	p.Asn others(5): Show p.Asn276fs	NKAP	ENSG00000101882.10	transcript	ENST00000371410.5	protein_coding	6/9	973/5942	827/1248	276/415		chrX	TogoVar
NKAP_chrX_119915672_119948751	119936383	C C	CT CT	frameshift_variant frameshift_variant	HIGH	NA19001.hp2 NA19001.hp2	a0007 a0007	a0007c0008 a0007c0008	a0007c0008t0002 a0007c0008t0002	a0007c0008t0002g0149 a0007c0008t0002g0149	1	320	0.0031	1	c.586 others(4): Show c.586dupA	p.Arg others(5): Show p.Arg196fs	NKAP	ENSG00000101882.10	transcript	ENST00000371410.5	protein_coding	4/9	732/5942	586/1248	196/415		chrX	TogoVar
NKAP_chrX_119915672_119948751	119943243	C C	CT CT	frameshift_variant frameshift_variant	HIGH	NA19055.hp1 NA19055.hp1	a0006 a0006	a0006c0007 a0006c0007	a0006c0007t0001 a0006c0007t0001	a0006c0007t0001g0036 a0006c0007t0001g0036	1	320	0.0031	1	c.362 others(4): Show c.362dupA	p.Arg others(5): Show p.Arg122fs	NKAP	ENSG00000101882.10	transcript	ENST00000371410.5	protein_coding	1/9	508/5942	362/1248	121/415		chrX	TogoVar
NKAP_chrX_119915672_119948751	119943261	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA18993.hp1 NA18993.hp1	a0005 a0005	a0005c0006 a0005c0006	a0005c0006t0001 a0005c0006t0001	a0005c0006t0001g0035 a0005c0006t0001g0035	1	320	0.0031	1	c.344 others(4): Show c.344dupC	p.Ser others(5): Show p.Ser116fs	NKAP	ENSG00000101882.10	transcript	ENST00000371410.5	protein_coding	1/9	490/5942	344/1248	115/415		chrX	TogoVar
NKAP_chrX_119915672_119948751	119943267	AG AG	A A	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0010 a0010	a0010c0011 a0010c0011	a0010c0011t0013 a0010c0011t0013	a0010c0011t0013g0033 a0010c0011t0013g0033	1	320	0.0031	-1	c.338 others(4): Show c.338delC	p.Pro others(5): Show p.Pro113fs	NKAP	ENSG00000101882.10	transcript	ENST00000371410.5	protein_coding	1/9	484/5942	338/1248	113/415		chrX	TogoVar
NKAP_chrX_119915672_119948751	119943332	AG AG	A A	frameshift_variant frameshift_variant	HIGH	NA18946.hp1 NA18946.hp1	a0004 a0004	a0004c0005 a0004c0005	a0004c0005t0002 a0004c0005t0002	a0004c0005t0002g0034 a0004c0005t0002g0034	1	320	0.0031	-1	c.273 others(4): Show c.273delC	p.Phe others(4): Show p.Phe92fs	NKAP	ENSG00000101882.10	transcript	ENST00000371410.5	protein_coding	1/9	419/5942	273/1248	91/415		chrX	TogoVar
NKAP_chrX_119915672_119948751	119943356	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0010 a0010	a0010c0011 a0010c0011	a0010c0011t0013 a0010c0011t0013	a0010c0011t0013g0033 a0010c0011t0013g0033	1	320	0.0031	1	c.249 others(4): Show c.249dupG	p.Pro others(4): Show p.Pro84fs	NKAP	ENSG00000101882.10	transcript	ENST00000371410.5	protein_coding	1/9	395/5942	249/1248	83/415		chrX	TogoVar
NKAP_chrX_119915672_119948751	119943451	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0010 a0010	a0010c0011 a0010c0011	a0010c0011t0013 a0010c0011t0013	a0010c0011t0013g0033 a0010c0011t0013g0033	1	320	0.0031	-1	c.154 others(4): Show c.154delG	p.Asp others(4): Show p.Asp52fs	NKAP	ENSG00000101882.10	transcript	ENST00000371410.5	protein_coding	1/9	300/5942	154/1248	52/415		chrX	TogoVar
NKAP_chrX_119915672_119948751	119943472	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0010 a0010	a0010c0011 a0010c0011	a0010c0011t0013 a0010c0011t0013	a0010c0011t0013g0033 a0010c0011t0013g0033	1	320	0.0031	1	c.133 others(4): Show c.133dupC	p.His others(4): Show p.His45fs	NKAP	ENSG00000101882.10	transcript	ENST00000371410.5	protein_coding	1/9	279/5942	133/1248	45/415		chrX	TogoVar
NKAP_chrX_119915672_119948751	119943495	C C	CGG CGG	frameshift_variant frameshift_variant	HIGH	NA18946.hp1 NA18946.hp1	a0004 a0004	a0004c0005 a0004c0005	a0004c0005t0002 a0004c0005t0002	a0004c0005t0002g0034 a0004c0005t0002g0034	1	320	0.0031	2	c.109 others(9): Show c.109_110dupCC	p.Arg others(4): Show p.Arg40fs	NKAP	ENSG00000101882.10	transcript	ENST00000371410.5	protein_coding	1/9	256/5942	110/1248	37/415		chrX	TogoVar
NKAP_chrX_119915672_119948751	119943549	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA19081.hp2 NA19081.hp2	a0003 a0003	a0003c0004 a0003c0004	a0003c0004t0037 a0003c0004t0037	a0003c0004t0037g0192 a0003c0004t0037g0192	1	320	0.0031	-1	c.56d others(3): Show c.56delG	p.Gly others(4): Show p.Gly19fs	NKAP	ENSG00000101882.10	transcript	ENST00000371410.5	protein_coding	1/9	202/5942	56/1248	19/415		chrX	TogoVar
NKX6-3_chr8_41640177_41655817	41650427	CATCTCCG others(7): Show CATCTCCGGAAACTG	C C	frameshift_variant frameshift_variant	HIGH	NA19056.hp1 NA19056.hp1	a0006 a0006	a0006c0014 a0006c0014	a0006c0014t0001 a0006c0014t0001	a0006c0014t0001g0087 a0006c0014t0001g0087	1	434	0.0023	-14	c.52_ others(19): Show c.52_65delCAGTTTCCGGAGAT	p.Gln others(4): Show p.Gln18fs	NKX6-3	ENSG00000165066.13	transcript	ENST00000518699.4	protein_coding	1/3	390/2395	52/798	18/265		chr8	TogoVar
NLGN2_chr17_7402845_7424860	7417688	A A	AC AC	frameshift_variant frameshift_variant	HIGH	HG00597.hp2 HG01192.hp2 HG01981.hp2 others(14): Show HG00597.hp2 HG01192.hp2 HG01981.hp2 HG01993.hp1 HG02055.hp1 HG02056.hp1 HG02071.hp1 HG02738.hp1 HG02738.hp2 HG02809.hp2 HG03927.hp1 HG03942.hp2 HG04115.hp2 NA18962.hp1 NA18980.hp1 NA18993.hp2 NA19080.hp2	a0000 a0000	a0000c0008 a0000c0010 a0000c0011 others(2): Show a0000c0008 a0000c0010 a0000c0011 a0000c0019 a0000c0026	a0000c0008t0001 a0000c0008t0003 a0000c0008t0006 others(8): Show a0000c0008t0001 a0000c0008t0003 a0000c0008t0006 a0000c0010t0004 a0000c0010t0005 a0000c0010t0007 a0000c0010t0026 a0000c0011t0006 a0000c0011t0035 a0000c0019t0006 a0000c0026t0007	a0000c0008t0001g0001 a0000c0008t0001g0003 a0000c0008t0001g0005 others(13): Show a0000c0008t0001g0001 a0000c0008t0001g0003 a0000c0008t0001g0005 a0000c0008t0003g0001 a0000c0008t0003g0003 a0000c0008t0003g0038 a0000c0008t0006g0107 a0000c0010t0004g0006 a0000c0010t0005g0030 a0000c0010t0007g0007 a0000c0010t0026g0071 a0000c0011t0006g0002 a0000c0011t0006g0010 a0000c0011t0035g0002 a0000c0019t0006g0012 a0000c0026t0007g0117	17	418	0.0407	1	c.240 others(5): Show c.2402dupC	p.Pro others(5): Show p.Pro802fs	NLGN2	ENSG00000169992.10	transcript	ENST00000302926.7	protein_coding	7/7	2814/4980	2403/2508	801/835	INFO_REALIGN_3_PRIME	chr17	TogoVar
NLGN3_chrX_71139841_71176201	71167098	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0008 a0008	a0008c0007 a0008c0007	a0008c0007t0008 a0008c0007t0008	a0008c0007t0008g0052 a0008c0007t0008g0052	1	278	0.0036	-1	c.100 others(5): Show c.1003delG	p.Ala others(5): Show p.Ala335fs	NLGN3	ENSG00000196338.15	transcript	ENST00000358741.4	protein_coding	7/8	1327/3975	1003/2547	335/848	INFO_REALIGN_3_PRIME	chrX	TogoVar
NLGN3_chrX_71139841_71176201	71167437	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0008 a0008	a0008c0007 a0008c0007	a0008c0007t0008 a0008c0007t0008	a0008c0007t0008g0052 a0008c0007t0008g0052	1	278	0.0036	1	c.134 others(5): Show c.1342dupG	p.Asp others(5): Show p.Asp448fs	NLGN3	ENSG00000196338.15	transcript	ENST00000358741.4	protein_coding	7/8	1667/3975	1343/2547	448/848	INFO_REALIGN_3_PRIME	chrX	TogoVar
NLGN3_chrX_71139841_71176201	71167459	CA CA	C C	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0008 a0008	a0008c0007 a0008c0007	a0008c0007t0008 a0008c0007t0008	a0008c0007t0008g0052 a0008c0007t0008g0052	1	278	0.0036	-1	c.136 others(5): Show c.1364delA	p.Lys others(5): Show p.Lys455fs	NLGN3	ENSG00000196338.15	transcript	ENST00000358741.4	protein_coding	7/8	1688/3975	1364/2547	455/848	INFO_REALIGN_3_PRIME	chrX	TogoVar
NLGN3_chrX_71139841_71176201	71167580	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0008 a0008	a0008c0007 a0008c0007	a0008c0007t0008 a0008c0007t0008	a0008c0007t0008g0052 a0008c0007t0008g0052	1	278	0.0036	1	c.148 others(5): Show c.1486dupC	p.Arg others(5): Show p.Arg496fs	NLGN3	ENSG00000196338.15	transcript	ENST00000358741.4	protein_coding	7/8	1811/3975	1487/2547	496/848	INFO_REALIGN_3_PRIME	chrX	TogoVar
NLGN3_chrX_71139841_71176201	71167594	G G	GCTCTA GCTCTA	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0008 a0008	a0008c0007 a0008c0007	a0008c0007t0008 a0008c0007t0008	a0008c0007t0008g0052 a0008c0007t0008g0052	1	278	0.0036	5	c.149 others(14): Show c.1498_1499insTCTAC	p.Pro others(5): Show p.Pro500fs	NLGN3	ENSG00000196338.15	transcript	ENST00000358741.4	protein_coding	7/8	1823/3975	1499/2547	500/848	INFO_REALIGN_3_PRIME	chrX	TogoVar
NLGN3_chrX_71139841_71176201	71169316	AG AG	A A	frameshift_variant frameshift_variant	HIGH	NA18994.hp1 NA18994.hp1	a0007 a0007	a0007c0009 a0007c0009	a0007c0009t0001 a0007c0009t0001	a0007c0009t0001g0213 a0007c0009t0001g0213	1	278	0.0036	-1	c.176 others(5): Show c.1768delG	p.Glu others(5): Show p.Glu590fs	NLGN3	ENSG00000196338.15	transcript	ENST00000358741.4	protein_coding	8/8	2092/3975	1768/2547	590/848	INFO_REALIGN_3_PRIME	chrX	TogoVar
NLGN3_chrX_71139841_71176201	71169516	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0008 a0008	a0008c0007 a0008c0007	a0008c0007t0008 a0008c0007t0008	a0008c0007t0008g0052 a0008c0007t0008g0052	1	278	0.0036	1	c.196 others(5): Show c.1969dupC	p.His others(5): Show p.His657fs	NLGN3	ENSG00000196338.15	transcript	ENST00000358741.4	protein_coding	8/8	2294/3975	1970/2547	657/848	INFO_REALIGN_3_PRIME	chrX	TogoVar
NLGN3_chrX_71139841_71176201	71169884	T T	TC TC	frameshift_variant frameshift_variant	HIGH	HG01433.hp1 HG02615.hp1 HG02738.hp1 others(4): Show HG01433.hp1 HG02615.hp1 HG02738.hp1 HG04184.hp1 NA18990.hp1 NA19030.hp2 NA19086.hp1	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0001 a0002c0002t0005 a0002c0002t0001 a0002c0002t0005	a0002c0002t0001g0008 a0002c0002t0001g0084 a0002c0002t0001g0085 others(4): Show a0002c0002t0001g0008 a0002c0002t0001g0084 a0002c0002t0001g0085 a0002c0002t0001g0092 a0002c0002t0001g0210 a0002c0002t0001g0214 a0002c0002t0005g0146	7	278	0.0252	1	c.234 others(5): Show c.2341dupC	p.His others(5): Show p.His781fs	NLGN3	ENSG00000196338.15	transcript	ENST00000358741.4	protein_coding	8/8	2666/3975	2342/2547	781/848	INFO_REALIGN_3_PRIME	chrX	TogoVar
NLGN3_chrX_71139841_71176201	71170003	TG TG	T T	frameshift_variant frameshift_variant	HIGH	HG03579.hp1 HG03579.hp1	a0005 a0005	a0005c0012 a0005c0012	a0005c0012t0001 a0005c0012t0001	a0005c0012t0001g0123 a0005c0012t0001g0123	1	278	0.0036	-1	c.245 others(5): Show c.2455delG	p.Val others(5): Show p.Val819fs	NLGN3	ENSG00000196338.15	transcript	ENST00000358741.4	protein_coding	8/8	2779/3975	2455/2547	819/848	INFO_REALIGN_3_PRIME	chrX	TogoVar
NLGN3_chrX_71139841_71176201	71170067	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0008 a0008	a0008c0007 a0008c0007	a0008c0007t0008 a0008c0007t0008	a0008c0007t0008g0052 a0008c0007t0008g0052	1	278	0.0036	1	c.252 others(5): Show c.2521dupC	p.His others(5): Show p.His841fs	NLGN3	ENSG00000196338.15	transcript	ENST00000358741.4	protein_coding	8/8	2846/3975	2522/2547	841/848	INFO_REALIGN_3_PRIME	chrX	TogoVar
NLGN4X_chrX_5885042_6233867	5903212	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19086.hp1 NA19086.hp1	a0002 a0002	a0002c0007 a0002c0007	a0002c0007t0001 a0002c0007t0001	a0002c0007t0001g0124 a0002c0007t0001g0124	1	128	0.0078	1	c.146 others(5): Show c.1465dupC	p.His others(5): Show p.His489fs	NLGN4X	ENSG00000146938.16	transcript	ENST00000381095.8	protein_coding	5/6	2097/5858	1465/2451	489/816		chrX	TogoVar
NMRK2_chr19_3928069_3947416	3937233	GTTTCAGC others(39): Show GTTTCAGCCCCAAGACCAAATAGCAGTTGGGGAAGACGGCTTCAAAC	G G	frameshift_variant others(3): Show frameshift_variant splice_acceptor_variant splice_region_variant intron_variant	HIGH	NA18954.hp2 NA18954.hp2	a0008 a0008	a0008c0008 a0008c0008	a0008c0008t0001 a0008c0008t0001	a0008c0008t0001g0194 a0008c0008t0001g0194	1	404	0.0025	-46	c.118 others(55): Show c.118-6_157delTTTCAGCCCCAAGACCAAATAGCAGTTGGGGAAGAC GGCTTCAAAC	p.Pro others(4): Show p.Pro40fs	NMRK2	ENSG00000077009.14	transcript	ENST00000168977.7	protein_coding	4/8		118/693	40/230		chr19	TogoVar
NMUR1_chr2_231518187_231535445	231528812	ATCAGCAG others(7): Show ATCAGCAGGTATGTG	A A	frameshift_variant frameshift_variant	HIGH	NA18939.hp2 NA18939.hp2	a0005 a0005	a0005c0013 a0005c0013	a0005c0013t0001 a0005c0013t0001	a0005c0013t0001g0096 a0005c0013t0001g0096	1	428	0.0023	-14	c.195 others(21): Show c.195_208delCACATACCTGCTGA	p.Thr others(4): Show p.Thr66fs	NMUR1	ENSG00000171596.7	transcript	ENST00000305141.5	protein_coding	2/3	292/3221	195/1281	65/426		chr2	TogoVar
NOC4L_chr12_132139457_132157468	132148890	A A	ACCTTGGT others(37): Show ACCTTGGTGAGTGCCGCCGCCTCACTCACACCACACCCCTAATCC	frameshift_variant others(1): Show frameshift_variant splice_region_variant	HIGH	HG03098.hp1 HG03098.hp1	a0013 a0013	a0013c0036 a0013c0036	a0013c0036t0001 a0013c0036t0001	a0013c0036t0001g0080 a0013c0036t0001g0080	1	294	0.0034	44	c.899 others(51): Show c.899_900insTGGTGAGTGCCGCCGCCTCACTCACACCACACCCCTAA TCCCCT	p.Gly others(5): Show p.Gly302fs	NOC4L	ENSG00000184967.7	transcript	ENST00000330579.6	protein_coding	9/15	932/1650	900/1551	300/516	INFO_REALIGN_3_PRIME	chr12	TogoVar
NOC4L_chr12_132139457_132157468	132151328	G G	GC GC	frameshift_variant frameshift_variant	HIGH	HG00642.hp2 HG00735.hp2 HG02080.hp2 others(5): Show HG00642.hp2 HG00735.hp2 HG02080.hp2 HG03516.hp1 NA18941.hp2 NA18947.hp2 NA19056.hp1 NA19056.hp2	a0002 a0003 a0005 a0002 a0003 a0005	a0002c0037 a0003c0008 a0003c0020 others(3): Show a0002c0037 a0003c0008 a0003c0020 a0003c0035 a0003c0043 a0005c0038	a0002c0037t0001 a0003c0008t0001 a0003c0020t0001 others(3): Show a0002c0037t0001 a0003c0008t0001 a0003c0020t0001 a0003c0035t0001 a0003c0043t0001 a0005c0038t0001	a0002c0037t0001g0041 a0003c0008t0001g0013 a0003c0008t0001g0117 others(5): Show a0002c0037t0001g0041 a0003c0008t0001g0013 a0003c0008t0001g0117 a0003c0008t0001g0164 a0003c0020t0001g0002 a0003c0035t0001g0047 a0003c0043t0001g0253 a0005c0038t0001g0219	8	294	0.0272	1	c.103 others(5): Show c.1036dupC	p.Arg others(5): Show p.Arg346fs	NOC4L	ENSG00000184967.7	transcript	ENST00000330579.6	protein_coding	11/15	1069/1650	1037/1551	346/516	INFO_REALIGN_3_PRIME	chr12	TogoVar
NOL7_chr6_13610335_13626712	13620476	AATGCTTG others(4): Show AATGCTTGGGGT	A A	frameshift_variant others(3): Show frameshift_variant splice_donor_variant splice_region_variant intron_variant	HIGH	NA19068.hp1 NA19068.hp1	a0004 a0004	a0004c0008 a0004c0008	a0004c0008t0001 a0004c0008t0001	a0004c0008t0001g0033 a0004c0008t0001g0033	1	452	0.0022	-11	c.693 others(20): Show c.693_700+3delTGCTTGGGGTA	p.Asn others(5): Show p.Asn231fs	NOL7	ENSG00000225921.7	transcript	ENST00000451315.7	protein_coding	7/8	717/1683	693/774	231/257	INFO_REALIGN_3_PRIME	chr6	TogoVar

Search by Variant

Search

Search Results (Total: 5828 hits)